Home |
Help |
Advanced search
2024-04-20 01:09:12, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001161440 3401 bp mRNA linear PRI 11-MAY-2013
DEFINITION Homo sapiens protein tyrosine phosphatase, receptor type, H
(PTPRH), transcript variant 2, mRNA.
ACCESSION NM_001161440
VERSION NM_001161440.1 GI:241896925
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3401)
AUTHORS Pasquali,C., Curchod,M.L., Walchli,S., Espanel,X., Guerrier,M.,
Arigoni,F., Strous,G. and Hooft van Huijsduijnen,R.
TITLE Identification of protein tyrosine phosphatases with specificity
for the ligand-activated growth hormone receptor
JOURNAL Mol. Endocrinol. 17 (11), 2228-2239 (2003)
PUBMED 12907755
REFERENCE 2 (bases 1 to 3401)
AUTHORS Nagano,H., Noguchi,T., Inagaki,K., Yoon,S., Matozaki,T., Itoh,H.,
Kasuga,M. and Hayashi,Y.
TITLE Downregulation of stomach cancer-associated protein tyrosine
phosphatase-1 (SAP-1) in advanced human hepatocellular carcinoma
JOURNAL Oncogene 22 (30), 4656-4663 (2003)
PUBMED 12879010
REMARK GeneRIF: SAP-1 expression is downregulated during the
dedifferentiation of human hepatocellular carcinoma, which may play
a causal role in disease progression
REFERENCE 3 (bases 1 to 3401)
AUTHORS Takada,T., Noguchi,T., Inagaki,K., Hosooka,T., Fukunaga,K.,
Yamao,T., Ogawa,W., Matozaki,T. and Kasuga,M.
TITLE Induction of apoptosis by stomach cancer-associated
protein-tyrosine phosphatase-1
JOURNAL J. Biol. Chem. 277 (37), 34359-34366 (2002)
PUBMED 12101188
REMARK GeneRIF: SAP-1 induces apoptotic cell death by inhibition of cell
survival signaling mediated by PI 3-kinase, Akt, and ILK and
activation of a caspase-dependent proapoptotic pathway.
REFERENCE 4 (bases 1 to 3401)
AUTHORS Noguchi,T., Tsuda,M., Takeda,H., Takada,T., Inagaki,K., Yamao,T.,
Fukunaga,K., Matozaki,T. and Kasuga,M.
TITLE Inhibition of cell growth and spreading by stomach
cancer-associated protein-tyrosine phosphatase-1 (SAP-1) through
dephosphorylation of p130cas
JOURNAL J. Biol. Chem. 276 (18), 15216-15224 (2001)
PUBMED 11278335
REFERENCE 5 (bases 1 to 3401)
AUTHORS Marneros,A.G., Mehenni,H., Reichenberger,E., Antonarakis,S.E.,
Krieg,T. and Olsen,B.R.
TITLE Gene for the human transmembrane-type protein tyrosine phosphatase
H (PTPRH): genomic structure, fine-mapping and its exclusion as a
candidate for Peutz-Jeghers syndrome
JOURNAL Cytogenet. Cell Genet. 92 (3-4), 213-216 (2001)
PUBMED 11435690
REFERENCE 6 (bases 1 to 3401)
AUTHORS Matozaki,T., Suzuki,T., Uchida,T., Inazawa,J., Ariyama,T.,
Matsuda,K., Horita,K., Noguchi,H., Mizuno,H., Sakamoto,C. et al.
TITLE Molecular cloning of a human transmembrane-type protein tyrosine
phosphatase and its expression in gastrointestinal cancers
JOURNAL J. Biol. Chem. 269 (3), 2075-2081 (1994)
PUBMED 8294459
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AK097257.1, BC111715.1, AC010327.8 and AA573849.1.
Summary: The protein encoded by this gene is a member of the
protein tyrosine phosphatase (PTP) family. PTPs are known to be
signaling molecules that regulate a variety of cellular processes
including cell growth, differentiation, mitotic cycle, and
oncogenic transformation. This PTP possesses an extracellular
region, a single transmembrane region, and a single
intracytoplasmic catalytic domain, and thus represents a
receptor-type PTP. The extracellular region contains eight
fibronectin type III-like repeats and multiple N-glycosylation
sites. The gene was shown to be expressed primarily in brain and
liver, and at a lower level in heart and stomach. It was also found
to be expressed in several cancer cell lines, but not in the
corresponding normal tissues. Alternative splicing results in
multiple transcript variants. [provided by RefSeq, Jun 2009].
