GGRNA Home | Help | Advanced search

2024-04-26 18:36:13, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001164382            2888 bp    mRNA    linear   PRI 07-JUN-2013
DEFINITION  Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2),
            transcript variant 3, mRNA.
ACCESSION   NM_001164382
VERSION     NM_001164382.1  GI:256418998
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2888)
  AUTHORS   Park,E., Gleghorn,M.L. and Maquat,L.E.
  TITLE     Staufen2 functions in Staufen1-mediated mRNA decay by binding to
            itself and its paralog and promoting UPF1 helicase but not ATPase
            activity
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 110 (2), 405-412 (2013)
   PUBMED   23263869
  REMARK    GeneRIF: Staufen2 functions in Staufen1-mediated mRNA decay by
            binding to itself and its paralog and promoting UPF1 helicase but
            not ATPase activity.
REFERENCE   2  (bases 1 to 2888)
  AUTHORS   Lebeau,G., Miller,L.C., Tartas,M., McAdam,R., Laplante,I.,
            Badeaux,F., DesGroseillers,L., Sossin,W.S. and Lacaille,J.C.
  TITLE     Staufen 2 regulates mGluR long-term depression and Map1b mRNA
            distribution in hippocampal neurons
  JOURNAL   Learn. Mem. 18 (5), 314-326 (2011)
   PUBMED   21508097
  REMARK    GeneRIF: We suggest a role for Stau2 in the generation and
            regulation of Map1b mRNA containing granules that are required for
            mGluR-long-term depression
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2888)
  AUTHORS   Furic,L., Maher-Laporte,M. and DesGroseillers,L.
  TITLE     A genome-wide approach identifies distinct but overlapping subsets
            of cellular mRNAs associated with Staufen1- and Staufen2-containing
            ribonucleoprotein complexes
  JOURNAL   RNA 14 (2), 324-335 (2008)
   PUBMED   18094122
  REMARK    GeneRIF: Stau1- and Stau2-mRNPs associate with distinct but
            overlapping sets of cellular mRNAs.
REFERENCE   4  (bases 1 to 2888)
  AUTHORS   Beausoleil,S.A., Villen,J., Gerber,S.A., Rush,J. and Gygi,S.P.
  TITLE     A probability-based approach for high-throughput protein
            phosphorylation analysis and site localization
  JOURNAL   Nat. Biotechnol. 24 (10), 1285-1292 (2006)
   PUBMED   16964243
REFERENCE   5  (bases 1 to 2888)
  AUTHORS   Duchaine,T.F., Hemraj,I., Furic,L., Deitinghoff,A., Kiebler,M.A.
            and DesGroseillers,L.
  TITLE     Staufen2 isoforms localize to the somatodendritic domain of neurons
            and interact with different organelles
  JOURNAL   J. Cell. Sci. 115 (PT 16), 3285-3295 (2002)
   PUBMED   12140260
  REMARK    GeneRIF: Data show that Stau2 is localized to the neuronal soma and
            dendrites, but it does not colocalize with Stau1-containing
            particles.
REFERENCE   6  (bases 1 to 2888)
  AUTHORS   Kiebler,M.A. and DesGroseillers,L.
  TITLE     Molecular insights into mRNA transport and local translation in the
            mammalian nervous system
  JOURNAL   Neuron 25 (1), 19-28 (2000)
   PUBMED   10707969
  REMARK    Review article
REFERENCE   7  (bases 1 to 2888)
  AUTHORS   Buchner,G., Bassi,M.T., Andolfi,G., Ballabio,A. and Franco,B.
  TITLE     Identification of a novel homolog of the Drosophila staufen protein
            in the chromosome 8q13-q21.1 region
  JOURNAL   Genomics 62 (1), 113-118 (1999)
   PUBMED   10585778
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB501161.1, AK303104.1,
            AC100784.2, AK002152.1 and AF459097.1.
            
            Summary: Staufen homolog 2 is a member of the family of
            double-stranded RNA (dsRNA)-binding proteins involved in the
            transport and/or localization of mRNAs to different subcellular
            compartments and/or organelles. These proteins are characterized by
            the presence of multiple dsRNA-binding domains which are required
            to bind RNAs having double-stranded secondary structures. Staufen
            homolog 2 shares 48.5% and 59.9% similarity with drosophila and
            human staufen, respectively. The exact function of Staufen homolog
            2 is not known, but since it contains 3 copies of conserved dsRNA
            binding domain, it could be involved in double-stranded RNA binding
            events. Several transcript variants encoding different isoforms
            have been found for this gene. [provided by RefSeq, Aug 2009].
