2024-04-23 22:19:10, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001160161 8343 bp mRNA linear PRI 15-JUL-2013 DEFINITION Homo sapiens sodium channel, voltage-gated, type V, alpha subunit (SCN5A), transcript variant 6, mRNA. ACCESSION NM_001160161 VERSION NM_001160161.1 GI:237512981 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 8343) AUTHORS Crotti,L., Tester,D.J., White,W.M., Bartos,D.C., Insolia,R., Besana,A., Kunic,J.D., Will,M.L., Velasco,E.J., Bair,J.J., Ghidoni,A., Cetin,I., Van Dyke,D.L., Wick,M.J., Brost,B., Delisle,B.P., Facchinetti,F., George,A.L., Schwartz,P.J. and Ackerman,M.J. TITLE Long QT syndrome-associated mutations in intrauterine fetal death JOURNAL JAMA 309 (14), 1473-1482 (2013) PUBMED 23571586 REMARK GeneRIF: 5 intrauterine fetal deaths hosted SCN5A rare nonsynonymous genetic variants that conferred in vitro electrophysiological characteristics consistent with potentially proarrhythmic phenotypes. REFERENCE 2 (bases 1 to 8343) AUTHORS Ritchie MD, Denny JC, Zuvich RL, Crawford DC, Schildcrout JS, Bastarache L, Ramirez AH, Mosley JD, Pulley JM, Basford MA, Bradford Y, Rasmussen LV, Pathak J, Chute CG, Kullo IJ, McCarty CA, Chisholm RL, Kho AN, Carlson CS, Larson EB, Jarvik GP, Sotoodehnia N, Manolio TA, Li R, Masys DR, Haines JL and Roden DM. CONSRTM Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) QRS Group TITLE Genome- and phenome-wide analyses of cardiac conduction identifies markers of arrhythmia risk JOURNAL Circulation 127 (13), 1377-1385 (2013) PUBMED 23463857 REFERENCE 3 (bases 1 to 8343) AUTHORS Hu,R.M., Tan,B.H., Orland,K.M., Valdivia,C.R., Peterson,A., Pu,J. and Makielski,J.C. TITLE Digenic inheritance novel mutations in SCN5a and SNTA1 increase late I(Na) contributing to LQT syndrome JOURNAL Am. J. Physiol. Heart Circ. Physiol. 304 (7), H994-H1001 (2013) PUBMED 23376825 REMARK GeneRIF: Novel mutations in SCN5A and SNTA1 jointly increase the INa current late/peak ratio and time constants of current decay. REFERENCE 4 (bases 1 to 8343) AUTHORS Calloe,K., Refaat,M.M., Grubb,S., Wojciak,J., Campagna,J., Thomsen,N.M., Nussbaum,R.L., Scheinman,M.M. and Schmitt,N. TITLE Characterization and mechanisms of action of novel NaV1.5 channel mutations associated with Brugada syndrome JOURNAL Circ Arrhythm Electrophysiol 6 (1), 177-184 (2013) PUBMED 23424222 REMARK GeneRIF: Na(V)1.5-S1218I and R811H are novel loss-of-function mutations in the SCN5A gene causing Brugada syndrome. REFERENCE 5 (bases 1 to 8343) AUTHORS Vanoye,C.G., Kunic,J.D., Ehring,G.R. and George,A.L. Jr. TITLE Mechanism of sodium channel NaV1.9 potentiation by G-protein signaling JOURNAL J. Gen. Physiol. 141 (2), 193-202 (2013) PUBMED 23359282 REMARK GeneRIF: Our results advance our understanding about the mechanism of Na(V)1.9 potentiation by G-protein signaling during inflammation. REFERENCE 6 (bases 1 to 8343) AUTHORS Olson,T.M. and Keating,M.T. TITLE Mapping a cardiomyopathy locus to chromosome 3p22-p25 JOURNAL J. Clin. Invest. 97 (2), 528-532 (1996) PUBMED 8567977 REFERENCE 7 (bases 1 to 8343) AUTHORS Wang,Q., Shen,J., Li,Z., Timothy,K., Vincent,G.M., Priori,S.G., Schwartz,P.J. and Keating,M.T. TITLE Cardiac sodium channel mutations in patients with long QT syndrome, an inherited cardiac arrhythmia JOURNAL Hum. Mol. Genet. 4 (9), 1603-1607 (1995) PUBMED 8541846 REFERENCE 8 (bases 1 to 8343) AUTHORS George,A.L. Jr., Varkony,T.A., Drabkin,H.A., Han,J., Knops,J.F., Finley,W.H., Brown,G.B., Ward,D.C. and Haas,M. TITLE Assignment of the human heart tetrodotoxin-resistant voltage-gated Na+ channel alpha-subunit gene (SCN5A) to band 3p21 JOURNAL Cytogenet. Cell Genet. 68 (1-2), 67-70 (1995) PUBMED 7956363 REFERENCE 9 (bases 1 to 8343) AUTHORS Jiang,C., Atkinson,D., Towbin,J.A., Splawski,I., Lehmann,M.H., Li,H., Timothy,K., Taggart,R.T., Schwartz,P.J., Vincent,G.M. et al. TITLE Two long QT syndrome loci map to chromosomes 3 and 7 with evidence for further heterogeneity JOURNAL Nat. Genet. 