Home |
Help |
Advanced search
2024-04-20 19:09:14, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001160161 8343 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens sodium channel, voltage-gated, type V, alpha subunit
(SCN5A), transcript variant 6, mRNA.
ACCESSION NM_001160161
VERSION NM_001160161.1 GI:237512981
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 8343)
AUTHORS Crotti,L., Tester,D.J., White,W.M., Bartos,D.C., Insolia,R.,
Besana,A., Kunic,J.D., Will,M.L., Velasco,E.J., Bair,J.J.,
Ghidoni,A., Cetin,I., Van Dyke,D.L., Wick,M.J., Brost,B.,
Delisle,B.P., Facchinetti,F., George,A.L., Schwartz,P.J. and
Ackerman,M.J.
TITLE Long QT syndrome-associated mutations in intrauterine fetal death
JOURNAL JAMA 309 (14), 1473-1482 (2013)
PUBMED 23571586
REMARK GeneRIF: 5 intrauterine fetal deaths hosted SCN5A rare
nonsynonymous genetic variants that conferred in vitro
electrophysiological characteristics consistent with potentially
proarrhythmic phenotypes.
REFERENCE 2 (bases 1 to 8343)
AUTHORS Ritchie MD, Denny JC, Zuvich RL, Crawford DC, Schildcrout JS,
Bastarache L, Ramirez AH, Mosley JD, Pulley JM, Basford MA,
Bradford Y, Rasmussen LV, Pathak J, Chute CG, Kullo IJ, McCarty CA,
Chisholm RL, Kho AN, Carlson CS, Larson EB, Jarvik GP, Sotoodehnia
N, Manolio TA, Li R, Masys DR, Haines JL and Roden DM.
CONSRTM Cohorts for Heart and Aging Research in Genomic Epidemiology
(CHARGE) QRS Group
TITLE Genome- and phenome-wide analyses of cardiac conduction identifies
markers of arrhythmia risk
JOURNAL Circulation 127 (13), 1377-1385 (2013)
PUBMED 23463857
REFERENCE 3 (bases 1 to 8343)
AUTHORS Hu,R.M., Tan,B.H., Orland,K.M., Valdivia,C.R., Peterson,A., Pu,J.
and Makielski,J.C.
TITLE Digenic inheritance novel mutations in SCN5a and SNTA1 increase
late I(Na) contributing to LQT syndrome
JOURNAL Am. J. Physiol. Heart Circ. Physiol. 304 (7), H994-H1001 (2013)
PUBMED 23376825
REMARK GeneRIF: Novel mutations in SCN5A and SNTA1 jointly increase the
INa current late/peak ratio and time constants of current decay.
REFERENCE 4 (bases 1 to 8343)
AUTHORS Calloe,K., Refaat,M.M., Grubb,S., Wojciak,J., Campagna,J.,
Thomsen,N.M., Nussbaum,R.L., Scheinman,M.M. and Schmitt,N.
TITLE Characterization and mechanisms of action of novel NaV1.5 channel
mutations associated with Brugada syndrome
JOURNAL Circ Arrhythm Electrophysiol 6 (1), 177-184 (2013)
PUBMED 23424222
REMARK GeneRIF: Na(V)1.5-S1218I and R811H are novel loss-of-function
mutations in the SCN5A gene causing Brugada syndrome.
REFERENCE 5 (bases 1 to 8343)
AUTHORS Vanoye,C.G., Kunic,J.D., Ehring,G.R. and George,A.L. Jr.
TITLE Mechanism of sodium channel NaV1.9 potentiation by G-protein
signaling
JOURNAL J. Gen. Physiol. 141 (2), 193-202 (2013)
PUBMED 23359282
REMARK GeneRIF: Our results advance our understanding about the mechanism
of Na(V)1.9 potentiation by G-protein signaling during
inflammation.
REFERENCE 6 (bases 1 to 8343)
AUTHORS Olson,T.M. and Keating,M.T.
TITLE Mapping a cardiomyopathy locus to chromosome 3p22-p25
JOURNAL J. Clin. Invest. 97 (2), 528-532 (1996)
PUBMED 8567977
REFERENCE 7 (bases 1 to 8343)
AUTHORS Wang,Q., Shen,J., Li,Z., Timothy,K., Vincent,G.M., Priori,S.G.,
Schwartz,P.J. and Keating,M.T.