Transcript Variant: This variant (2) lacks two in-frame exons in
the 5' coding region, compared to variant 1. The encoded isoform
(2) is shorter than isoform 1.
##Evidence-Data-START##
Transcript exon combination :: BC111715.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-50 AK097257.1 1-50
51-404 BC111715.1 1-354
405-417 AC010327.8 100143-100155 c
418-1456 BC111715.1 368-1406
1457-1457 AC010327.8 90635-90635 c
1458-2005 BC111715.1 1408-1955
2006-2006 AC010327.8 81532-81532 c
2007-2124 BC111715.1 1957-2074
2125-2125 AC010327.8 79967-79967 c
2126-2390 BC111715.1 2076-2340
2391-2391 AC010327.8 79357-79357 c
2392-2863 BC111715.1 2342-2813
2864-3401 AA573849.1 1-538 c
FEATURES Location/Qualifiers
source 1..3401
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="19"
/map="19q13.4"
gene 1..3401
/gene="PTPRH"
/gene_synonym="SAP1"
/note="protein tyrosine phosphatase, receptor type, H"
/db_xref="GeneID:5794"
/db_xref="HGNC:9672"
/db_xref="MIM:602510"
exon 1..124
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
misc_feature 11..13
/gene="PTPRH"
/gene_synonym="SAP1"
/note="upstream in-frame stop codon"
CDS 74..2887
/gene="PTPRH"
/gene_synonym="SAP1"
/EC_number="3.1.3.48"
/note="isoform 2 precursor is encoded by transcript
variant 2; transmembrane-type protein-tyrosine phosphatase
type H; stomach cancer-associated protein tyrosine
phosphatase 1; receptor-type tyrosine-protein phosphatase
H; R-PTP-H"
/codon_start=1
/product="receptor-type tyrosine-protein phosphatase H
isoform 2 precursor"
/protein_id="NP_001154912.1"
/db_xref="GI:241896926"
/db_xref="CCDS:CCDS54321.1"
/db_xref="GeneID:5794"
/db_xref="HGNC:9672"
/db_xref="MIM:602510"
/translation="
MAGAGGGLGVWGNLVLLGLCSWTGARAPAPNPGRNLTVETQTTSSISLSWEVPDGLDSQNSNYWVQCTGDGGTTETRNTTATNVTVDGLGPGSLYTCSVWVEKDGVNSSVGTVTTATAPNPVRNLTVEAQTNSSIALTWEVPDGPDPQNSTYGVEYTGDGGRAGTRSTAHTNITVDRLEPGCLYVFSVWVGKNGINSSRETRNATTAPNPVRNLHMETQTNSSIALCWEVPDGPYPQDYTYWVEYTGDGGGTETRNTTNTSVTAERLEPGTLYTFSVWAEKNGARGSRQNVSISTVPNAVTSLSKQDWTNSTIALRWTAPQGPGQSSYSYWVSWVREGMTDPRTQSTSGTDITLKELEAGSLYHLTVWAERNEVRGYNSTLTAATAPNEVTDLQNETQTKNSVMLWWKAPGDPHSQLYVYWVQWASKGHPRRGQDPQANWVNQTSRTNETWYKVEALEPGTLYNFTVWAERNDVASSTQSLCASTYPDTVTITSCVSTSAGYGVNLIWSCPQGGYEAFELEVGGQRGSQDRSSCGEAVSVLGLGPARSYPATITTIWDGMKVVSHSVVCHTESAGVIAGAFVGILLFLILVGLLIFFLKRRNKKKQQKPELRDLVFSSPGDIPAEDFADHVRKNERDSNCGFADKYQQLSLVGHSQSQMVASASENNAKNRYRNVLPYDWSRVPLKPIHEEPGSDYINASFMPGLWSPQEFIATQGPLPQTVGDFWRLVWEQQSHTLVMLTNCMEAGRVKCEHYWPLDSQPCTHGHLRVTLVGEEVMENWTVRELLLLQVEEQKTLSVRQFHYQAWPDHGVPSSPDTLLAFWRMLRQWLDQTMEGGPPIVHCSAGVGRTGTLIALDVLLRQLQSEGLLGPFSFVRKMRESRPLMVQTEAQYVFLHQCILRFLQQSAQAPAEKEVPYEDVENLIYENVAAIQAHKLEV
"
sig_peptide 74..154
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 161..427
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(161..163,344..346,389..391)
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(392..397,401..406)
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 428..691
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(428..430,611..613,653..655)
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(656..661,665..670)
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 695..931
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(695..697,878..880,923..925)
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature 926..931
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 962..1231
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(962..964,1148..1150,1193..1195)
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(1196..1201,1205..1210)
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 1232..1501
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(1232..1234,1448..1450,1493..1495)
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature 1496..1501