8 (2), 141-147 (1994) PUBMED 7842012 REFERENCE 10 (bases 1 to 8343) AUTHORS Gellens,M.E., George,A.L. Jr., Chen,L.Q., Chahine,M., Horn,R., Barchi,R.L. and Kallen,R.G. TITLE Primary structure and functional expression of the human cardiac tetrodotoxin-insensitive voltage-dependent sodium channel JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (2), 554-558 (1992) PUBMED 1309946 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC051374.1, AB158470.2, BC140813.1, AF482988.1 and AY038064.1. Summary: The protein encoded by this gene is an integral membrane protein and tetrodotoxin-resistant voltage-gated sodium channel subunit. This protein is found primarily in cardiac muscle and is responsible for the initial upstroke of the action potential in an electrocardiogram. Defects in this gene are a cause of long QT syndrome type 3 (LQT3), an autosomal dominant cardiac disease. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (6) uses an alternate, duplicated exon in the 5' coding region and lacks an alternate in-frame exon in the central coding region, compared to variant 1. The resulting isoform (f) differs at a few internal aa near the N-terminus and lacks a 54-aa segment, compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: AB158470.2 [ECO:0000331] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-153 BC051374.1 1-153 154-766 AB158470.2 1-613 767-767 BC140813.1 597-597 768-2111 AB158470.2 615-1958 2112-2152 BC140813.1 1942-1982 2153-3155 AB158470.2 2000-3002 3156-3378 AF482988.1 2970-3192 3379-4468 AB158470.2 3226-4315 4469-6118 AF482988.1 4442-6091 6119-7277 BC140813.1 6012-7170 7278-8229 AY038064.1 7300-8251 8230-8343 AY038064.1 8277-8390 FEATURES Location/Qualifiers source 1..8343 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="3" /map="3p21" gene 1..8343 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="sodium channel, voltage-gated, type V, alpha subunit" /db_xref="GeneID:6331" /db_xref="HGNC:10593" /db_xref="MIM:600163" exon 1..143 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" variation 131 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45608739" exon 144..468 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" CDS 196..6084 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="isoform f is encoded by transcript variant 6; cardiac tetrodotoxin-insensitive voltage-dependent sodium channel alpha subunit; sodium channel protein type 5 subunit alpha; voltage-gated sodium channel subunit alpha Nav1.5; sodium channel protein cardiac muscle subunit alpha" /codon_start=1 /product="sodium channel protein type 5 subunit alpha isoform f" /protein_id="NP_001153633.1" /db_xref="GI:237512982" /db_xref="CCDS:CCDS54569.1" /db_xref="GeneID:6331" /db_xref="HGNC:10593" /db_xref="MIM:600163" /translation="
MANFLLPRGTSSFRRFTRESLAAIEKRMAEKQARGSTTLQESREGLPEEEAPRPQLDLQASKKLPDLYGNPPQELIGEPLEDLDPFYSTQKTFIVLNKGKTIFRFSATNALYVLSPFHPIRRAAVKILVHSLFNMLIMCTILTNCVFMAQHDPPPWTKYVEYTFTAIYTFESLVKILARGFCLHAFTFLRDPWNWLDFSVIIMAYVSENIKLGNLSALRTFRVLRALKTISVIPGLKTIVGALIQSVKKLADVMVLTVFCLSVFALIGLQLFMGNLRHKCVRNFTALNGTNGSVEADGLVWESLDLYLSDPENYLLKNGTSDVLLCGNSSDAGTCPEGYRCLKAGENPDHGYTSFDSFAWAFLALFRLMTQDCWERLYQQTLRSAGKIYMIFFMLVIFLGSFYLVNLILAVVAMAYEEQNQATIAETEEKEKRFQEAMEMLKKEHEALTIRGVDTVSRSSLEMSPLAPVNSHERRSKRRKRMSSGTEECGEDRLPKSDSEDGPRAMNHLSLTRGLSRTSMKPRSSRGSIFTFRRRDLGSEADFADDENSTAGESESHHTSLLVPWPLRRTSAQGQPSPGTSAPGHALHGKKNSTVDCNGVVSLLGAGDPEATSPGSHLLRPVMLEHPPDTTTPSEEPGGPQMLTSQAPCVDGFEEPGARQRALSAVSVLTSALEELEESRHKCPPCWNRLAQRYLIWECCPLWMSIKQGVKLVVMDPFTDLTITMCIVLNTLFMALEHYNMTSEFEEMLQVGNLVFTGIFTAEMTFKIIALDPYYYFQQGWNIFDSIIVILSLMELGLSRMSNLSVLRSFRLLRVFKLAKSWPTLNTLIKIIGNSVGALGNLTLVLAIIVFIFAVVGMQLFGKNYSELRDSDSGLLPRWHMMDFFHAFLIIFRILCGEWIETMWDCMEVSGQSLCLLVFLLVMVIGNLVVLNLFLALLLSSFSADNLTAPDEDREMNNLQLALARIQRGLRFVKRTTWDFCCGLLRQRPQKPAALAAQGQLPSCIATPYSPPPPETEKVPPTRKETRFEEGEQPGQGTPGDPEPVCVPIAVAESDTDDQEEDEENSLGTEEESSKQTPEDSCSEGSTADMTNTAELLEQIPDLGQDVKDPEDCFTEGCVRRCPCCAVDTTQAPGKVWWRLRKTCYHIVEHSWFETFIIFMILLSSGALAFEDIYLEERKTIKVLLEYADKMFTYVFVLEMLLKWVAYGFKKYFTNAWCWLDFLIVDVSLVSLVANTLGFAEMGPIKSLRTLRALRPLRALSRFEGMRVVVNALVGAIPSIMNVLLVCLIFWLIFSIMGVNLFAGKFGRCINQTEGDLPLNYTIVNNKSQCESLNLTGELYWTKVKVNFDNVGAGYLALLQVATFKGWMDIMYAAVDSRGYEEQPQWEYNLYMYIYFVIFIIFGSFFTLNLFIGVIIDNFNQQKKKLGGQDIFMTEEQKKYYNAMKKLGSKKPQKPIPRPLNKYQGFIFDIVTKQAFDVTIMFLICLNMVTMMVETDDQSPEKINILAKINLLFVAIFTGECIVKLAALRHYYFTNSWNIFDFVVVILSIVGTVLSDIIQKYFFSPTLFRVIRLARIGRILRLIRGAKGIRTLLFALMMSLPALFNIGLLLFLVMFIYSIFGMANFAYVKWEAGIDDMFNFQTFANSMLCLFQITTSAGWDGLLSPILNTGPPYCDPTLPNSNGSRGDCGSPAVGILFFTTYIIISFLIVVNMYIAIILENFSVATEESTEPLSEDDFDMFYEIWEKFDPEATQFIEYSVLSDFADALSEPLRIAKPNQISLINMDLPMVSGDRIHCMDILFAFTKRVLGESGEMDALKIQMEEKFMAANPSKISYEPITTTLRRKHEEVSAMVIQRAFRRHLLQRSLKHASFLFRQQAGSGLSEEDAPEREGLIAYVMSENFSRPLGPPSSSSISSTSFPPSYDSVTRATSDNLQVRGSDYSHSEDLADFPPSPDRDRESIV
" misc_feature 670..>1068 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Ion transport protein; Region: Ion_trans; pfam00520" /db_xref="CDD:201279" misc_feature <1201..1431 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Ion transport protein; Region: Ion_trans; pfam00520" /db_xref="CDD:201279" misc_feature 1576..2199 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Domain of unknown function (DUF3451); Region: DUF3451; pfam11933" /db_xref="CDD:204785" misc_feature 2452..2973 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Ion transport protein; Region: Ion_trans; pfam00520" /db_xref="CDD:201279" misc_feature 3052..3678 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Sodium ion transport-associated; Region: Na_trans_assoc; pfam06512" /db_xref="CDD:203469" misc_feature 3754..4440 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Ion transport protein; Region: Ion_trans; pfam00520" /db_xref="CDD:201279" misc_feature 4720..5346 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Ion transport protein; Region: Ion_trans; pfam00520" /db_xref="CDD:201279" misc_feature <4726..5367 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Polycystin cation channel; Region: PKD_channel; pfam08016" /db_xref="CDD:203839" exon 469..587 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" STS 469..587 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="GDB:624564" /db_xref="UniSTS:158350" variation 549 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45533640" exon 588..677 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" exon 678..806 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" variation 681 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45489099" exon 807..898 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" variation 843 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45475402" exon 899..1129 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 7, numbering commonly used in literature and the LOVD database." variation 939 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45453395" variation 996 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45587735" variation 1035 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:72549413" exon 1130..1193 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 8, numbering commonly used in literature and the LOVD database." exon 1194..1335 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 9, numbering commonly used in literature and the LOVD database." variation 1212 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:17215493" variation 1260 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45570333" exon 1336..1533 