GGRNA | NM_001164000.1

LOCUS       NM_001164000            5740 bp    mRNA    linear   PRI 16-JUN-2013
DEFINITION  Homo sapiens MDS1 and EVI1 complex locus (MECOM), transcript
            variant 6, mRNA.
ACCESSION   NM_001164000
VERSION     NM_001164000.1  GI:255683389
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5740)
  AUTHORS   Senyuk,V., Zhang,Y., Liu,Y., Ming,M., Premanand,K., Zhou,L.,
            Chen,P., Chen,J., Rowley,J.D., Nucifora,G. and Qian,Z.
  TITLE     Critical role of miR-9 in myelopoiesis and EVI1-induced
            leukemogenesis
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 110 (14), 5594-5599 (2013)
   PUBMED   23509296
  REMARK    GeneRIF: EVI1 binds to the promoter of miR-9-3, leading to DNA
            hypermethylation of the promoter and repression of miR-9.
REFERENCE   2  (bases 1 to 5740)
  AUTHORS   Hwang,J.Y., Lee,S.H., Go,M.J., Kim,B.J., Kou,I., Ikegawa,S.,
            Guo,Y., Deng,H.W., Raychaudhuri,S., Kim,Y.J., Oh,J.H., Kim,Y.,
            Moon,S., Kim,D.J., Koo,H., Cha,M.J., Lee,M.H., Yun,J.Y., Yoo,H.S.,
            Kang,Y.A., Cho,E.H., Kim,S.W., Oh,K.W., Kang,M.I., Son,H.Y.,
            Kim,S.Y., Kim,G.S., Han,B.G., Cho,Y.S., Cho,M.C., Lee,J.Y. and
            Koh,J.M.
  TITLE     Meta-analysis identifies a MECOM gene as a novel predisposing
            factor of osteoporotic fracture
  JOURNAL   J. Med. Genet. 50 (4), 212-219 (2013)
   PUBMED   23349225
REFERENCE   3  (bases 1 to 5740)
  AUTHORS   Steinleitner,K., Rampetsreiter,P., Koffel,R., Ramanathan,G.,
            Mannhalter,C., Strobl,H. and Wieser,R.
  TITLE     EVI1 and MDS1/EVI1 expression during primary human hematopoietic
            progenitor cell differentiation into various myeloid lineages
  JOURNAL   Anticancer Res. 32 (11), 4883-4889 (2012)
   PUBMED   23155256
  REMARK    GeneRIF: EVI1 is expressed in human hematopoietic progenitor cells,
            but is down-regulated during differentiation
REFERENCE   4  (bases 1 to 5740)
  AUTHORS   Hancock,D.B., Artigas,M.S., Gharib,S.A., Henry,A., Manichaikul,A.,
            Ramasamy,A., Loth,D.W., Imboden,M., Koch,B., McArdle,W.L.,
            Smith,A.V., Smolonska,J., Sood,A., Tang,W., Wilk,J.B., Zhai,G.,
            Zhao,J.H., Aschard,H., Burkart,K.M., Curjuric,I., Eijgelsheim,M.,
            Elliott,P., Gu,X., Harris,T.B., Janson,C., Homuth,G., Hysi,P.G.,
            Liu,J.Z., Loehr,L.R., Lohman,K., Loos,R.J., Manning,A.K.,
            Marciante,K.D., Obeidat,M., Postma,D.S., Aldrich,M.C.,
            Brusselle,G.G., Chen,T.H., Eiriksdottir,G., Franceschini,N.,
            Heinrich,J., Rotter,J.I., Wijmenga,C., Williams,O.D., Bentley,A.R.,
            Hofman,A., Laurie,C.C., Lumley,T., Morrison,A.C., Joubert,B.R.,
            Rivadeneira,F., Couper,D.J., Kritchevsky,S.B., Liu,Y., Wjst,M.,
            Wain,L.V., Vonk,J.M., Uitterlinden,A.G., Rochat,T., Rich,S.S.,
            Psaty,B.M., O'Connor,G.T., North,K.E., Mirel,D.B., Meibohm,B.,
            Launer,L.J., Khaw,K.T., Hartikainen,A.L., Hammond,C.J., Glaser,S.,
            Marchini,J., Kraft,P., Wareham,N.J., Volzke,H., Stricker,B.H.,
            Spector,T.D., Probst-Hensch,N.M., Jarvis,D., Jarvelin,M.R.,
            Heckbert,S.R., Gudnason,V., Boezen,H.M., Barr,R.G., Cassano,P.A.,
            Strachan,D.P., Fornage,M., Hall,I.P., Dupuis,J., Tobin,M.D. and
            London,S.J.