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 1994..2773
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Protein tyrosine phosphatase, catalytic domain;
Region: PTPc; smart00194"
/db_xref="CDD:197567"
misc_feature 2078..2770
/gene="PTPRH"
/gene_synonym="SAP1"
/note="Protein tyrosine phosphatases (PTP) catalyze the
dephosphorylation of phosphotyrosine peptides; they
regulate phosphotyrosine levels in signal transduction
pathways. The depth of the active site cleft renders the
enzyme specific for phosphorylated Tyr; Region: PTPc;
cd00047"
/db_xref="CDD:28929"
misc_feature order(2495..2497,2594..2599,2606..2608,2615..2620)
/gene="PTPRH"
/gene_synonym="SAP1"
/note="active site"
/db_xref="CDD:28929"
exon 125..158
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
exon 159..425
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
exon 426..692
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
variation 581
/gene="PTPRH"
/gene_synonym="SAP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2288515"
exon 693..959
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
exon 960..1229
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
variation 1219
/gene="PTPRH"
/gene_synonym="SAP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2288518"
exon 1230..1529
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
variation 1441
/gene="PTPRH"
/gene_synonym="SAP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2288520"
variation 1457
/gene="PTPRH"
/gene_synonym="SAP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2288521"
exon 1530..1796
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
exon 1797..1875
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
exon 1876..1923
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
variation 1882
/gene="PTPRH"
/gene_synonym="SAP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2288523"
exon 1924..2014
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
variation 2006
/gene="PTPRH"
/gene_synonym="SAP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:890870"
exon 2015..2105
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
exon 2106..2182
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
variation 2125
/gene="PTPRH"
/gene_synonym="SAP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1136578"
exon 2183..2317
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
exon 2318..2440
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
exon 2441..2601
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
exon 2602..2737
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
exon 2738..3394
/gene="PTPRH"
/gene_synonym="SAP1"
/inference="alignment:Splign:1.39.8"
variation 2765
/gene="PTPRH"
/gene_synonym="SAP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2288419"
variation 2886
/gene="PTPRH"
/gene_synonym="SAP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2288420"
STS 2927..3070
/gene="PTPRH"
/gene_synonym="SAP1"
/standard_name="STS-D15049"
/db_xref="UniSTS:50041"
STS 2950..3093
/gene="PTPRH"
/gene_synonym="SAP1"
/standard_name="D19S1081"
/db_xref="UniSTS:12607"
variation 2994
/gene="PTPRH"
/gene_synonym="SAP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:17458"
ORIGIN