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 10, numbering commonly used in literature and the LOVD database." variation 1431 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45565936" exon 1534..1713 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 11, numbering commonly used in literature and the LOVD database." variation 1542 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="c" /db_xref="dbSNP:45477694" exon 1714..2085 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 12, numbering commonly used in literature and the LOVD database." variation 1782 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45624133" variation 1876 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45522138" variation 1897 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45600438" exon 2086..2218 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 13, numbering commonly used in literature and the LOVD database." exon 2219..2457 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 14, numbering commonly used in literature and the LOVD database." variation 2367 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="t" /db_xref="dbSNP:45583237" exon 2458..2631 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 15, numbering commonly used in literature and the LOVD database." exon 2632..2982 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 16, numbering commonly used in literature and the LOVD database." STS 2962..3672 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="Scn5a" /db_xref="UniSTS:516644" exon 2983..3423 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 17, numbering commonly used in literature and the LOVD database." variation 3316 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45491996" variation 3363 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="c" /db_xref="dbSNP:45480800" exon 3424..3544 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 19, numbering commonly used in literature and the LOVD database." exon 3545..3699 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 20, numbering commonly used in literature and the LOVD database." variation 3597 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="g" /replace="t" /db_xref="dbSNP:17221875" exon 3700..3873 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 21, numbering commonly used in literature and the LOVD database." exon 3874..3996 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 22, numbering commonly used in literature and the LOVD database." exon 3997..4278 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 23, numbering commonly used in literature and the LOVD database." exon 4279..4332 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 24, numbering commonly used in literature and the LOVD database." exon 4333..4470 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 25, numbering commonly used in literature and the LOVD database." exon 4471..4575 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 26, numbering commonly used in literature and the LOVD database." exon 4576..4846 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 27, numbering commonly used in literature and the LOVD database." STS 4654..5046 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="Scn3a" /db_xref="UniSTS:516640" exon 4847..8343 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 28, numbering commonly used in literature and the LOVD database." variation 4857 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45437099" variation 5281 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="c" /db_xref="dbSNP:45606037" variation 5490 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:1805126" STS 5946..6302 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="GDB:555574" /db_xref="UniSTS:157686" variation 6212 