            
            Transcript Variant: This variant (3) differs in the 5' UTR and
            coding sequence compared to variant 1. The resulting isoform (c)
            has a shorter N-terminus compared to isoform a.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK303104.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-87                DB501161.1         1-87
            88-641              AK303104.1         1-554
            642-642             AC100784.2         53879-53879
            643-2037            AK303104.1         556-1950
            2038-2861           AK002152.1         2128-2951
            2862-2888           AF459097.1         2758-2784
FEATURES             Location/Qualifiers
     source          1..2888
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8q21.11"
     gene            1..2888
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /note="staufen double-stranded RNA binding protein 2"
                     /db_xref="GeneID:27067"
                     /db_xref="HGNC:11371"
                     /db_xref="MIM:605920"
     exon            1..145
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(92)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:182586484"
     variation       complement(141)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190921391"
     exon            146..258
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(155)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367669479"
     variation       complement(180..181)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:367547275"
     exon            259..324
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(269)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202210177"
     variation       complement(270)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375973716"
     misc_feature    303..305
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /note="upstream in-frame stop codon"
     exon            325..460
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     CDS             363..1877
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /note="isoform c is encoded by transcript variant 3;
                     double-stranded RNA-binding protein Staufen homolog 2;
                     staufen homolog 2; staufen, RNA binding protein, homolog
                     2"
                     /codon_start=1
                     /product="double-stranded RNA-binding protein Staufen
                     homolog 2 isoform c"
                     /protein_id="NP_001157854.1"
                     /db_xref="GI:256418999"
                     /db_xref="CCDS:CCDS55245.1"
                     /db_xref="GeneID:27067"
                     /db_xref="HGNC:11371"
                     /db_xref="MIM:605920"
                     /translation="
MKRGEPAIYRPLDPKPFPNYRANYNFRGMYNQRYHCPVPKIFYVQLTVGNNEFFGEGKTRQAARHNAAMKALQALQNEPIPERSPQNGESGKDVDDDKDANKSEISLVFEIALKRNMPVSFEVIKESGPPHMKSFVTRVSVGEFSAEGEGNSKKLSKKRAATTVLQELKKLPPLPVVEKPKLFFKKRPKTIVKAGPEYGQGMNPISRLAQIQQAKKEKEPDYVLLSERGMPRRREFVMQVKVGNEVATGTGPNKKIAKKNAAEAMLLQLGYKASTNLQDQLEKTGENKGWSGPKPGFPEPTNNTPKGILHLSPDVYQEMEASRHKVISGTTLGYLSPKDMNQPSSSFFSISPTSNSSATIARELLMNGTSSTAEAIGLKGSSPTPPCSPVQPSKQLEYLARIQGFQVHYCDRQSGKECVTCLTLAPVQMTFHAIGSSIEASHDQAALSALKQFSEQGLDPIDGAMNIEKGSLEKQAKHLREKADNNQAPPGSIAQDCKKSNSAV
"
     misc_feature    <471..587
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /note="Double-stranded RNA binding motif. Binding is not
                     sequence specific but is highly specific for double
                     stranded RNA. Found in a variety of proteins including
                     dsRNA dependent protein kinase PKR, RNA helicases,
                     Drosophila staufen protein, E. coli RNase III; Region:
                     DSRM; cd00048"
                     /db_xref="CDD:28930"
     misc_feature    order(534..545,552..554)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /note="dsRNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:28930"
     misc_feature    675..860
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /note="Double-stranded RNA binding motif. Binding is not
                     sequence specific but is highly specific for double
                     stranded RNA. Found in a variety of proteins including
                     dsRNA dependent protein kinase PKR, RNA helicases,
                     Drosophila staufen protein, E. coli RNase III; Region:
                     DSRM; cd00048"
                     /db_xref="CDD:28930"
     misc_feature    order(687..692,813..824,831..833)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /note="dsRNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:28930"
     misc_feature    969..1169
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /note="Double-stranded RNA binding motif. Binding is not
                     sequence specific but is highly specific for double
                     stranded RNA. Found in a variety of proteins including
                     dsRNA dependent protein kinase PKR, RNA helicases,
                     Drosophila staufen protein, E. coli RNase III; Region:
                     DSRM; cd00048"
                     /db_xref="CDD:28930"
     misc_feature    order(969..971,987..992,1116..1127,1134..1136)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /note="dsRNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:28930"
     variation       complement(380)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373781707"
     variation       complement(381)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200832177"
     variation       complement(395)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115816230"
     variation       complement(422)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150527132"
     variation       complement(424)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200996921"
     exon            461..620
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(486)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199731066"
     variation       complement(496)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200297530"
     variation       complement(540)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201210593"
