GGRNA Home | Help | Advanced search

2020-10-26 19:24:44, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001165946            4480 bp    mRNA    linear   PRI 15-JUL-2013
DEFINITION  Homo sapiens insulin-degrading enzyme (IDE), transcript variant 2,
            mRNA.
ACCESSION   NM_001165946
VERSION     NM_001165946.1  GI:260099675
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4480)
  AUTHORS   Leal,M.C., Magnani,N., Villordo,S., Buslje,C.M., Evelson,P.,
            Castano,E.M. and Morelli,L.
  TITLE     Transcriptional regulation of insulin-degrading enzyme modulates
            mitochondrial amyloid beta (Abeta) peptide catabolism and
            functionality
  JOURNAL   J. Biol. Chem. 288 (18), 12920-12931 (2013)
   PUBMED   23525105
  REMARK    GeneRIF: IDE-Met(1) links the mitochondrial biogenesis pathway with
            mitAbeta levels and organelle functionality.
REFERENCE   2  (bases 1 to 4480)
  AUTHORS   Wilk,J.B., Shrine,N.R., Loehr,L.R., Zhao,J.H., Manichaikul,A.,
            Lopez,L.M., Smith,A.V., Heckbert,S.R., Smolonska,J., Tang,W.,
            Loth,D.W., Curjuric,I., Hui,J., Cho,M.H., Latourelle,J.C.,
            Henry,A.P., Aldrich,M., Bakke,P., Beaty,T.H., Bentley,A.R.,
            Borecki,I.B., Brusselle,G.G., Burkart,K.M., Chen,T.H., Couper,D.,
            Crapo,J.D., Davies,G., Dupuis,J., Franceschini,N., Gulsvik,A.,
            Hancock,D.B., Harris,T.B., Hofman,A., Imboden,M., James,A.L.,
            Khaw,K.T., Lahousse,L., Launer,L.J., Litonjua,A., Liu,Y.,
            Lohman,K.K., Lomas,D.A., Lumley,T., Marciante,K.D., McArdle,W.L.,
            Meibohm,B., Morrison,A.C., Musk,A.W., Myers,R.H., North,K.E.,
            Postma,D.S., Psaty,B.M., Rich,S.S., Rivadeneira,F., Rochat,T.,
            Rotter,J.I., Artigas,M.S., Starr,J.M., Uitterlinden,A.G.,
            Wareham,N.J., Wijmenga,C., Zanen,P., Province,M.A., Silverman,E.K.,
            Deary,I.J., Palmer,L.J., Cassano,P.A., Gudnason,V., Barr,R.G.,
            Loos,R.J., Strachan,D.P., London,S.J., Boezen,H.M.,
            Probst-Hensch,N., Gharib,S.A., Hall,I.P., O'Connor,G.T., Tobin,M.D.
            and Stricker,B.H.
  TITLE     Genome-wide association studies identify CHRNA5/3 and HTR4 in the
            development of airflow obstruction
  JOURNAL   Am. J. Respir. Crit. Care Med. 186 (7), 622-632 (2012)
   PUBMED   22837378
REFERENCE   3  (bases 1 to 4480)
  AUTHORS   Cui,P.J., Cao,L., Wang,Y., Deng,Y.L., Xu,W., Wang,G., Zhang,Y.,
            Zheng,L., Fei,Q.Z., Zhang,T. and Chen,S.D.
  TITLE     The association between two single nucleotide polymorphisms within
            the insulin-degrading enzyme gene and Alzheimer's disease in a
            Chinese Han population
  JOURNAL   J Clin Neurosci 19 (5), 745-749 (2012)
   PUBMED   22502914
  REMARK    GeneRIF: In the context of APOEepsilon4-negative status,
            insulin-degrading enzyme variants are significantly associated with
            Alzheimer disease in some genetic models.
REFERENCE   4  (bases 1 to 4480)
  AUTHORS   Kumar,S., Singh,S., Hinze,D., Josten,M., Sahl,H.G., Siepmann,M. and
            Walter,J.