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45601739" STS 6290..6468 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="D3S4190" /db_xref="UniSTS:43452" STS 6335..6632 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="GDB:624573" /db_xref="UniSTS:158352" variation 6466 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45459402" variation 6636 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45615435" variation 6679 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:4073687" variation 6743 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45446194" variation 6761 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45458203" variation 6906 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45600839" variation 7106 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45548632" variation 7288 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45502198" variation 7520 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45589543" variation 7652 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="g" /db_xref="dbSNP:45503498" variation 7693 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="" /replace="c" /db_xref="dbSNP:45589940" variation 7705 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45512996" variation 7708 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45441103" STS 7758..8298 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="SCN5A_3457" /db_xref="UniSTS:471751" variation 7827 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45474195" variation 7884 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45615238" variation 7904 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="g" /db_xref="dbSNP:45610536" variation 7968 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45624736" variation 8091 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45593136" variation 8219 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="c" /db_xref="dbSNP:45502793" variation 8229..8230 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="" /replace="gagaagagagtaggaaaaaggaggg" /db_xref="dbSNP:45592631" polyA_signal 8326..8331 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" polyA_site 8343 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" ORIGIN
gagacggcggcggcgcccgtaggatgcagggatcgctcccccggggccgctgagcctgcgcccagtgccccgagccccgcgccgagccgagtccgcgccaagcagcagccgcccaccccggggcccggccgggggaccagcagcttccccacaggcaacgtgaggagagcctgtgcccagaagcaggatgagaagatggcaaacttcctattacctcggggcaccagcagcttccgcaggttcacacgggagtccctggcagccatcgagaagcgcatggcagagaagcaagcccgcggctcaaccaccttgcaggagagccgagaggggctgcccgaggaggaggctccccggccccagctggacctgcaggcctccaaaaagctgccagatctctatggcaatccaccccaagagctcatcggagagcccctggaggacctggaccccttctatagcacccaaaagactttcatcgtactgaataaaggcaagaccatcttccggttcagtgccaccaacgccttgtatgtcctcagtcccttccaccccatccggagagcggctgtgaagattctggttcactcgctcttcaacatgctcatcatgtgcaccatcctcaccaactgcgtgttcatggcccagcacgaccctccaccctggaccaagtatgtcgagtacaccttcaccgccatttacacctttgagtctctggtcaagattctggctcgaggcttctgcctgcacgcgttcactttccttcgggacccatggaactggctggactttagtgtgattatcatggcgtatgtatcagaaaatataaaactaggcaatttgtcggctcttcgaactttcagagtcctgagagctctaaaaactatttcagttatcccagggctgaagaccatcgtgggggccctgatccagtctgtgaagaagctggctgatgtgatggtcctcacagtcttctgcctcagcgtctttgccctcatcggcctgcagctcttcatgggcaacctaaggcacaagtgcgtgcgcaacttcacagcgctcaacggcaccaacggctccgtggaggccgacggcttggtctgggaatccctggacctttacctcagtgatccagaaaattacctgctcaagaacggcacctctgatgtgttactgtgtgggaacagctctgacgctgggacatgtccggagggctaccggtgcctaaaggcaggcgagaaccccgaccacggctacaccagcttcgattcctttgcctgggcctttcttgcactcttccgcctgatgacgcaggactgctgggagcgcctctatcagcagaccctcaggtccgcagggaagatctacatgatcttcttcatgcttgtcatcttcctggggtccttctacctggtgaacctgatcctggccgtggtcgcaatggcctatgaggagcaaaaccaagccaccatcgctgagaccgaggagaaggaaaagcgcttccaggaggccatggaaatgctcaagaaagaacacgaggccctcaccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggccccagtaaacagccatgagagaagaagcaagaggagaaaacggatgtcttcaggaactgaggagtgtggggaggacaggctccccaagtctgactcagaagatggtcccagagcaatgaatcatctcagcctcacccgtggcctcagcaggacttctatgaagccacgttccagccgcgggagcattttcacctttcgcaggcgagacctgggttctgaagcagattttgcagatgatgaaaacagcacagcgggggagagcgagagccaccacacatcactgctggtgccctggcccctgcgccggaccagtgcccagggacagcccagtcccggaacctcggctcctggccacgccctccatggcaaaaagaacagcactgtggactgcaatggggtggtctcattactgggggcaggcgacccagaggccacatccccaggaagccacctcctccgccctgtgatgctagagcacccgccagacacgaccacgccatcggaggagccaggcgggccccagatgctgacctcccaggctccgtgtgtagatggcttcgaggagccaggagcacggcagcgggccctcagcgcagtcagcgtcctcaccagcgcactggaagagttagaggagtctcgccacaagtgtccaccatgctggaaccgtctcgcccagcgctacctgatctgggagtgctgcccgctgtggatgtccatcaagcagggagtgaagttggtggtcatggacccgtttactgacctcaccatcactatgtgcatcgtactcaacacactcttcatggcgctggagcactacaacatgacaagtgaattcgaggagatgctgcaggtcggaaacctggtcttcacagggattttcacagcagagatgaccttcaagatcattgccctcgacccctactactacttccaacagggctggaacatcttcgacagcatcatcgtcatccttagcctcatggagctgggcctgtcccgcatgagcaacttgtcggtgctgcgctccttccgcctgctgcgggtcttcaagctggccaaatcatggcccaccctgaacacactcatcaagatcatcgggaactcagtgggggcactggggaacctgacactggtgctagccatcatcgtgttcatctttgctgtggtgggcatgcagctctttggcaagaactactcggagctgagggacagcgactcaggcctgctgcctcgctggcacatgatggacttctttcatgccttcctcatcatcttccgcatcctctgtggagagtggatcgagaccatgtgggactgcatggaggtgtcggggcagtcattatgcctgctggtcttcttgcttgttatggtcattggcaaccttgtggtcctgaatctcttcctggccttgctgctcagctccttcagtgcagacaacctcacagcccctgatgaggacagagagatgaacaacctccagctggccctggcccgcatccagaggggcctgcgctttgtcaagcggaccacctgggatttctgctgtggtctcctgcggcagcggcctcagaagcccgcagcccttgccgcccagggccagctgcccagctgcattgccaccccctactccccgccacccccagagacggagaaggtgcctcccacccgcaaggaaacacggtttgaggaaggcgagcaaccaggccagggcacccccggggatccagagcccgtgtgtgtgcccatcgctgtggccgagtcagacacagatgaccaagaagaagatgaggagaacagcctgggcacggaggaggagtccagcaagcagaccccagaggacagttgctccgagggcagcacagcagacatgaccaacaccgctgagctcctggagcagatccctgacctcggccaggatgtcaaggacccagaggactgcttcactgaaggctgtgtccggcgctgtccctgctgtgcggtggacaccacacaggccccagggaaggtctggtggcggttgcgcaagacctgctaccacatcgtggagcacagctggttcgagacattcatcatcttcatgatcctactcagcagtggagcgctggccttcgaggacatctacctagaggagcggaagaccatcaaggttctgcttgagtatgccgacaagatgttcacatatgtcttcgtgctggagatgctgctcaagtgggtggcctacggcttcaagaagtacttcaccaatgcctggtgctggctcgacttcctcatcgtagacgtctctctggtcagcctggtggccaacaccctgggctttgccgagatgggccccatcaagtcactgcggacgctgcgtgcactccgtcctctgagagctctgtcacgatttgagggcatgagggtggtggtcaatgccctggtgggcgccatcccgtccatcatgaacgtcctcctcgtctgcctcatcttctggctcatcttcagcatcatgggcgtgaacctctttgcggggaagtttgggaggtgcatcaaccagacagagggagacttgcctttgaactacaccatcgtgaacaacaagagccagtgtgagtccttgaacttgaccggagaattgtactggaccaaggtgaaagtcaactttgacaacgtgggggccgggtacctggcccttctgcaggtggcaacatttaaaggctggatggacattatgtatgcagctgtggactccagggggtatgaagagcagcctcagtgggaatacaacctctacatgtacatctattttgtcattttcatcatctttgggtctttcttcaccctgaacctctttattggtgtcatcattgacaacttcaaccaacagaagaaaaagttagggggccaggacatcttcatgacagaggagcagaagaagtactacaatgccatgaagaagctgggctccaagaagccccagaagcccatcccacggcccctgaacaagtaccagggcttcatattcgacattgtgaccaagcaggcctttgacgtcaccatcatgtttctgatctgcttgaatatggtgaccatgatggtggagacagatgaccaaagtcctgagaaaatcaacatcttggccaagatcaacctgctctttgtggccatcttcacaggcgagtgtattgtcaagctggctgccctgcgccactactacttcaccaacagctggaatatcttcgacttcgtggttgtcatcctctccatcgtgggcactgtgctctcggacatcatccagaagtacttcttctccccgacgctcttccgagtcatccgcctggcccgaataggccgcatcctcagactgatccgaggggccaaggggatccgcacgctgctctttgccctcatgatgtccctgcctgccctcttcaacatcgggctgctgctcttcctcgtcatgttcatctactccatctttggcatggccaacttcgcttatgtcaagtgggaggctggcatcgacgacatgttcaacttccagaccttcgccaacagcatgctgtgcctcttccagatcaccacgtcggccggctgggatggcctcctcagccccatcctcaacactgggccgccctactgcgaccccactctgcccaacagcaatggctctcggggggactgcgggagcccagccgtgggcatcctcttcttcaccacctacatcatcatctccttcctcatcgtggtcaacatgtacattgccatcatcctggagaacttcagcgtggccacggaggagagcaccgagcccctgagtgaggacgacttcgatatgttctatgagatctgggagaaatttgacccagaggccactcagtttattgagtattcggtcctgtctgactttgccgatgccctgtctgagccactccgtatcgccaagcccaaccagataagcctcatcaacatggacctgcccatggtgagtggggaccgcatccattgcatggacattctctttgccttcaccaaaagggtcctgggggagtctggggagatggacgccctgaagatccagatggaggagaagttcatggcagccaacccatccaagatctcctacgagcccatcaccaccacactccggcgcaagcacgaagaggtgtcggccatggttatccagagagccttccgcaggcacctgctgcaacgctctttgaagcatgcctccttcctcttccgtcagcaggcgggcagcggcctctccgaagaggatgcccctgagcgagagggcctcatcgcctacgtgatgagtgagaacttctcccgaccccttggcccaccctccagctcctccatctcctccacttccttcccaccctcctatgacagtgtcactagagccaccagcgataacctccaggtgcgggggtctgactacagccacagtgaagatctcgccgacttccccccttctccggacagggaccgtgagtccatcgtgtgagcctcggcctggctggccaggacacactgaaaagcagcctttttcaccatggcaaacctaaatgcagtcagtcacaaaccagcctggggccttcctggctttgggagtaagaaatgggcctcagccccgcggatcaaccaggcagagttctgtggcgccgcgtggacagccggagcagttggcctgtgcttggaggcctcagatagacctgtgacctggtctggtcaggcaatgccctgcggctctggaaagcaacttcatcccagctgctgaggcgaaatataaaactgagactgtatatgttgtgaatgggctttcataaatttattatatttgatatttttttacttgagcaaagaactaaggatttttccatggacatgggcagcaattcacgctgtctcttcttaaccctgaacaagagtgtctatggagcagccggaagtctgttctcaaagcagaagtggaatccagtgtggctcccacaggtcttcactgcccaggggtcgaatggggtccccctcccacttgacctgagatgctgggagggctgaacccccactcacacaagcacacacacacagtcctcacacacggaggccagacacaggccgtgggacccaggctcccagcctaagggagacaggcctttccctgccggccccccaaggatggggttcttgtccacggggctcactctggccccctattgtctccaaggtcccattttccccctgtgttttcacgcaggtcatattgtcagtcctacaaaaataaaaggcttccagaggagagtggcctgggtcccagggctggccctaggcactgatagttgccttttcttcccctcctgtaagagtattaacaaaaccaaaggacacaagggtgcaagccccattcacggcctggcatgcagcttgtccttgctcctggaacctggcaggccctgcccagccagccatcggaagagagggctgagccatgggggtttggggctaagaagttcaccagccctgagccatggcggcccctcagcctgcctgaagagaggaaactggcgatctcccagggctctctggaccatacgcggaggagttttctgtgtggtctccagctcctctccagacacagagacatgggagtggggagcggagcttggccctgcgccctgtgcagggaaagggatggtcaggcccagttctcgtgcccttagaggggaatgaaccatggcacctttgagagagggggcactgtggtcaggcccagcctctctggctcagcccgggatcctgatggcacccacacagaggacctctttggggcaagatccaggtggtcccataggtcttgtgaaaaggctttttcagggaaaaatattttactagtccaatcacccccaggacctcttcagctgctgacaatcctatttagcatatgcaaatcttttaacatagagaactgtcaccctgaggtaacagggtcaactggcgaagcctgagcaggcaggggcttggctgccccattccagctctcccatggagcccctccaccgggcgcatgcctcccaggccacctcagtctcacctgccggctctgggctggctgctcctaacctacctcgccgagctgtcggagggctggacatttgtggcagtgctgaagggggcattgccggcgagtaaagtattatgtttcttcttgtcaccccagttcccttggtggcaaccccagacccaacccatgcccctgacagatctagttctcttctcctgtgttccctttgagtccagtgtgggacacggtttaactgtcccagcgacatttctccaagtggaaatcctatttttgtagatctccatgctttgctctcaaggcttggagaggtatgtgcccctcctgggtgctcaccgcctgctacacaggcaggaatgcggttgggaggcaggtcgggctgccagcccagctggccggaaggagactgtggtttttgtgtgtgtggacagcccgggagctttgagacaggtgcctggggctggctgcagacggtgtggttgggggtgggaggtgagctagacccaacccttagcttttagcctggctgtcacctttttaatttccagaactgcacaatgaccagcaggagggaaggacagacatcaagtgccagatgttgtctgaactaatcgagcacttctcaccaaacttcatgtataaataaaatacatatttttaaaacaaaccaataaatggcttacatga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:6331 -> Molecular function: GO:0005248 [voltage-gated sodium channel activity] evidence: IDA GeneID:6331 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:6331 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IPI GeneID:6331 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI GeneID:6331 -> Molecular function: GO:0030506 [ankyrin binding] evidence: IDA GeneID:6331 -> Molecular function: GO:0044325 [ion channel binding] evidence: IPI GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IDA GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IMP GeneID:6331 -> Molecular function: GO:0097110 [scaffold protein binding] evidence: IPI GeneID:6331 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP GeneID:6331 -> Biological process: GO:0003231 [cardiac ventricle development] evidence: ISS GeneID:6331 -> Biological process: GO:0003360 [brainstem development] evidence: ISS GeneID:6331 -> Biological process: GO:0006814 [sodium ion transport] evidence: IDA GeneID:6331 -> Biological process: GO:0010765 [positive regulation of sodium ion transport] evidence: IDA GeneID:6331 -> Biological process: GO:0014894 [response to denervation involved in regulation of muscle adaptation] evidence: ISS GeneID:6331 -> Biological process: GO:0021537 [telencephalon development] evidence: ISS GeneID:6331 -> Biological process: GO:0021549 [cerebellum development] evidence: ISS GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IDA GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IMP GeneID:6331 -> Biological process: GO:0042475 [odontogenesis of dentin-containing tooth] evidence: ISS GeneID:6331 -> Biological process: GO:0045760 [positive regulation of action potential] evidence: ISS GeneID:6331 -> Biological process: GO:0050679 [positive regulation of epithelial cell proliferation] evidence: ISS GeneID:6331 -> Biological process: GO:0051899 [membrane depolarization] evidence: IDA GeneID:6331 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP GeneID:6331 -> Biological process: GO:0060307 [regulation of ventricular cardiac muscle cell membrane repolarization] evidence: IMP GeneID:6331 -> Biological process: GO:0060371 [regulation of atrial cardiac muscle cell membrane depolarization] evidence: IMP GeneID:6331 -> Biological process: GO:0060372 [regulation of atrial cardiac muscle cell membrane repolarization] evidence: IMP GeneID:6331 -> Biological process: GO:0060373 [regulation of ventricular cardiac muscle cell membrane depolarization] evidence: IMP GeneID:6331 -> Biological process: GO:0071277 [cellular response to calcium ion] evidence: IDA GeneID:6331 -> Biological process: GO:0086002 [regulation of cardiac muscle cell action potential involved in contraction] evidence: IMP GeneID:6331 -> Biological process: GO:0086004 [regulation of cardiac muscle cell contraction] evidence: IMP GeneID:6331 -> Biological process: GO:0086005 [regulation of ventricular cardiac muscle cell action potential] evidence: IMP GeneID:6331 -> Biological process: GO:0086010 [membrane depolarization involved in regulation of action potential] evidence: IDA GeneID:6331 -> Biological process: GO:0086012 [membrane depolarization involved in regulation of cardiac muscle cell action potential] evidence: IMP GeneID:6331 -> Biological process: GO:0086046 [membrane depolarization involved in regulation of SA node cell action potential] evidence: ISS GeneID:6331 -> Biological process: GO:0086067 [AV node cell to bundle of His cell communication] evidence: IMP GeneID:6331 -> Biological process: GO:0086069 [bundle of His cell to Purkinje myocyte communication] evidence: IMP GeneID:6331 -> Biological process: GO:0086070 [SA node cell to atrial cardiac muscle cell communication] evidence: IMP GeneID:6331 -> Biological process: GO:0086091 [regulation of heart rate by cardiac conduction] evidence: IMP GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IC GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IDA GeneID:6331 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IDA GeneID:6331 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA GeneID:6331 -> Cellular component: GO:0005901 [caveola] evidence: TAS GeneID:6331 -> Cellular component: GO:0009986 [cell surface] evidence: IDA GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: IDA GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: ISS GeneID:6331 -> Cellular component: GO:0016021 [integral to membrane] evidence: IDA GeneID:6331 -> Cellular component: GO:0030315 [T-tubule] evidence: IDA GeneID:6331 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.