TITLE Cardiac sodium channel mutations in patients with long QT syndrome,
an inherited cardiac arrhythmia
JOURNAL Hum. Mol. Genet. 4 (9), 1603-1607 (1995)
PUBMED 8541846
REFERENCE 8 (bases 1 to 8343)
AUTHORS George,A.L. Jr., Varkony,T.A., Drabkin,H.A., Han,J., Knops,J.F.,
Finley,W.H., Brown,G.B., Ward,D.C. and Haas,M.
TITLE Assignment of the human heart tetrodotoxin-resistant voltage-gated
Na+ channel alpha-subunit gene (SCN5A) to band 3p21
JOURNAL Cytogenet. Cell Genet. 68 (1-2), 67-70 (1995)
PUBMED 7956363
REFERENCE 9 (bases 1 to 8343)
AUTHORS Jiang,C., Atkinson,D., Towbin,J.A., Splawski,I., Lehmann,M.H.,
Li,H., Timothy,K., Taggart,R.T., Schwartz,P.J., Vincent,G.M. et al.
TITLE Two long QT syndrome loci map to chromosomes 3 and 7 with evidence
for further heterogeneity
JOURNAL Nat. Genet. 8 (2), 141-147 (1994)
PUBMED 7842012
REFERENCE 10 (bases 1 to 8343)
AUTHORS Gellens,M.E., George,A.L. Jr., Chen,L.Q., Chahine,M., Horn,R.,
Barchi,R.L. and Kallen,R.G.
TITLE Primary structure and functional expression of the human cardiac
tetrodotoxin-insensitive voltage-dependent sodium channel
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (2), 554-558 (1992)
PUBMED 1309946
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BC051374.1, AB158470.2,
BC140813.1, AF482988.1 and AY038064.1.
Summary: The protein encoded by this gene is an integral membrane
protein and tetrodotoxin-resistant voltage-gated sodium channel
subunit. This protein is found primarily in cardiac muscle and is
responsible for the initial upstroke of the action potential in an
electrocardiogram. Defects in this gene are a cause of long QT
syndrome type 3 (LQT3), an autosomal dominant cardiac disease.
Alternative splicing results in several transcript variants
encoding different isoforms. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (6) uses an alternate, duplicated
exon in the 5' coding region and lacks an alternate in-frame exon
in the central coding region, compared to variant 1. The resulting
isoform (f) differs at a few internal aa near the N-terminus and
lacks a 54-aa segment, compared to isoform a.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
CDS exon combination :: AB158470.2 [ECO:0000331]
RNAseq introns :: mixed/partial sample support ERS025081,
ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-153 BC051374.1 1-153
154-766 AB158470.2 1-613
767-767 BC140813.1 597-597
768-2111 AB158470.2 615-1958
2112-2152 BC140813.1 1942-1982
2153-3155 AB158470.2 2000-3002
3156-3378 AF482988.1 2970-3192
3379-4468 AB158470.2 3226-4315
4469-6118 AF482988.1 4442-6091
6119-7277 BC140813.1 6012-7170
7278-8229 AY038064.1 7300-8251
8230-8343 AY038064.1 8277-8390
FEATURES Location/Qualifiers
source 1..8343
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3p21"
gene 1..8343
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="sodium channel, voltage-gated, type V, alpha
subunit"
/db_xref="GeneID:6331"
/db_xref="HGNC:10593"
/db_xref="MIM:600163"
exon 1..143
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
variation 131
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45608739"
exon 144..468
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
CDS 196..6084
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="isoform f is encoded by transcript variant 6;
cardiac tetrodotoxin-insensitive voltage-dependent sodium
channel alpha subunit; sodium channel protein type 5
subunit alpha; voltage-gated sodium channel subunit alpha
Nav1.5; sodium channel protein cardiac muscle subunit
alpha"
/codon_start=1
/product="sodium channel protein type 5 subunit alpha
isoform f"
/protein_id="NP_001153633.1"
/db_xref="GI:237512982"