ttcttgagtgtaaagtccagcaggtggaaggactaggcctgggactcctgggtccccggcagtgtctggaggcatggctggggctggcgggggcctcggggtctgggggaacctggtgctgctgggcctgtgcagctggacaggggccagggcgcctgcccccaacccagggaggaacctgacagtggagactcagaccaccagctccatctccctgagctgggaggtccccgatggcctagactcacagaactccaactactgggttcagtgtactggagacggcggcacaacagagactcgaaacacaacagccaccaacgtcaccgtggatggccttggacccgggtcattgtatacgtgttctgtgtgggtggagaaagacggagtaaatagctctgtggggactgtcactactgccacagctcccaacccagtgagaaacctgacagtggaggctcagaccaacagctccatcgccctgacctgggaggtccccgatggcccagacccacagaactccacctacggggttgagtacactggagatggtggcagagcagggactcgaagcacagcacacaccaacatcaccgtggatagacttgaacccgggtgtttgtatgtgttttccgtgtgggtggggaagaatggaatcaacagctcccgggagactcgaaatgccaccacagcccccaacccagtgagaaacctccatatggagactcagaccaacagctccatcgccctatgctgggaagtccccgatggcccataccctcaggactacacctactgggtagagtacactggagacggtggtggcacagagacccgaaacacaacaaataccagtgtgacagctgagagacttgagcccggaaccttgtacacattctctgtatgggcagaaaaaaatggagcacgtggctccaggcagaatgtcagcatctccacagtccccaacgcagtgacaagcctcagcaagcaggactggaccaacagcaccattgctttgcgctggacagctccccagggcccaggccagtcttcctacagctactgggtctcatgggtcagggaaggcatgactgaccccaggacccaaagcacctcaggtactgacatcaccctaaaggaactggaagctggcagcctgtaccacctcaccgtctgggccgagaggaatgaggtcagaggctataacagcaccctcactgcagccactgctcccaatgaggtcacagatctccagaatgaaactcagactaagaactcagtcatgctgtggtggaaggcccctggagacccccactctcagttgtacgtatactgggtccagtgggccagcaagggacatccccggagggggcaagatccccaagcgaattgggtcaaccagaccagcaggaccaatgagacgtggtacaaagtggaggccctggaacccgggacgttgtacaatttcaccgtgtgggcagagaggaatgacgtagccagttccacgcagagcctctgtgcgtccacatacccagacacagtcaccatcacttcctgtgtcagcacctcagcgggctatggagtcaacttgatctggtcctgcccccagggaggctacgaggcctttgagttggaggtgggaggacagcggggctcccaggacagatcttcatgtggggaggctgtgtctgtgttgggtctcgggccggctcggtcctacccagccaccatcacgaccatctgggacggaatgaaggtcgtgtctcactctgtggtctgccacaccgagagtgcaggggtcattgccggagcctttgtgggcatcctcctgtttctcatcctcgtgggcctgctgattttcttcctgaagaggaggaataagaagaagcagcagaaaccagaactcagggatctggtctttagctccccaggggacatcccagctgaagacttcgctgaccacgtcaggaagaatgagagggacagcaactgtggttttgcagacaagtaccagcaactctccctggtgggccacagccagtctcagatggtggcttcggcttcagagaacaacgccaagaaccgctacagaaatgtgctgccctatgactggtcccgggtgcccctgaagcccatccatgaggagccaggctctgactacatcaatgccagcttcatgcccggtctctggagcccccaggagttcattgcaacccagggtcccctgccacagacagtgggtgacttctggcgcctggtgtgggaacagcagagccacaccctggtcatgctgaccaactgcatggaggccggccgggtgaagtgtgagcattactggcctctggactcgcagccctgcacccatgggcacctgcgggtaaccctggtaggtgaggaagtgatggagaactggacggtgcgggaactgctgctcctccaggtggaggagcagaagacactgtctgtgcgccaattccactaccaggcctggccggatcacggcgttccctcctccccagacaccttgctggctttctggaggatgcttcggcagtggctggatcagaccatggagggaggcccacccattgtgcactgcagtgctggcgtgggtcgcacaggaaccctcattgccctggacgtcctgctccggcagctgcagtccgagggtctccttgggcccttcagctttgtaaggaagatgagagagagtcggccgttgatggtgcagactgaggctcagtacgtattcctgcatcagtgcatcctgcggttcctccaacagtcagcccaggccccagccgagaaggaagtcccgtatgaggatgtcgaaaacctcatctacgagaacgtggccgccatccaggcccacaagttggaggtctaagtgacgagggggctgggtcggcagcccaggcatcctcaagctctggacacccacttgagcccagattcctggaagagcagagggctgggctcccagactcctgggtgctgtgggaggagggggctggtatcccaaactctggtttccccaggagagagtggtctggtgggcttcagatgagtcctatgggagctggggatctggattcctggttccctgaaggaggagagggatgatagcttggattccctaggtctttccaggatgcagaaagaaacaggctggggcctggattctgaggcaggaaggaatttgggtctggagttctggctacttgaggaccaaaggcaggaaggatcctgccttgattttacttcagaaaccaaatcagtcttctataatctggggtcggagggagtccctgtgcccaaggtctctctgcaccccaccatccacatgtatttttccttctatcccataatttattaaatcactgttctccccagaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5794 -> Molecular function: GO:0005001 [transmembrane receptor protein tyrosine phosphatase activity] evidence: TAS
GeneID:5794 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:5794 -> Biological process: GO:0006470 [protein dephosphorylation] evidence: TAS
GeneID:5794 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:5794 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:5794 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:5794 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:5794 -> Cellular component: GO:0005739 [mitochondrion] evidence: IDA
GeneID:5794 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001154912 -> EC 3.1.3.48
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.