  TITLE     Genome-wide joint meta-analysis of SNP and SNP-by-smoking
            interaction identifies novel loci for pulmonary function
  JOURNAL   PLoS Genet. 8 (12), E1003098 (2012)
   PUBMED   23284291
REFERENCE   5  (bases 1 to 5740)
  AUTHORS   Haas,K., Kundi,M., Sperr,W.R., Esterbauer,H., Ludwig,W.D.,
            Ratei,R., Koller,E., Gruener,H., Sauerland,C., Fonatsch,C.,
            Valent,P. and Wieser,R.
  TITLE     Expression and prognostic significance of different mRNA 5'-end
            variants of the oncogene EVI1 in 266 patients with de novo AML:
            EVI1 and MDS1/EVI1 overexpression both predict short remission
            duration
  JOURNAL   Genes Chromosomes Cancer 47 (4), 288-298 (2008)
   PUBMED   18181178
  REMARK    GeneRIF: EVI1 and MDS1/EVI1 overexpression is associated with acute
            myeloid leukemia
REFERENCE   6  (bases 1 to 5740)
  AUTHORS   Aytekin,M., Vinatzer,U., Musteanu,M., Raynaud,S. and Wieser,R.
  TITLE     Regulation of the expression of the oncogene EVI1 through the use
            of alternative mRNA 5'-ends
  JOURNAL   Gene 356, 160-168 (2005)
   PUBMED   16014322
  REMARK    GeneRIF: The general expression patterns of the EVI1 5'-end
            variants in a panel of 20 human tissues were similar, while
            pronounced differences were noted in response to all-trans retinoic
            acid.
REFERENCE   7  (bases 1 to 5740)
  AUTHORS   Mochizuki,N., Shimizu,S., Nagasawa,T., Tanaka,H., Taniwaki,M.,
            Yokota,J. and Morishita,K.
  TITLE     A novel gene, MEL1, mapped to 1p36.3 is highly homologous to the
            MDS1/EVI1 gene and is transcriptionally activated in
            t(1;3)(p36;q21)-positive leukemia cells
  JOURNAL   Blood 96 (9), 3209-3214 (2000)
   PUBMED   11050005
REFERENCE   8  (bases 1 to 5740)
  AUTHORS   Nucifora,G., Begy,C.R., Kobayashi,H., Roulston,D., Claxton,D.,
            Pedersen-Bjergaard,J., Parganas,E., Ihle,J.N. and Rowley,J.D.
  TITLE     Consistent intergenic splicing and production of multiple
            transcripts between AML1 at 21q22 and unrelated genes at 3q26 in
            (3;21)(q26;q22) translocations
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 91 (9), 4004-4008 (1994)
   PUBMED   8171026
REFERENCE   9  (bases 1 to 5740)
  AUTHORS   Mitani,K., Ogawa,S., Tanaka,T., Miyoshi,H., Kurokawa,M., Mano,H.,
            Yazaki,Y., Ohki,M. and Hirai,H.
  TITLE     Generation of the AML1-EVI-1 fusion gene in the t(3;21)(q26;q22)
            causes blastic crisis in chronic myelocytic leukemia
  JOURNAL   EMBO J. 13 (3), 504-510 (1994)
   PUBMED   8313895
REFERENCE   10 (bases 1 to 5740)
  AUTHORS   Morishita,K., Parganas,E., Douglass,E.C. and Ihle,J.N.
  TITLE     Unique expression of the human Evi-1 gene in an endometrial
            carcinoma cell line: sequence of cDNAs and structure of
            alternatively spliced transcripts
  JOURNAL   Oncogene 5 (7), 963-971 (1990)
   PUBMED   2115646
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BX640908.1, AC078985.14,
            BX647613.1 and AA043944.1.