/db_xref="CCDS:CCDS54569.1"
/db_xref="GeneID:6331"
/db_xref="HGNC:10593"
/db_xref="MIM:600163"
/translation="
MANFLLPRGTSSFRRFTRESLAAIEKRMAEKQARGSTTLQESREGLPEEEAPRPQLDLQASKKLPDLYGNPPQELIGEPLEDLDPFYSTQKTFIVLNKGKTIFRFSATNALYVLSPFHPIRRAAVKILVHSLFNMLIMCTILTNCVFMAQHDPPPWTKYVEYTFTAIYTFESLVKILARGFCLHAFTFLRDPWNWLDFSVIIMAYVSENIKLGNLSALRTFRVLRALKTISVIPGLKTIVGALIQSVKKLADVMVLTVFCLSVFALIGLQLFMGNLRHKCVRNFTALNGTNGSVEADGLVWESLDLYLSDPENYLLKNGTSDVLLCGNSSDAGTCPEGYRCLKAGENPDHGYTSFDSFAWAFLALFRLMTQDCWERLYQQTLRSAGKIYMIFFMLVIFLGSFYLVNLILAVVAMAYEEQNQATIAETEEKEKRFQEAMEMLKKEHEALTIRGVDTVSRSSLEMSPLAPVNSHERRSKRRKRMSSGTEECGEDRLPKSDSEDGPRAMNHLSLTRGLSRTSMKPRSSRGSIFTFRRRDLGSEADFADDENSTAGESESHHTSLLVPWPLRRTSAQGQPSPGTSAPGHALHGKKNSTVDCNGVVSLLGAGDPEATSPGSHLLRPVMLEHPPDTTTPSEEPGGPQMLTSQAPCVDGFEEPGARQRALSAVSVLTSALEELEESRHKCPPCWNRLAQRYLIWECCPLWMSIKQGVKLVVMDPFTDLTITMCIVLNTLFMALEHYNMTSEFEEMLQVGNLVFTGIFTAEMTFKIIALDPYYYFQQGWNIFDSIIVILSLMELGLSRMSNLSVLRSFRLLRVFKLAKSWPTLNTLIKIIGNSVGALGNLTLVLAIIVFIFAVVGMQLFGKNYSELRDSDSGLLPRWHMMDFFHAFLIIFRILCGEWIETMWDCMEVSGQSLCLLVFLLVMVIGNLVVLNLFLALLLSSFSADNLTAPDEDREMNNLQLALARIQRGLRFVKRTTWDFCCGLLRQRPQKPAALAAQGQLPSCIATPYSPPPPETEKVPPTRKETRFEEGEQPGQGTPGDPEPVCVPIAVAESDTDDQEEDEENSLGTEEESSKQTPEDSCSEGSTADMTNTAELLEQIPDLGQDVKDPEDCFTEGCVRRCPCCAVDTTQAPGKVWWRLRKTCYHIVEHSWFETFIIFMILLSSGALAFEDIYLEERKTIKVLLEYADKMFTYVFVLEMLLKWVAYGFKKYFTNAWCWLDFLIVDVSLVSLVANTLGFAEMGPIKSLRTLRALRPLRALSRFEGMRVVVNALVGAIPSIMNVLLVCLIFWLIFSIMGVNLFAGKFGRCINQTEGDLPLNYTIVNNKSQCESLNLTGELYWTKVKVNFDNVGAGYLALLQVATFKGWMDIMYAAVDSRGYEEQPQWEYNLYMYIYFVIFIIFGSFFTLNLFIGVIIDNFNQQKKKLGGQDIFMTEEQKKYYNAMKKLGSKKPQKPIPRPLNKYQGFIFDIVTKQAFDVTIMFLICLNMVTMMVETDDQSPEKINILAKINLLFVAIFTGECIVKLAALRHYYFTNSWNIFDFVVVILSIVGTVLSDIIQKYFFSPTLFRVIRLARIGRILRLIRGAKGIRTLLFALMMSLPALFNIGLLLFLVMFIYSIFGMANFAYVKWEAGIDDMFNFQTFANSMLCLFQITTSAGWDGLLSPILNTGPPYCDPTLPNSNGSRGDCGSPAVGILFFTTYIIISFLIVVNMYIAIILENFSVATEESTEPLSEDDFDMFYEIWEKFDPEATQFIEYSVLSDFADALSEPLRIAKPNQISLINMDLPMVSGDRIHCMDILFAFTKRVLGESGEMDALKIQMEEKFMAANPSKISYEPITTTLRRKHEEVSAMVIQRAFRRHLLQRSLKHASFLFRQQAGSGLSEEDAPEREGLIAYVMSENFSRPLGPPSSSSISSTSFPPSYDSVTRATSDNLQVRGSDYSHSEDLADFPPSPDRDRESIV
"
misc_feature 670..>1068
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature <1201..1431
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 1576..2199
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Domain of unknown function (DUF3451); Region:
DUF3451; pfam11933"
/db_xref="CDD:204785"
misc_feature 2452..2973
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 3052..3678
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Sodium ion transport-associated; Region:
Na_trans_assoc; pfam06512"
/db_xref="CDD:203469"
misc_feature 3754..4440
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 4720..5346
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature <4726..5367
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Polycystin cation channel; Region: PKD_channel;
pfam08016"
/db_xref="CDD:203839"
exon 469..587
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
STS 469..587
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="GDB:624564"
/db_xref="UniSTS:158350"
variation 549
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45533640"
exon 588..677
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
exon 678..806
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
variation 681
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45489099"
exon 807..898
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
variation 843
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45475402"
exon 899..1129
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 7, numbering commonly used in
literature and the LOVD database."