  TITLE     Phosphorylation of amyloid-beta peptide at serine 8 attenuates its
            clearance via insulin-degrading and angiotensin-converting enzymes
  JOURNAL   J. Biol. Chem. 287 (11), 8641-8651 (2012)
   PUBMED   22267728
  REMARK    GeneRIF: Phosphorylation of amyloid-beta peptide at serine 8
            attenuates its clearance via insulin-degrading and
            angiotensin-converting enzymes.
REFERENCE   5  (bases 1 to 4480)
  AUTHORS   Bartl,J., Scholz,C.J., Hinterberger,M., Jungwirth,S., Wichart,I.,
            Rainer,M.K., Kneitz,S., Danielczyk,W., Tragl,K.H., Fischer,P.,
            Riederer,P. and Grunblatt,E.
  TITLE     Disorder-specific effects of polymorphisms at opposing ends of the
            Insulin Degrading Enzyme gene
  JOURNAL   BMC Med. Genet. 12, 151 (2011)
   PUBMED   22107728
  REMARK    GeneRIF: The upstream polymorphism IDE2 was found to influence AD
            risk and to trigger the Abeta42 plasma level, whereas the
            downstream polymorphism IDE7 modified the T2DM risk; no
            associations were found for the intronic variant IDE9.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 4480)
  AUTHORS   Farris,W., Leissring,M.A., Hemming,M.L., Chang,A.Y. and Selkoe,D.J.
  TITLE     Alternative splicing of human insulin-degrading enzyme yields a
            novel isoform with a decreased ability to degrade insulin and
            amyloid beta-protein
  JOURNAL   Biochemistry 44 (17), 6513-6525 (2005)
   PUBMED   15850385
  REMARK    GeneRIF: This study systematically characterizes IDE mRNAs,
            identifies a novel, catalytically inefficient splice form and
            compares its subcellular distribution, kinetic properties and
            ability to degrade amyloid beta protein to the known isoform.
REFERENCE   7  (bases 1 to 4480)
  AUTHORS   Wroblewski,V.J., Masnyk,M., Khambatta,S.S. and Becker,G.W.
  TITLE     Mechanisms involved in degradation of human insulin by cytosolic
            fractions of human, monkey, and rat liver
  JOURNAL   Diabetes 41 (4), 539-547 (1992)
   PUBMED   1607078
REFERENCE   8  (bases 1 to 4480)
  AUTHORS   Ding,L., Becker,A.B., Suzuki,A. and Roth,R.A.
  TITLE     Comparison of the enzymatic and biochemical properties of human
            insulin-degrading enzyme and Escherichia coli protease III
  JOURNAL   J. Biol. Chem. 267 (4), 2414-2420 (1992)
   PUBMED   1733942
REFERENCE   9  (bases 1 to 4480)
  AUTHORS   Espinosa,R. III, Lemons,R.S., Perlman,R.K., Kuo,W.L., Rosner,M.R.
            and Le Beau,M.M.
  TITLE     Localization of the gene encoding insulin-degrading enzyme to human
            chromosome 10, bands q23----q25
  JOURNAL   Cytogenet. Cell Genet. 57 (4), 184-186 (1991)
   PUBMED   1743072
REFERENCE   10 (bases 1 to 4480)
  AUTHORS   Whitsett,J.A. and Lessard,J.L.
  TITLE     Characteristics of the microvillus brush border of human placenta:
            insulin receptor localization in brush border membranes
  JOURNAL   Endocrinology 103 (4), 1458-1468 (1978)
   PUBMED   758022
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB445060.1, AK316407.1,
            BX648462.1, CK824565.1, DA879845.1 and CF780766.1.
            
            Summary: This gene encodes a zinc metallopeptidase that degrades
            intracellular insulin, and thereby terminates insulins activity, as
            well as participating in intercellular peptide signalling by
            degrading diverse peptides such as glucagon, amylin, bradykinin,
            and kallidin. The preferential affinity of this enzyme for insulin
            results in insulin-mediated inhibition of the degradation of other
            peptides such as beta-amyloid. Deficiencies in this protein's
            function are associated with Alzheimer's disease and type 2
            diabetes mellitus but mutations in this gene have not been shown to
            be causitive for these diseases. This protein localizes primarily
            to the cytoplasm but in some cell types localizes to the
            extracellular space, cell membrane, peroxisome, and mitochondrion.
            Alternative splicing results in multiple transcript variants
            encoding distinct isoforms. Additional transcript variants have
            been described but have not been experimentally verified.[provided
            by RefSeq, Sep 2009].
            
            Transcript Variant: This variant (2) lacks multiple exons that are
            present in the 5' end of variant 1. Variant 2 contains a novel exon
            at its 5' end and begins translation from a downstream in-frame
            start codon, compared to variant 1. The encoded protein (isoform 2)
            lacks 555 amino acids from the N-terminus of isoform 1 but is
            identical to its C-terminal 464 amino acids. Compared to isoform 1,
            isoform 2 lacks two of three M16 peptidase domains and the
            N-terminal catalytic domain. The C-terminus of isoform 2 retains
            the oligomerization domain and peroxisomal targeting sequence
            present in isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK302578.1, AK316407.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-28                DB445060.1         1-28
            29-1778             AK316407.1         1-1750
            1779-3557           BX648462.1         3360-5138
            3558-3950           CK824565.1         174-566
            3951-4324           DA879845.1         122-495
            4325-4480           CF780766.1         284-439
FEATURES             Location/Qualifiers
     source          1..4480
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10q23-q25"
     gene            1..4480
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /note="insulin-degrading enzyme"
                     /db_xref="GeneID:3416"
                     /db_xref="HGNC:5381"
                     /db_xref="MIM:146680"
     exon            1..90
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    50..52
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /note="upstream in-frame stop codon"
     exon            91..193
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     exon            194..316
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     variation       277
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35426658"
     variation       307
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79491549"
     exon            317..399
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     CDS             326..1720
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /EC_number="3.4.24.56"
                     /note="isoform 2 is encoded by transcript variant 2;
                     insulinase; insulin protease; Abeta-degrading protease"
                     /codon_start=1
                     /product="insulin-degrading enzyme isoform 2"
                     /protein_id="NP_001159418.1"
                     /db_xref="GI:260099676"
                     /db_xref="CCDS:CCDS53554.1"
                     /db_xref="GeneID:3416"
                     /db_xref="HGNC:5381"
                     /db_xref="MIM:146680"
                     /translation="
MSKLWFKQDDKFFLPKACLNFEFFSPFAYVDPLHCNMAYLYLELLKDSLNEYAYAAELAGLSYDLQNTIYGMYLSVKGYNDKQPILLKKIIEKMATFEIDEKRFEIIKEAYMRSLNNFRAEQPHQHAMYYLRLLMTEVAWTKDELKEALDDVTLPRLKAFIPQLLSRLHIEALLHGNITKQAALGIMQMVEDTLIEHAHTKPLLPSQLVRYREVQLPDRGWFVYQQRNEVHNNCGIEIYYQTDMQSTSENMFLELFCQIISEPCFNTLRTKEQLGYIVFSGPRRANGIQGLRFIIQSEKPPHYLESRVEAFLITMEKSIEDMTEEAFQKHIQALAIRRLDKPKKLSAECAKYWGEIISQQYNFDRDNTEVAYLKTLTKEDIIKFYKEMLAVDAPRRHKVSVHVLAREMDSCPVVGEFPCQNDINLSQAPALPQPEVIQNMTEFKRGLPLFPLVKPHINFMAAKL
"
     misc_feature    776..1327
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /note="Peptidase M16 inactive domain; Region:
                     Peptidase_M16_C; pfam05193"
                     /db_xref="CDD:218490"
     exon            400..544
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     variation       406
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:5030982"
     exon            545..655
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     variation       559
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2229709"
     exon            656..776
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     STS             728..1634
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /standard_name="Ide"
                     /db_xref="UniSTS:506987"
     exon            777..868
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     variation       824
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76587725"
     exon            869..980
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     exon            981..1148
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     variation       1033
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35640611"
     exon            1149..1421
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     variation       1193
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042444"
     exon            1422..1483
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     exon            1484..1556
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     exon            1557..1624
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     exon            1625..4480
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /inference="alignment:Splign:1.39.8"
     STS             1755..1854
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /standard_name="GDB:193867"
                     /db_xref="UniSTS:155775"
     STS             1756..1853
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /standard_name="D10S2141"
                     /db_xref="UniSTS:20873"
     STS             3687..3870
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /standard_name="STS-D29519"
                     /db_xref="UniSTS:28873"
     STS             3747..3896
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
                     /standard_name="WI-17525"
                     /db_xref="UniSTS:60139"
     polyA_signal    3898..3903
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
     polyA_site      3917
                     /gene="IDE"
                     /gene_synonym="INSULYSIN"
ORIGIN      
agttgtaactgtagtaggtcagtgatacatggtgcaaaacagcctgggataatattgccagctgccagaccagactagggtggctcaaggggttgccatagtttctaaatcttttgaaggaaaaactgatcgcacagaagagtggtatggaacccagtacaaacaagaagctataccggatgaagtcatcaagaaatggcaaaatgctgacctgaatgggaaatttaaacttcctacaaagaatgaatttattcctacgaattttgagattttaccgttagaaaaagaggcgacaccataccctgctcttattaaggatacagctatgagcaaactttggttcaaacaagatgataagttttttttgccgaaggcttgtctcaactttgaatttttcagcccatttgcttatgtggaccccttgcactgtaacatggcctatttgtaccttgagctcctcaaagactcactcaacgagtatgcatatgcagcagagctagcaggcttgagctatgatctccaaaataccatctatgggatgtatctttcagtgaaaggttacaatgacaagcagccaattttactaaagaagattattgagaaaatggctacctttgagattgatgaaaaaagatttgaaattatcaaagaagcatatatgcgatctcttaacaatttccgggctgaacagcctcaccagcatgccatgtactacctccgcttgctgatgactgaagtggcctggactaaagatgagttaaaagaagctctggatgatgtaacccttcctcgccttaaggccttcatacctcagctcctgtcacggctgcacattgaagcccttctccatggaaacataacaaagcaggctgcattaggaattatgcagatggttgaagacaccctcattgaacatgctcataccaaacctctccttccaagtcagctggttcggtatagagaagttcagctccctgacagaggatggtttgtttatcagcagagaaatgaagttcacaataactgtggcatcgagatatactaccaaacagacatgcaaagcacctcagagaatatgtttctggagctcttctgtcagattatctcggaaccttgcttcaacaccctgcgcaccaaggagcagttgggctatatcgtcttcagcgggccacgtcgagctaatggcatacagggcttgagattcatcatccagtcagaaaagccacctcactacctagaaagcagagtggaagctttcttaattaccatggaaaagtccatagaggacatgacagaagaggccttccaaaaacacattcaggcattagcaattcgtcgactagacaaaccaaagaagctatctgctgagtgtgctaaatactggggagaaatcatctcccagcaatataattttgacagagataacactgaggttgcatatttaaagacacttaccaaggaagatatcatcaaattctacaaggaaatgttggcagtagatgctccaaggagacataaggtatccgtccatgttcttgccagggaaatggattcttgtcctgttgttggagagttcccatgtcaaaatgacataaatttgtcacaagcaccagccttgccacaacctgaagtgattcagaacatgaccgaattcaagcgtggtctgccactgtttccccttgtgaaaccacatattaacttcatggctgcaaaactctgaagattccccatgcatgggaaagtgcaagtggatgcattcctgagtcttccagagcctaagaaaatcatcttggccactttaatagtttctgattcactattagagaaacaaacaaaaaattgtcaaatgtcattatgtagaaatattataaatccaaagtaaattacaaaatcttatagatgtagaatattttttaaatacatgcctcttaaatattttaaaatttttcttttgattactgagagaaatttccccaatataacaatgcttaaaatgaatgatattcctatagaatcttccttccctattctgtaaaatagtcacttgtccgaagaaagttaaaagttagctcttttctaaaagcctcctagcttgacatagaaggcttcacaacatttagaaaggtaataactttttaaaaattgatcctcaaatttgctttctacttgatggtttcatgtaaatcagtggaaaacattacatttggcagatgataaagcaatgtcatcttttattagtgaaatgctggttatataaggcatggttttaatctttttataaaatttgaacatgttttttatgccaactcgtaaaatgctagaaaaccctacttatttacaatgctagaaatacagacttaccttacatcaattttgtcctaaaccgaatttctcaggattactgtggtttctttcattctgattgaattatattgacctacttcttcatagttggtttgcagtgttccatgagttttacttttcctcatcaacatattgctttaacacaacatatttatttaacacgtacaaatagggtcaacttcagatcctactgagtgtgtgacatgcttttccaacatcagctttttgtaaccacctgtataactttttattacagtgaaattgcagtcagtatgtgaaccaaaatatcttgcccctttatgaatttaaaaggcagccaatacaaagccacctttttggaaatataaaaagtaaagccttgcattcttatatagcaggtcttcataaaactctaaaatcccttgttgctaccagtctaatcttgccttaaatgttaagttattttttgaatatataaatataaacatataaacacagatgatgactggagtagacttttaaaaaaatatttttttcatgagatactattttaggtgaaattgttactgtagatttaacagctgttttgaaatatttactgttattaaaacttgcttcaagagaaattgtgaatatatttccatatacaagcactagtaacagtaagtggccctgtcatccactaactcaggcaaagtaaagaatggcatttttgaaggacattttacctccccatatgatttgattggctaggactttcttctgtaaagtcataccttttcacatcttaagtttttacatttgccattttccaaatctcaattttgggcaagaacgatatagtcacaactatggggctgctttcaaaagcggggctccatttctactgtcagatcaatgtggtgctgtaaccatctttttatccctaccttcaagaacctccttatatgaagcctgtctttatccatcagaaggtgtgtgaaatcatcacttccttctggttttatgtatttgtagactatgcagcttttcattaaactgcaagtatatacaagacagatctgaaattaggcctgagtgttccgatccaccactgtactagtaaataaaaatccacctaccttttatgtggaaaattatgtgctattgagtaacttttagctcttttttaaaaaatgggtgaaatttaagtgtcttttttatgagaatgacacatgaagagatctgagagcaatctcatgtagtcttccatgaacctgcaattgtttggtatgcgtcagcattttccaatttccaggttggatctagagctgctgttgatcactcaggcatactaatggattcatttagatgggtccaagctgcagtccatgagcaataacagactaccccagatactgcagtttacgcagtgcttagtaaatgagatttgtggaactaagttattagttacctgaggcttcttaagaaagtcttcttttttgaccagttgatgtgaaagagggagcatgtgacacagccagtatggtggagtgctagggttatcctgtttacaataaatcgcctgaatttcacctctggagtctgcatttgtattatttttccagttttagtgaaatagtacagtggccagtcctcagcctacctctcaacatcccagtttgaccagatttcttgctttcattgttcataatgcagaaagcagtgaattatattaacattttaaaagtgtttctgggtaacaatgatttttgtcaaatagaagactcaatttcacaaccttaagaatagatcacttttgtaaaacaagaatctcagtatttgatgttggactccttgctgtgagtattgtcactgactccaaacccagaaagatttgttcctgcccttacagggatgaaaataaaaaggatagaaaaaatatttctctcctctacaatgagtccttacatcttcttgccacatctccagctgcagtttaggcagatatcttgttcaatctctgtcttcttgatccctgtcaaaataatttttctactcatatagtggccagttggctcaggcaggcatttcaagaggaatctgcttgttcctcacttttccagcataggacagtggtccagcccgcacagtcagc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3416 -> Molecular function: GO:0001540 [beta-amyloid binding] evidence: IEA
            GeneID:3416 -> Molecular function: GO:0001948 [glycoprotein binding] evidence: IPI
            GeneID:3416 -> Molecular function: GO:0004222 [metalloendopeptidase activity] evidence: IDA
            GeneID:3416 -> Molecular function: GO:0005102 [receptor binding] evidence: IPI
            GeneID:3416 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:3416 -> Molecular function: GO:0005524 [ATP binding] evidence: IDA
            GeneID:3416 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IDA
            GeneID:3416 -> Molecular function: GO:0016887 [ATPase activity] evidence: IEA
            GeneID:3416 -> Molecular function: GO:0031626 [beta-endorphin binding] evidence: IEA
            GeneID:3416 -> Molecular function: GO:0042277 [peptide binding] evidence: IPI
            GeneID:3416 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
            GeneID:3416 -> Molecular function: GO:0043130 [ubiquitin binding] evidence: IPI
            GeneID:3416 -> Molecular function: GO:0043559 [insulin binding] evidence: IDA
            GeneID:3416 -> Molecular function: GO:0043559 [insulin binding] evidence: IPI
            GeneID:3416 -> Biological process: GO:0006508 [proteolysis] evidence: IDA
            GeneID:3416 -> Biological process: GO:0008286 [insulin receptor signaling pathway] evidence: NAS
            GeneID:3416 -> Biological process: GO:0008340 [determination of adult lifespan] evidence: IDA
            GeneID:3416 -> Biological process: GO:0010815 [bradykinin catabolic process] evidence: IDA
            GeneID:3416 -> Biological process: GO:0010992 [ubiquitin homeostasis] evidence: IDA
            GeneID:3416 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
            GeneID:3416 -> Biological process: GO:0032461 [positive regulation of protein oligomerization] evidence: IDA
            GeneID:3416 -> Biological process: GO:0042447 [hormone catabolic process] evidence: IEA
            GeneID:3416 -> Biological process: GO:0045861 [negative regulation of proteolysis] evidence: IEA
            GeneID:3416 -> Biological process: GO:0050435 [beta-amyloid metabolic process] evidence: IDA
            GeneID:3416 -> Biological process: GO:0051260 [protein homooligomerization] evidence: IDA
            GeneID:3416 -> Biological process: GO:0051289 [protein homotetramerization] evidence: IEA
            GeneID:3416 -> Biological process: GO:0051291 [protein heterooligomerization] evidence: IEA
            GeneID:3416 -> Biological process: GO:0051603 [proteolysis involved in cellular protein catabolic process] evidence: IDA
            GeneID:3416 -> Biological process: GO:1901142 [insulin metabolic process] evidence: IDA
            GeneID:3416 -> Biological process: GO:1901143 [insulin catabolic process] evidence: IDA
            GeneID:3416 -> Cellular component: GO:0005615 [extracellular space] evidence: IDA
            GeneID:3416 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:3416 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:3416 -> Cellular component: GO:0005739 [mitochondrion] evidence: IDA
            GeneID:3416 -> Cellular component: GO:0005777 [peroxisome] evidence: IDA
            GeneID:3416 -> Cellular component: GO:0005782 [peroxisomal matrix] evidence: IEA
            GeneID:3416 -> Cellular component: GO:0005829 [cytosol] evidence: IDA
            GeneID:3416 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
            GeneID:3416 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
            GeneID:3416 -> Cellular component: GO:0031597 [cytosolic proteasome complex] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001159418 -> EC 3.4.24.56

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.