            
            Summary: The protein encoded by this gene is a transcriptional
            regulator and oncoprotein that may be involved in hematopoiesis,
            apoptosis, development, and cell differentiation and proliferation.
            The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B,
            MAPK8, and MAPK9. This gene can undergo translocation with the AML1
            gene, resulting in overexpression of this gene and the onset of
            leukemia. Several transcript variants encoding a few different
            isoforms have been found for this gene. [provided by RefSeq, Mar
            2011].
            
            Transcript Variant: This variant (6, also known as EVI1_1a) differs
            in the 5' UTR, lacks a portion of the 5' coding region, initiates
            translation at a downstream start codon, and uses an alternate
            in-frame splice site and lacks an alternate in-frame exon in the
            central coding region, compared to variant 1. The encoded isoform
            (e) is shorter than isoform a.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX640908.1, BX647613.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025098 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-371               BX640908.1         1-371
            372-973             AC078985.14        120459-121060       c
            974-2527            BX647613.1         706-2259
            2528-2628           BX640908.1         2528-2628
            2629-3394           BX647613.1         2361-3126
            3395-4211           BX640908.1         3395-4211
            4212-5732           BX647613.1         3944-5464
            5733-5740           AA043944.1         3-10                c
FEATURES             Location/Qualifiers
     source          1..5740
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3q26.2"
     gene            1..5740
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="MDS1 and EVI1 complex locus"
                     /db_xref="GeneID:2122"
                     /db_xref="HGNC:3498"
                     /db_xref="MIM:165215"
     exon            1..1012
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     variation       973
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420476"
     misc_feature    992..994
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="upstream in-frame stop codon"
     exon            1013..1147
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            1148..1250
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     CDS             1202..4330
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="isoform e is encoded by transcript variant 6; MDS1
                     and EVI1 complex locus protein EVI1; MDS1 and EVI1 complex
                     locus protein MDS1; oncogene EVI1; myelodysplasia
                     syndrome-associated protein 1; zinc finger protein Evi1;
                     AML1-EVI-1 fusion protein; ecotropic virus integration
                     site 1 protein homolog"
                     /codon_start=1
                     /product="MDS1 and EVI1 complex locus protein EVI1 isoform
                     e"
                     /protein_id="NP_001157472.1"
                     /db_xref="GI:255683390"
                     /db_xref="CCDS:CCDS54669.1"
                     /db_xref="GeneID:2122"
                     /db_xref="HGNC:3498"
                     /db_xref="MIM:165215"
                     /translation="