variation 939
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45453395"
variation 996
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45587735"
variation 1035
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:72549413"
exon 1130..1193
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 8, numbering commonly used in
literature and the LOVD database."
exon 1194..1335
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 9, numbering commonly used in
literature and the LOVD database."
variation 1212
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:17215493"
variation 1260
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45570333"
exon 1336..1533
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 10, numbering commonly used
in literature and the LOVD database."
variation 1431
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45565936"
exon 1534..1713
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 11, numbering commonly used
in literature and the LOVD database."
variation 1542
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45477694"
exon 1714..2085
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 12, numbering commonly used
in literature and the LOVD database."
variation 1782
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45624133"
variation 1876
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45522138"
variation 1897
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45600438"
exon 2086..2218
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 13, numbering commonly used
in literature and the LOVD database."
exon 2219..2457
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 14, numbering commonly used
in literature and the LOVD database."
variation 2367
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="t"
/db_xref="dbSNP:45583237"
exon 2458..2631
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 15, numbering commonly used
in literature and the LOVD database."
exon 2632..2982
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 16, numbering commonly used
in literature and the LOVD database."
STS 2962..3672
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="Scn5a"
/db_xref="UniSTS:516644"
exon 2983..3423
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 17, numbering commonly used
in literature and the LOVD database."
variation 3316
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45491996"
variation 3363
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45480800"
exon 3424..3544
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 19, numbering commonly used
in literature and the LOVD database."
exon 3545..3699
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 20, numbering commonly used
in literature and the LOVD database."
variation 3597
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:17221875"
exon 3700..3873
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 21, numbering commonly used
in literature and the LOVD database."
exon 3874..3996
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 22, numbering commonly used
in literature and the LOVD database."
exon 3997..4278
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 23, numbering commonly used
in literature and the LOVD database."
exon 4279..4332
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 24, numbering commonly used
in literature and the LOVD database."
exon 4333..4470
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 25, numbering commonly used
in literature and the LOVD database."
exon 4471..4575
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 26, numbering commonly used
in literature and the LOVD database."
exon 4576..4846
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 27, numbering commonly used
in literature and the LOVD database."
STS 4654..5046
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="Scn3a"
/db_xref="UniSTS:516640"
exon 4847..8343
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 28, numbering commonly used
in literature and the LOVD database."
variation 4857
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45437099"
variation 5281
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45606037"
variation 5490
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1805126"
STS 5946..6302
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="GDB:555574"
/db_xref="UniSTS:157686"
variation 6212
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45601739"
STS 6290..6468
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="D3S4190"
/db_xref="UniSTS:43452"
STS 6335..6632
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="GDB:624573"
/db_xref="UniSTS:158352"
variation 6466
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45459402"
variation 6636
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45615435"
variation 6679
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:4073687"
variation 6743
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45446194"
variation 6761
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45458203"
variation 6906
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45600839"
variation 7106
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45548632"
variation 7288
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45502198"
variation 7520
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45589543"
variation 7652
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:45503498"
variation 7693
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace=""
/replace="c"
/db_xref="dbSNP:45589940"
variation 7705
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45512996"
variation 7708
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45441103"
STS 7758..8298
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="SCN5A_3457"
/db_xref="UniSTS:471751"
variation 7827
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45474195"
variation 7884
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45615238"
variation 7904
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:45610536"
variation 7968
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45624736"
variation 8091
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45593136"
variation 8219
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45502793"
variation 8229..8230
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace=""
/replace="gagaagagagtaggaaaaaggaggg"
/db_xref="dbSNP:45592631"
polyA_signal 8326..8331
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
polyA_site 8343
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
ORIGIN
gagacggcggcggcgcccgtaggatgcagggatcgctcccccggggccgctgagcctgcgcccagtgccccgagccccgcgccgagccgagtccgcgccaagcagcagccgcccaccccggggcccggccgggggaccagcagcttccccacaggcaacgtgaggagagcctgtgcccagaagcaggatgagaagatggcaaacttcctattacctcggggcaccagcagcttccgcaggttcacacgggagtccctggcagccatcgagaagcgcatggcagagaagcaagcccgcggctcaaccaccttgcaggagagccgagaggggctgcccgaggaggaggctccccggccccagctggacctgcaggcctccaaaaagctgccagatctctatggcaatccaccccaagagctcatcggagagcccctggaggacctggaccccttctatagcacccaaaagactttcatcgtactgaataaaggcaagaccatcttccggttcagtgccaccaacgccttgtatgtcctcagtcccttccaccccatccggagagcggctgtgaagattctggttcactcgctcttcaacatgctcatcatgtgcaccatcctcaccaactgcgtgttcatggcccagcacgaccctccaccctggaccaagtatgtcgagtacaccttcaccgccatttacacctttgagtctctggtcaagattctggctcgaggcttctgcctgcacgcgttcactttccttcgggacccatggaactggctggactttagtgtgattatcatggcgtatgtatcagaaaatataaaactaggcaatttgtcggctcttcgaactttcagagtcctgagagctctaaaaactatttcagttatcccagggctgaagaccatcgtgggggccctgatccagtctgtgaagaagctggctgatgtgatggtcctcacagtcttctgcctcagcgtctttgccctcatcggcctgcagctcttcatgggcaacctaaggcacaagtgcgtgcgcaacttcacagcgctcaacggcaccaacggctccgtggaggccgacggcttggtctgggaatccctggacctttacctcagtgatccagaaaattacctgctcaagaacggcacctctgatgtgttactgtgtgggaacagctctgacgctgggacatgtccggagggctaccggtgcctaaaggcaggcgagaaccccgaccacggctacaccagcttcgattcctttgcctgggcctttcttgcactcttccgcctgatgacgcaggactgctgggagcgcctctatcagcagaccctcaggtccgcagggaagatctacatgatcttcttcatgcttgtcatcttcctggggtccttctacctggtgaacctgatcctggccgtggtcgcaatggcctatgaggagcaaaaccaagccaccatcgctgagaccgaggagaaggaaaagcgcttccaggaggccatggaaatgctcaagaaagaacacgaggccctcaccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggccccagtaaacagccatgagagaagaagcaagaggagaaaacggatgtcttcaggaactgaggagtgtggggaggacaggctccccaagtctgactcagaagatggtcccagagcaatgaatcatctcagcctcacccgtggcctcagcaggacttctatgaagccacgttccagccgcgggagcattttcacctttcgcaggcgagacctgggttctgaagcagattttgcagatgatgaaaacagcacagcgggggagagcgagagccaccacacatcactgctggtgccctggcccctgcgccggaccagtgcccagggacagcccagtcccggaacctcggctcctggccacgccctccatggcaaaaagaacagcactgtggactgcaatggggtggtctcattactgggggcaggcgacccagaggccacatccccaggaagccacctcctccgccctgtgatgctagagcacccgccagacacgaccacgccatcggaggagccaggcgggccccagatgctgacctcccaggctccgtgtgtagatggcttcgaggagccaggagcacggcagcgggccctcagcgcagtcagcgtcctcaccagcgcactggaagagttagaggagtctcgccacaagtgtccaccatgctggaaccgtctcgcccagcgctacctgatctgggagtgctgcccgctgtggatgtccatcaagcagggagtgaagttggtggtcatggacccgtttactgacctcaccatcactatgtgcatcgtactcaacacactcttcatggcgctggagcactacaacatgacaagtgaattcgaggagatgctgcaggtcggaaacctggtcttcacagggattttcacagcagagatgaccttcaagatcattgccctcgacccctactactacttccaacagggctggaacatcttcgacagcatcatcgtcatccttagcctcatggagctgggcctgtcccgcatgagcaacttgtcggtgctgcgctccttccgcctgctgcgggtcttcaagctggccaaatcatggcccaccctgaacacactcatcaagatcatcgggaactcagtgggggcactggggaacctgacactggtgctagccatcatcgtgttcatctttgctgtggtgggcatgcagctctttggcaagaactactcggagctgagggacagcgactcaggcctgctgcctcgctggcacatgatggacttctttcatgccttcctcatcatcttccgcatcctctgtggagagtggatcgagaccatgtgggactgcatggaggtgtcggggcagtcattatgcctgctggtcttcttgcttgttatggtcattggcaaccttgtggtcctgaatctcttcctggccttgctgctcagctccttcagtgcagacaacctcacagcccctgatgaggacagagagatgaacaacctccagctggccctggcccgcatccagaggggcctgcgctttgtcaagcggaccacctgggatttctgctgtggtctcctgcggcagcggcctcagaagcccgcagcccttgccgcccagggccagctgcccagctgcattgccaccccctactccccgccacccccagagacggagaaggtgcctcccacccgcaaggaaacacggtttgaggaaggcgagcaaccaggccagggcacccccggggatccagagcccgtgtgtgtgcccatcgctgtggccgagtcagacacagatgaccaagaagaagatgaggagaacagcctgggcacggaggaggagtccagcaagcagaccccagaggacagttgctccgagggcagcacagcagacatgaccaacaccgctgagctcctggagcagatccctgacctcggccaggatgtcaaggacccagaggactgcttcactgaaggctgtgtccggcgctgtccctgctgtgcggtggacaccacacaggccccagggaaggtctggtggcggttgcgcaagacctgctaccacatcgtggagcacagctggttcgagacattcatcatcttcatgatcctactcagcagtggagcgctggccttcgaggacatctacctagaggagcggaagaccatcaaggttctgcttgagtatgccgacaagatgttcacatatgtcttcgtgctggagatgctgctcaagtgggtggcctacggcttcaagaagtacttcaccaatgcctggtgctggctcgacttcctcatcgtagacgtctctctggtcagcctggtggccaacaccctgggctttgccgagatgggccccatcaagtcactgcggacgctgcgtgcactccgtcctctgagagctctgtcacgatttgagggcatgagggtggtggtcaatgccctggtgggcgccatcccgtccatcatgaacgtcctcctcgtctgcctcatcttctggctcatcttcagcatcatgggcgtgaacctctttgcggggaagtttgggaggtgcatcaaccagacagagggagacttgcctttgaactacaccatcgtgaacaacaagagccagtgtgagtccttgaacttgaccggagaattgtactggaccaaggtgaaagtcaactttgacaacgtgggggccgggtacctggcccttctgcaggtggcaacatttaaaggctggatggacattatgtatgcagctgtggactccagggggtatgaagagcagcctcagtgggaatacaacctctacatgtacatctattttgtcattttcatcatctttgggtctttcttcaccctgaacctctttattggtgtcatcattgacaacttcaaccaacagaagaaaaagttagggggccaggacatcttcatgacagaggagcagaagaagtactacaatgccatgaagaagctgggctccaagaagccccagaagcccatcccacggcccctgaacaagtaccagggcttcatattcgacattgtgaccaagcaggcctttgacgtcaccatcatgtttctgatctgcttgaatatggtgaccatgatggtggagacagatgaccaaagtcctgagaaaatcaacatcttggccaagatcaacctgctctttgtggccatcttcacaggcgagtgtattgtcaagctggctgccctgcgccactactacttcaccaacagctggaatatcttcgacttcgtggttgtcatcctctccatcgtgggcactgtgctctcggacatcatccagaagtacttcttctccccgacgctcttccgagtcatccgcctggcccgaataggccgcatcctcagactgatccgaggggccaaggggatccgcacgctgctctttgccctcatgatgtccctgcctgccctcttcaacatcgggctgctgctcttcctcgtcatgttcatctactccatctttggcatggccaacttcgcttatgtcaagtgggaggctggcatcgacgacatgttcaacttccagaccttcgccaacagcatgctgtgcctcttccagatcaccacgtcggccggctgggatggcctcctcagccccatcctcaacactgggccgccctactgcgaccccactctgcccaacagcaatggctctcggggggactgcgggagcccagccgtgggcatcctcttcttcaccacctacatcatcatctccttcctcatcgtggtcaacatgtacattgccatcatcctggagaacttcagcgtggccacggaggagagcaccgagcccctgagtgaggacgacttcgatatgttctatgagatctgggagaaatttgacccagaggccactcagtttattgagtattcggtcctgtctgactttgccgatgccctgtctgagccactccgtatcgccaagcccaaccagataagcctcatcaacatggacctgcccatggtgagtggggaccgcatccattgcatggacattctctttgccttcaccaaaagggtcctgggggagtctggggagatggacgccctgaagatccagatggaggagaagttcatggcagccaacccatccaagatctcctacgagcccatcaccaccacactccggcgcaagcacgaagaggtgtcggccatggttatccagagagccttccgcaggcacctgctgcaacgctctttgaagcatgcctccttcctcttccgtcagcaggcgggcagcggcctctccgaagaggatgcccctgagcgagagggcctcatcgcctacgtgatgagtgagaacttctcccgaccccttggcccaccctccagctcctccatctcctccacttccttcccaccctcctatgacagtgtcactagagccaccagcgataacctccaggtgcgggggtctgactacagccacagtgaagatctcgccgacttccccccttctccggacagggaccgtgagtccatcgtgtgagcctcggcctggctggccaggacacactgaaaagcagcctttttcaccatggcaaacctaaatgcagtcagtcacaaaccagcctggggccttcctggctttgggagtaagaaatgggcctcagccccgcggatcaaccaggcagagttctgtggcgccgcgtggacagccggagcagttggcctgtgcttggaggcctcagatagacctgtgacctggtctggtcaggcaatgccctgcggctctggaaagcaacttcatcccagctgctgaggcgaaatataaaactgagactgtatatgttgtgaatgggctttcataaatttattatatttgatatttttttacttgagcaaagaactaaggatttttccatggacatgggcagcaattcacgctgtctcttcttaaccctgaacaagagtgtctatggagcagccggaagtctgttctcaaagcagaagtggaatccagtgtggctcccacaggtcttcactgcccaggggtcgaatggggtccccctcccacttgacctgagatgctgggagggctgaacccccactcacacaagcacacacacacagtcctcacacacggaggccagacacaggccgtgggacccaggctcccagcctaagggagacaggcctttccctgccggccccccaaggatggggttcttgtccacggggctcactctggccccctattgtctccaaggtcccattttccccctgtgttttcacgcaggtcatattgtcagtcctacaaaaataaaaggcttccagaggagagtggcctgggtcccagggctggccctaggcactgatagttgccttttcttcccctcctgtaagagtattaacaaaaccaaaggacacaagggtgcaagccccattcacggcctggcatgcagcttgtccttgctcctggaacctggcaggccctgcccagccagccatcggaagagagggctgagccatgggggtttggggctaagaagttcaccagccctgagccatggcggcccctcagcctgcctgaagagaggaaactggcgatctcccagggctctctggaccatacgcggaggagttttctgtgtggtctccagctcctctccagacacagagacatgggagtggggagcggagcttggccctgcgccctgtgcagggaaagggatggtcaggcccagttctcgtgcccttagaggggaatgaaccatggcacctttgagagagggggcactgtggtcaggcccagcctctctggctcagcccgggatcctgatggcacccacacagaggacctctttggggcaagatccaggtggtcccataggtcttgtgaaaaggctttttcagggaaaaatattttactagtccaatcacccccaggacctcttcagctgctgacaatcctatttagcatatgcaaatcttttaacatagagaactgtcaccctgaggtaacagggtcaactggcgaagcctgagcaggcaggggcttggctgccccattccagctctcccatggagcccctccaccgggcgcatgcctcccaggccacctcagtctcacctgccggctctgggctggctgctcctaacctacctcgccgagctgtcggagggctggacatttgtggcagtgctgaagggggcattgccggcgagtaaagtattatgtttcttcttgtcaccccagttcccttggtggcaaccccagacccaacccatgcccctgacagatctagttctcttctcctgtgttccctttgagtccagtgtgggacacggtttaactgtcccagcgacatttctccaagtggaaatcctatttttgtagatctccatgctttgctctcaaggcttggagaggtatgtgcccctcctgggtgctcaccgcctgctacacaggcaggaatgcggttgggaggcaggtcgggctgccagcccagctggccggaaggagactgtggtttttgtgtgtgtggacagcccgggagctttgagacaggtgcctggggctggctgcagacggtgtggttgggggtgggaggtgagctagacccaacccttagcttttagcctggctgtcacctttttaatttccagaactgcacaatgaccagcaggagggaaggacagacatcaagtgccagatgttgtctgaactaatcgagcacttctcaccaaacttcatgtataaataaaatacatatttttaaaacaaaccaataaatggcttacatga
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6331 -> Molecular function: GO:0005248 [voltage-gated sodium channel activity] evidence: IDA
GeneID:6331 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0030506 [ankyrin binding] evidence: IDA
GeneID:6331 -> Molecular function: GO:0044325 [ion channel binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IDA
GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IMP
GeneID:6331 -> Molecular function: GO:0097110 [scaffold protein binding] evidence: IPI
GeneID:6331 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP
GeneID:6331 -> Biological process: GO:0003231 [cardiac ventricle development] evidence: ISS
GeneID:6331 -> Biological process: GO:0003360 [brainstem development] evidence: ISS
GeneID:6331 -> Biological process: GO:0006814 [sodium ion transport] evidence: IDA
GeneID:6331 -> Biological process: GO:0010765 [positive regulation of sodium ion transport] evidence: IDA
GeneID:6331 -> Biological process: GO:0014894 [response to denervation involved in regulation of muscle adaptation] evidence: ISS
GeneID:6331 -> Biological process: GO:0021537 [telencephalon development] evidence: ISS
GeneID:6331 -> Biological process: GO:0021549 [cerebellum development] evidence: ISS
GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IDA
GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IMP
GeneID:6331 -> Biological process: GO:0042475 [odontogenesis of dentin-containing tooth] evidence: ISS
GeneID:6331 -> Biological process: GO:0045760 [positive regulation of action potential] evidence: ISS
GeneID:6331 -> Biological process: GO:0050679 [positive regulation of epithelial cell proliferation] evidence: ISS
GeneID:6331 -> Biological process: GO:0051899 [membrane depolarization] evidence: IDA
GeneID:6331 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
GeneID:6331 -> Biological process: GO:0060307 [regulation of ventricular cardiac muscle cell membrane repolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0060371 [regulation of atrial cardiac muscle cell membrane depolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0060372 [regulation of atrial cardiac muscle cell membrane repolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0060373 [regulation of ventricular cardiac muscle cell membrane depolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0071277 [cellular response to calcium ion] evidence: IDA
GeneID:6331 -> Biological process: GO:0086002 [regulation of cardiac muscle cell action potential involved in contraction] evidence: IMP
GeneID:6331 -> Biological process: GO:0086004 [regulation of cardiac muscle cell contraction] evidence: IMP
GeneID:6331 -> Biological process: GO:0086005 [regulation of ventricular cardiac muscle cell action potential] evidence: IMP
GeneID:6331 -> Biological process: GO:0086010 [membrane depolarization involved in regulation of action potential] evidence: IDA
GeneID:6331 -> Biological process: GO:0086012 [membrane depolarization involved in regulation of cardiac muscle cell action potential] evidence: IMP
GeneID:6331 -> Biological process: GO:0086046 [membrane depolarization involved in regulation of SA node cell action potential] evidence: ISS
GeneID:6331 -> Biological process: GO:0086067 [AV node cell to bundle of His cell communication] evidence: IMP
GeneID:6331 -> Biological process: GO:0086069 [bundle of His cell to Purkinje myocyte communication] evidence: IMP
GeneID:6331 -> Biological process: GO:0086070 [SA node cell to atrial cardiac muscle cell communication] evidence: IMP
GeneID:6331 -> Biological process: GO:0086091 [regulation of heart rate by cardiac conduction] evidence: IMP
GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IC
GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IDA
GeneID:6331 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IDA
GeneID:6331 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:6331 -> Cellular component: GO:0005901 [caveola] evidence: TAS
GeneID:6331 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: IDA
GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: ISS
GeneID:6331 -> Cellular component: GO:0016021 [integral to membrane] evidence: IDA
GeneID:6331 -> Cellular component: GO:0030315 [T-tubule] evidence: IDA
GeneID:6331 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.