     variation       complement(548)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201898195"
     STS             597..702
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /standard_name="WI-16800"
                     /db_xref="UniSTS:64871"
     exon            621..728
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(642)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949493"
     exon            729..941
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(750)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376554654"
     variation       complement(782)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199859315"
     variation       complement(796)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184418849"
     variation       complement(839)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:28728027"
     variation       complement(845)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368673903"
     variation       complement(854)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144539323"
     variation       complement(887)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201913123"
     variation       complement(888)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373605907"
     variation       complement(899)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192673893"
     variation       complement(919)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199601674"
     exon            942..1079
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(944)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371435229"
     variation       complement(945)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142831475"
     variation       complement(977)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370812556"
     variation       complement(981)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138925194"
     variation       complement(1036)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376665220"
     variation       complement(1044)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368955920"
     variation       complement(1057)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369041333"
     variation       complement(1060)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377142999"
     exon            1080..1211
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1090)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147219043"
     variation       complement(1143)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200304414"
     exon            1212..1272
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1220)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199836880"
     variation       complement(1221)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200276587"
     variation       complement(1251)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201007858"
     variation       complement(1252)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202001506"
     variation       complement(1262)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142953051"
     exon            1273..1580
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1277)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138728668"
     variation       complement(1292)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150211307"
     variation       complement(1329)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140982689"
     variation       complement(1374)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199937946"
     variation       complement(1378)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376067283"
     variation       complement(1388)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148124805"
     variation       complement(1389)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373103243"
     variation       complement(1394)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370371919"
     variation       complement(1414)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377256202"
     variation       complement(1418)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373075598"
     variation       complement(1420)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369610486"
     variation       complement(1437)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145795257"
     variation       complement(1443)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375207062"
     variation       complement(1459)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202085377"
     variation       complement(1485)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140667237"
     variation       complement(1515)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374802646"
     variation       complement(1521)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146866411"
     variation       complement(1535)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370311327"
     exon            1581..1694
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1625..1628)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace=""
                     /replace="tctg"
                     /db_xref="dbSNP:371637726"
     variation       complement(1659)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370898737"
     variation       complement(1673)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376807384"
     exon            1695..1783
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1699)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376970137"
     variation       complement(1701)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75740279"
     variation       complement(1727)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73318729"
     variation       complement(1743)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:114263344"
     variation       complement(1746)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139158161"
     exon            1784..2880
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1808)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145759808"
     variation       complement(1811)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368365328"
     variation       complement(1868)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146501256"
     variation       complement(1871)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369462384"
     variation       complement(1894)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375647181"
     variation       complement(1921)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184498114"
     variation       complement(1929)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143999038"
     variation       complement(2171)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72659432"
     variation       complement(2203)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192055318"
     variation       complement(2216..2217)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:36069340"
     variation       complement(2250)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:188780480"
     variation       complement(2266)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184724066"
     variation       complement(2281..2282)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace=""
                     /replace="tc"
                     /db_xref="dbSNP:149185059"
     variation       complement(2283)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193047022"
     variation       complement(2375)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187933579"
     variation       complement(2517)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77216259"
     variation       complement(2519)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:76395585"
     variation       complement(2520)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77588845"
     variation       complement(2522)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:75569575"
     variation       complement(2544)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182521597"
     variation       complement(2579)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375063234"
     variation       complement(2620)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146705265"
     STS             2667..2784
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /standard_name="D8S1387E"
                     /db_xref="UniSTS:55892"
     variation       complement(2688)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16938648"
     variation       complement(2704)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192977182"
     STS             2755..2880
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /standard_name="RH12642"
                     /db_xref="UniSTS:77739"
     variation       complement(2790)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187118704"
     variation       complement(2858)
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113732226"
     polyA_site      2880
                     /gene="STAU2"
                     /gene_synonym="39K2; 39K3"
ORIGIN      
gggagcgccggggaggcgggcggaggcgggcggaggcggggggcggggagcccgaggggtggaagccggcggcggccgagcggggtcagttctctgtagtgtttgccaatgttggagccgtctgcaaagtgtccccggcaagaagaggctgcctaccacaaggactttagcttactttttaaagattgaagaaaaaaaagaagacagaaaaagaagaactcaaagatacacaaagtaatttgaaccaaggctcagaagtttttggagccgtgagggatacagcagtttggtcaatattgtcttaacatgcttcaaataaatcaggcagtataactccaactgtggaactgaatgggcttgctatgaaaaggggagagcctgccatctacaggccattagatccaaagccattcccaaattatagagctaattacaactttcggggcatgtacaatcagaggtatcattgcccagtgcctaagatcttttatgttcagctcactgtaggaaataatgaattttttggggaaggaaagactcgacaagctgctagacacaatgctgcaatgaaagccctccaagcactgcagaatgaacctattccagaaagatctcctcagaatggtgaatcaggaaaggatgtggatgatgacaaagatgcaaataagtctgagatcagcttagtgtttgaaattgctctgaagcgaaatatgcctgtcagttttgaggttattaaagaaagtggaccaccacatatgaaaagctttgttactcgagtgtcagtaggagagttctctgcagaaggagaaggaaatagcaaaaaactctccaagaagcgcgctgcgaccaccgtcttacaggagcttaaaaaacttccacctcttcctgtggtggaaaagccaaaactattttttaaaaaacgccctaaaacaatagtaaaggccggaccagaatatggccaagggatgaaccctattagccgcctggcgcaaattcaacaggccaaaaaggaaaaggagccggattatgttttgctttcagaaagaggaatgcctcgacgtcgagaatttgtgatgcaggtgaaggtaggcaatgaagttgctacaggaacaggacctaataaaaagatagccaaaaaaaatgctgcagaagcaatgctgttacaacttggttataaagcatccactaatcttcaggatcaacttgagaagacaggggaaaacaaaggatggagtggtccaaagcctgggtttcctgaaccaacaaataatactccaaaaggaattcttcatttgtctcctgatgtttatcaagagatggaagccagccgccacaaagtaatctctggcactactctaggctatttgtcacccaaagatatgaaccaaccttcaagctctttcttcagtatatctcccacatcgaatagttcagctacaattgccagggaactccttatgaatggaacatcttctacagctgaagccataggtttaaaaggaagttctcctactcccccttgttctccagtacaaccttcaaaacaactggaatatttagcaaggattcaaggctttcaggttcactactgtgatagacaaagtggcaaagagtgtgtgacctgtctgacattagcccctgtgcagatgactttccatgctattggaagctccattgaagccagccatgatcaggcagccttaagtgccttgaaacaattttctgaacaaggactggatccaatcgatggagcaatgaatatcgaaaaaggttctcttgaaaaacaagccaagcatctgagagagaaagcggacaataaccaggcacccccgggctccatcgctcaggactgcaagaaatcaaactcggccgtctagcagctcccagaacccgcggctgccaccgcatccttataaacctgtcagcacgcatgagggtgtctgtgttcagggaaatgaatgactaataccattatttgagtcttatgtgaagacaacactattctaacacgagagataatatacatggtactgtttattcaactggggaaaaataaaactttgagcatttcccttggaactcgagatcagatcataactcatttgcctagaggcagcagaaatctgatcctgctactggagcttaaaataacaagtaaagaaaagtgttagaaacaaagctaaaattttaacatgattaataatagagaagttgggtttggttctgttgttatgattgttttgtcgtggtgcttgtgttcagttatattctctctctctctcatttcaaatactgcttgacaattcgaaaatgaaccaatgatgtgctgtggaatgtgatggttgtcttcatatagagtcacatggtttctctttttatgcagatatttataatcttcatcctatatcagtaggaataactataaggtgcactacaaaaagatgtatgcaaacaaacatgttttaaatcaggtcagatatctgatgaaaaatacgaactaatgttaagagcaagtagtttcaacatactccaggaactgagaaacaaaacaaagcaattgtgggttttgagctccatatactcttagcaagtaagggggcgtcttgcccctatatatcatcttcccggattccactccctgttgtgggaatcgcgcccacccccatccgtgtgttgtagccactcacggtttgcatcaagagtgttttttgtaactgcctctggacttgggacagtgagtaggatcaaaaataaataatgtacatgacggggaagggaaaaacctgttggagttgcttccagccagccacgctccgggccagcatgttggaatccagcgtggagcagatgcagtaaaaatgtggttggtttctgtgtgaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:27067 -> Molecular function: GO:0003725 [double-stranded RNA binding] evidence: TAS
            GeneID:27067 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:27067 -> Biological process: GO:0006810 [transport] evidence: IEA
            GeneID:27067 -> Cellular component: GO:0005730 [nucleolus] evidence: IEA
            GeneID:27067 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IEA
            GeneID:27067 -> Cellular component: GO:0005874 [microtubule] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.