MKSEDYPHETMAPDIHEERQYRCEDCDQLFESKAELADHQKFPCSTPHSAFSMVEEDFQQKLESENDLQEIHTIQECKECDQVFPDLQSLEKHMLSHTEEREYKCDQCPKAFNWKSNLIRHQMSHDSGKHYECENCAKVFTDPSNLQRHIRSQHVGARAHACPECGKTFATSSGLKQHKHIHSSVKPFICEVCHKSYTQFSNLCRHKRMHADCRTQIKCKDCGQMFSTTSSLNKHRRFCEGKNHFAAGGFFGQGISLPGTPAMDKTSMVNMSHANPGLADYFGANRHPAGLTFPTAPGFSFSFPGLFPSGLYHRPPLIPASSPVKGLSSTEQTNKSQSPLMTHPQILPATQDILKALSKHPSVGDNKPVELQPERSSEERPFEKISDQSESSDLDDVSTPSGSDLETTSGSDLESDIESDKEKFKENGKMFKDKVSPLQNLASINNKKEYSNHSIFSPSLEEQTAVSGAVNDSIKAIASIAEKYFGSTGLVGLQDKKVGALPYPSMFPLPFFPAFSQSMYPFPDRDLRSLPLKMEPQSPGEVKKLQKGSSESPFDLTTKRKDEKPLTPVPSKPPVTPATSQDQPLDLSMGSRSRASGTKLTEPRKNHVFGGKKGSNVESRPASDGSLQHARPTPFFMDPIYRVEKRKLTDPLEALKEKYLRPSPGFLFHPQMSAIENMAEKLESFSALKPEASELLQSVPSMFNFRAPPNALPENLLRKGKERYTCRYCGKIFPRSANLTRHLRTHTGEQPYRCKYCDRSFSISSNLQRHVRNIHNKEKPFKCHLCDRCFGQQTNLDRHLKKHENGNMSGTATSSPHSELESTGAILDDKEDAYFTEIRNFIGNSNHGSQSPRNVEERMNGSHFKDEKALVTSQNSDLLDDEEVEDEVLLDEEDEDNDITGKTGKEPVTSNLHEGNPEDDYEETSALEMSCKTSPVRYKEEEYKSGLSALDHIRHFTDSLKMRKMEDNQYSEAELSSFSTSHVPEELKQPLHRKSKSQAYAMMLSLSDKESLHSTSHSSSNVWHSMARAAAESSAIQSISHV

"
     misc_feature    1202..1957
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q03112.2);
                     Region: Interaction with MAPK9, SMAD3 and probably
                     SUV39H1"
     misc_feature    1466..1540
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    1511..1576
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478"
                     /db_xref="CDD:210117"
     misc_feature    1634..1714
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    1766..1831
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478"
                     /db_xref="CDD:210117"
     misc_feature    1853..1918
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478"
                     /db_xref="CDD:210117"
     misc_feature    2462..2503
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q03112.2);
                     Region: Nuclear localization signal (Potential)"
     misc_feature    2858..2872
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q03112.2);
                     Region: CTBP-binding motif 1 (By similarity)"
     misc_feature    2951..2965
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q03112.2);
                     Region: CTBP-binding motif 2 (By similarity)"
     misc_feature    3170..3529
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="hypothetical protein; Region: PHA00733"
                     /db_xref="CDD:177301"
     misc_feature    3374..3439
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478"
                     /db_xref="CDD:210117"
     misc_feature    3413..3487
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    3497..3571
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    3752..3754
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q03112.2); phosphorylation site"
     exon            1251..1467
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            1468..1615
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     variation       1521
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34896995"
     STS             1564..2771
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /standard_name="Evi1"
                     /db_xref="UniSTS:256974"
     STS             1564..2030
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /standard_name="Evi1"
                     /db_xref="UniSTS:256973"
     exon            1616..1769
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            1770..3126
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     variation       1912
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35594969"
     variation       1955
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199968662"
     STS             2215..3161
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /standard_name="Evi1"
                     /db_xref="UniSTS:506889"
     variation       2834
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2276719"
     exon            3127..3214
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            3215..3381
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     variation       3284
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:36043407"
     exon            3382..3459
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            3460..3629
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     variation       3551
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34224062"
     exon            3630..3774
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            3775..4011
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            4012..4195
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            4196..5740
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     STS             4214..4433
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /standard_name="SHGC-77524"
                     /db_xref="UniSTS:47700"
     STS             4731..5018
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /standard_name="SGC38138"
                     /db_xref="UniSTS:74058"
     variation       4918
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048601"
     variation       5532
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1048604"
     polyA_signal    5712..5717
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
     polyA_site      5740
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
ORIGIN

cacacacacacacacacaccacacttgtgctttcaagacatcgaaacggaggctatttccctggggaaagaaatcctgcctggcgagatctccccattggttgtttacccggagaaatctacatgtttaagggggatggtgcatccataatcagtctgtccctataggacttgggtcttggcgacctttttgtgacctctcccgccagaggaggctgctgtcactttaaaaatttaaaagaggagcccgtctggcttccgatcagatcactctgggcggcgggagatagctccctttctccctcgccccgggttctttctggatggccgagcagatcctctttaaagagacagttcatgaaatagaaacccggcggctgagcttggagttgcgaaaggggacgatcccgtgagggtccaggacccgcgaaggcgctgcggaggatctgaaagggggatagagctcccctcgcctccccaggccccccaccttttcaaactctcctcctcctgcttgttttcccccattggaactgggaaggagaagtagaagttttagtgggtttcagataactttcattacacatcgggctgataagagcaagagaaagtgagaaaagagggaggtgatgtgaaccagaaggaatagctccgagctcatttaggaagggggaaaaagccaaaacacaccaaacccgggtcacccagacgaaagaagacttcatttcttgtattaaaaatacactgttggcggacaataaatccgaaacgcgtggtcctggagagcagatcctagagacggacaaagttgtcagagacccatttggaaatcgagacgcgaggcttttaaaaaattattattattatttttaaacatctctaaatgttgctcgggatcgtttgaaaggattttcgtgcaggagcgttgggggctgctgattattttattttgtttattttgattcttctgtgaatgcctattattgctgagttgaggccatagaaatctaaagatcttagacgaattttacaatgtgaagttctgcatagatgccagtcaaccagatgttggaagctggctcaagtacattagattcgctggctgttatgatcagcacaaccttgttgcatgccagataaatgatcagatattctatagagtagttgcagacattgcgccgggagaggagcttctgctgttcatgaagagcgaagactatccccatgaaactatggcgccggatatccacgaagaacggcaatatcgctgcgaagactgtgaccagctctttgaatctaaggctgaactagcagatcaccaaaagtttccatgcagtactcctcactcagcattttcaatggttgaagaggactttcagcaaaaactcgaaagcgagaatgatctccaagagatacacacgatccaggagtgtaaggaatgtgaccaagtttttcctgatttgcaaagcctggagaaacacatgctgtcacatactgaagagagggaatacaagtgtgatcagtgtcccaaggcatttaactggaagtccaatttaattcgccaccagatgtcacatgacagtggaaagcactatgaatgtgaaaactgtgccaaggttttcacggaccctagcaaccttcagcggcacattcgctctcagcatgtcggtgcccgggcccatgcatgcccggagtgtggcaaaacgtttgccacttcgtcgggcctcaaacaacacaagcacatccacagcagtgtgaagccctttatctgtgaggtctgccataaatcctatactcagttttcaaacctttgccgtcataagcgcatgcatgctgattgcagaacccaaatcaagtgcaaagactgtggacaaatgttcagcactacgtcttccttaaataaacacaggaggttttgtgagggcaagaaccattttgcggcaggtggattttttggccaaggcatttcacttcctggaaccccagctatggataaaacgtccatggttaatatgagtcatgccaacccgggccttgctgactattttggcgccaataggcatcctgctggtcttacctttccaacagctcctggattttcttttagcttccctggtctgtttccttccggcttgtaccacaggcctcctttgatacctgctagttctcctgttaaaggactatcaagtactgaacagacaaacaaaagtcaaagtcccctcatgacacatcctcagatactgccagctacacaggatattttgaaggcactatctaaacacccatctgtaggggacaataagccagtggagctccagcccgagaggtcctctgaagagaggccctttgagaaaatcagtgaccagtcagagagtagtgaccttgatgatgtcagtacaccaagtggcagtgacctggaaacaacctcgggctctgatctggaaagtgacattgaaagtgataaagagaaatttaaagaaaatggtaaaatgttcaaagacaaagtaagccctcttcagaatctggcttcaataaataataagaaagaatacagcaatcattccattttctcaccatctttagaggagcagactgcggtgtcaggagctgtgaatgattctataaaggctattgcttctattgctgaaaaatactttggttcaacaggactggtggggctgcaagacaaaaaagttggagctttaccttacccttccatgtttcccctcccattttttccagcattctctcaatcaatgtacccatttcctgatagagacttgagatcgttacctttgaaaatggaaccccaatcaccaggtgaagtaaagaaactgcagaagggcagctctgagtccccctttgatctcaccactaagcgaaaggatgagaagcccttgactccagtcccctccaagcctccagtgacacctgccacaagccaagaccagcccctggatctaagtatgggcagtaggagtagagccagtgggacaaagctgactgagcctcgaaaaaaccacgtgtttgggggaaaaaaaggaagcaacgtcgaatcaagacctgcttcagatggttccttgcagcatgcaagacccactcctttctttatggaccctatttacagagtagagaaaagaaaactaactgacccacttgaagctttaaaagagaaatacttgaggccttctccaggattcttgtttcacccacaaatgtcagctattgaaaacatggcagaaaagctagagagcttcagtgccctgaaacctgaggccagtgagctcttacagtcagtgccctctatgttcaacttcagggcgcctcccaatgccctgccagagaaccttctgcggaagggaaaggagcgctatacctgcagatactgtggcaagatttttccaaggtctgcaaacctaacacggcacttgagaacccacacaggagagcagccttacagatgcaaatactgtgacagatcatttagcatatcttctaacttgcaaaggcatgttcgcaacatccacaataaagagaagccatttaagtgtcacttatgtgataggtgttttggtcaacaaaccaatttagacagacacctaaagaaacatgagaatgggaacatgtccggtacagcaacatcgtcgcctcattctgaactggaaagtacaggtgcgattctggatgacaaagaagatgcttacttcacagaaattcgaaatttcattgggaacagcaaccatggcagccaatctcccaggaatgtggaggagagaatgaatggcagtcattttaaagatgaaaaggctttggtgaccagtcaaaattcagacttgctggatgatgaagaagttgaagatgaggtgttgttagatgaggaggatgaagacaatgatattactggaaaaacaggaaaggaaccagtgacaagtaatttacatgaaggaaaccctgaggatgactatgaagaaaccagtgccctggagatgagttgcaagacatccccagtgaggtataaagaggaagaatataaaagtggactttctgctctagatcatataaggcacttcacagatagcctcaaaatgaggaaaatggaagataatcaatattctgaagctgagctgtcttcttttagtacttcccatgtgccagaggaacttaagcagccgttacacagaaagtccaaatcgcaggcatatgctatgatgctgtcactgtctgacaaggagtccctccattctacatcccacagttcttccaacgtgtggcacagtatggccagggctgcggcggaatccagtgctatccagtccataagccacgtatgacgttatcaaggttgaccagagtgggaccaagtccaacagtagcatggctctttcatataggactatttacaagactgctgagcagaatgccttataaacctgcagggtcactcatctaaagtctagtgaccttaaactgaatgatttaaaaaagaaaagaaagaaaaaagaaactatttattctcgatattttgttttgcacagcaaaggcagctgctgacttctggaagatcaatcaatgcgacttaaagtgattcagtgaaaacaaaaaacttggtgggctgaaggcatcttccagtttaccccaccttagggtatgggtgggtgagaagggcagttgagatggcagcattgatatgaatgaacactccatagaaactgaattctcttttgtacaagatcacctgacatgattgggaacagttgcttttaattacagatttaatttttttcttcgttaaagttttatgtaatttaaccctttgaagacagaagtagttggatgaaatgcacagtcaattattatagaaactgataacagggagtacttgttcccccttttgccttcttaagtacattgtttaaaactagggaaaaagggtatgtgtatattgtaaactatggatgttaacactcaaagaggttaagtcagtgaagtaacctattcatcaccagtaccgctgtaccactaataaattgtttgccaaatccttgtaataacatcttaattttagacaatcatgtcactgtttttaatgtttatttttttgtgtgtgttgcgtgtatcatgtatttatttgttggcaaactattgtttgttgattaaaatagcactgttccagtcagccactactttatgacgtctgaggcacacccctttccgaatttcaaggaccaaggtgacccgacctgtgtatgagagtgccaaatggtgtttggcttttcttaacattcctttttgtttgtttgttttgttttccttcttaatgaactaaatacgaatagatgcaacttagtttttgtaatactgaaatcgattcaattgtataaacgattataatttctttcatggaagcatgattcttctgattaaaaactgtactccatattttatgctggttgtctgcaagcttgtgcgatgttatgttcatgttaatcctatttgtaaaatgaagtgttcccaaccttatgttaaaagagagaagtaaataacagactgtattcagttattttgccctttattgaggaaccagatttgttttctttttgtttgtaatctcattttgaaataatcagcaagttgaggtactttcttcaaatgctttgtacaatataaactgttatgcctttcagtgcattactatgggaggagcaactaaaaaataaagacttacaaaaaggagtattttt

//

Annotations: