Home |
Help |
Advanced search
2024-04-24 09:05:17, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001160160 8406 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens sodium channel, voltage-gated, type V, alpha subunit
(SCN5A), transcript variant 5, mRNA.
ACCESSION NM_001160160
VERSION NM_001160160.1 GI:237512979
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 8406)
AUTHORS Crotti,L., Tester,D.J., White,W.M., Bartos,D.C., Insolia,R.,
Besana,A., Kunic,J.D., Will,M.L., Velasco,E.J., Bair,J.J.,
Ghidoni,A., Cetin,I., Van Dyke,D.L., Wick,M.J., Brost,B.,
Delisle,B.P., Facchinetti,F., George,A.L., Schwartz,P.J. and
Ackerman,M.J.
TITLE Long QT syndrome-associated mutations in intrauterine fetal death
JOURNAL JAMA 309 (14), 1473-1482 (2013)
PUBMED 23571586
REMARK GeneRIF: 5 intrauterine fetal deaths hosted SCN5A rare
nonsynonymous genetic variants that conferred in vitro
electrophysiological characteristics consistent with potentially
proarrhythmic phenotypes.
REFERENCE 2 (bases 1 to 8406)
AUTHORS Ritchie MD, Denny JC, Zuvich RL, Crawford DC, Schildcrout JS,
Bastarache L, Ramirez AH, Mosley JD, Pulley JM, Basford MA,
Bradford Y, Rasmussen LV, Pathak J, Chute CG, Kullo IJ, McCarty CA,
Chisholm RL, Kho AN, Carlson CS, Larson EB, Jarvik GP, Sotoodehnia
N, Manolio TA, Li R, Masys DR, Haines JL and Roden DM.
CONSRTM Cohorts for Heart and Aging Research in Genomic Epidemiology
(CHARGE) QRS Group
TITLE Genome- and phenome-wide analyses of cardiac conduction identifies
markers of arrhythmia risk
JOURNAL Circulation 127 (13), 1377-1385 (2013)
PUBMED 23463857
REFERENCE 3 (bases 1 to 8406)
AUTHORS Hu,R.M., Tan,B.H., Orland,K.M., Valdivia,C.R., Peterson,A., Pu,J.
and Makielski,J.C.
TITLE Digenic inheritance novel mutations in SCN5a and SNTA1 increase
late I(Na) contributing to LQT syndrome
JOURNAL Am. J. Physiol. Heart Circ. Physiol. 304 (7), H994-H1001 (2013)
PUBMED 23376825
REMARK GeneRIF: Novel mutations in SCN5A and SNTA1 jointly increase the
INa current late/peak ratio and time constants of current decay.
REFERENCE 4 (bases 1 to 8406)
AUTHORS Calloe,K., Refaat,M.M., Grubb,S., Wojciak,J., Campagna,J.,
Thomsen,N.M., Nussbaum,R.L., Scheinman,M.M. and Schmitt,N.
TITLE Characterization and mechanisms of action of novel NaV1.5 channel
mutations associated with Brugada syndrome
JOURNAL Circ Arrhythm Electrophysiol 6 (1), 177-184 (2013)
PUBMED 23424222
REMARK GeneRIF: Na(V)1.5-S1218I and R811H are novel loss-of-function
mutations in the SCN5A gene causing Brugada syndrome.
REFERENCE 5 (bases 1 to 8406)
AUTHORS Vanoye,C.G., Kunic,J.D., Ehring,G.R. and George,A.L. Jr.
TITLE Mechanism of sodium channel NaV1.9 potentiation by G-protein
signaling
JOURNAL J. Gen. Physiol. 141 (2), 193-202 (2013)
PUBMED 23359282
REMARK GeneRIF: Our results advance our understanding about the mechanism
of Na(V)1.9 potentiation by G-protein signaling during
inflammation.
REFERENCE 6 (bases 1 to 8406)
AUTHORS Olson,T.M. and Keating,M.T.
TITLE Mapping a cardiomyopathy locus to chromosome 3p22-p25
JOURNAL J. Clin. Invest. 97 (2), 528-532 (1996)
PUBMED 8567977
REFERENCE 7 (bases 1 to 8406)
AUTHORS Wang,Q., Shen,J., Li,Z., Timothy,K., Vincent,G.M., Priori,S.G.,
Schwartz,P.J. and Keating,M.T.
TITLE Cardiac sodium channel mutations in patients with long QT syndrome,
an inherited cardiac arrhythmia
JOURNAL Hum. Mol. Genet. 4 (9), 1603-1607 (1995)
PUBMED 8541846
REFERENCE 8 (bases 1 to 8406)
AUTHORS George,A.L. Jr., Varkony,T.A., Drabkin,H.A., Han,J., Knops,J.F.,
Finley,W.H., Brown,G.B., Ward,D.C. and Haas,M.
TITLE Assignment of the human heart tetrodotoxin-resistant voltage-gated
Na+ channel alpha-subunit gene (SCN5A) to band 3p21
JOURNAL Cytogenet. Cell Genet. 68 (1-2), 67-70 (1995)
PUBMED 7956363
REFERENCE 9 (bases 1 to 8406)
AUTHORS Jiang,C., Atkinson,D., Towbin,J.A., Splawski,I., Lehmann,M.H.,
Li,H., Timothy,K., Taggart,R.T., Schwartz,P.J., Vincent,G.M. et al.
TITLE Two long QT syndrome loci map to chromosomes 3 and 7 with evidence
for further heterogeneity
JOURNAL Nat. Genet. 8 (2), 141-147 (1994)
PUBMED 7842012
REFERENCE 10 (bases 1 to 8406)
AUTHORS Gellens,M.E., George,A.L. Jr., Chen,L.Q., Chahine,M., Horn,R.,
Barchi,R.L. and Kallen,R.G.
TITLE Primary structure and functional expression of the human cardiac
tetrodotoxin-insensitive voltage-dependent sodium channel
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (2), 554-558 (1992)
PUBMED 1309946
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BC051374.1, AB158469.2,
BC144621.1, AF482988.1 and AY038064.1.
Summary: The protein encoded by this gene is an integral membrane
protein and tetrodotoxin-resistant voltage-gated sodium channel
subunit. This protein is found primarily in cardiac muscle and is
responsible for the initial upstroke of the action potential in an
electrocardiogram. Defects in this gene are a cause of long QT
syndrome type 3 (LQT3), an autosomal dominant cardiac disease.
Alternative splicing results in several transcript variants
encoding different isoforms. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (5) uses an alternate, duplicated
exon in the 5' coding region, uses an alternate in-frame splice
site in the central coding region, and uses an alternate in-frame
splice site in the 3' coding region, compared to variant 1. The
resulting isoform (e) differs at a few internal aa near the
N-terminus and lacks a 1-aa and a 32-aa segment, compared to
isoform a.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
CDS exon combination :: BC140813.1 [ECO:0000331]
RNAseq introns :: mixed/partial sample support ERS025081,
ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-281 BC051374.1 1-281
282-282 AB158469.2 129-129
283-1867 BC144621.1 113-1697
1868-1868 AB158469.2 1715-1715
1869-3377 BC144621.1 1699-3207
3378-3378 AF482988.1 3192-3192
3379-7340 BC144621.1 3209-7170
7341-8292 AY038064.1 7300-8251
8293-8406 AY038064.1 8277-8390
FEATURES Location/Qualifiers
source 1..8406
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3p21"
gene 1..8406
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="sodium channel, voltage-gated, type V, alpha
subunit"
/db_xref="GeneID:6331"
/db_xref="HGNC:10593"
/db_xref="MIM:600163"
exon 1..143
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
variation 131
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45608739"
exon 144..468
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
CDS 196..6147
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="isoform e is encoded by transcript variant 5;
cardiac tetrodotoxin-insensitive voltage-dependent sodium
channel alpha subunit; sodium channel protein type 5
subunit alpha; voltage-gated sodium channel subunit alpha
Nav1.5; sodium channel protein cardiac muscle subunit
alpha"
/codon_start=1
/product="sodium channel protein type 5 subunit alpha
isoform e"
/protein_id="NP_001153632.1"
/db_xref="GI:237512980"
/db_xref="CCDS:CCDS54570.1"
/db_xref="GeneID:6331"
/db_xref="HGNC:10593"
/db_xref="MIM:600163"
/translation="
MANFLLPRGTSSFRRFTRESLAAIEKRMAEKQARGSTTLQESREGLPEEEAPRPQLDLQASKKLPDLYGNPPQELIGEPLEDLDPFYSTQKTFIVLNKGKTIFRFSATNALYVLSPFHPIRRAAVKILVHSLFNMLIMCTILTNCVFMAQHDPPPWTKYVEYTFTAIYTFESLVKILARGFCLHAFTFLRDPWNWLDFSVIIMAYVSENIKLGNLSALRTFRVLRALKTISVIPGLKTIVGALIQSVKKLADVMVLTVFCLSVFALIGLQLFMGNLRHKCVRNFTALNGTNGSVEADGLVWESLDLYLSDPENYLLKNGTSDVLLCGNSSDAGTCPEGYRCLKAGENPDHGYTSFDSFAWAFLALFRLMTQDCWERLYQQTLRSAGKIYMIFFMLVIFLGSFYLVNLILAVVAMAYEEQNQATIAETEEKEKRFQEAMEMLKKEHEALTIRGVDTVSRSSLEMSPLAPVNSHERRSKRRKRMSSGTEECGEDRLPKSDSEDGPRAMNHLSLTRGLSRTSMKPRSSRGSIFTFRRRDLGSEADFADDENSTAGESESHHTSLLVPWPLRRTSAQGQPSPGTSAPGHALHGKKNSTVDCNGVVSLLGAGDPEATSPGSHLLRPVMLEHPPDTTTPSEEPGGPQMLTSQAPCVDGFEEPGARQRALSAVSVLTSALEELEESRHKCPPCWNRLAQRYLIWECCPLWMSIKQGVKLVVMDPFTDLTITMCIVLNTLFMALEHYNMTSEFEEMLQVGNLVFTGIFTAEMTFKIIALDPYYYFQQGWNIFDSIIVILSLMELGLSRMSNLSVLRSFRLLRVFKLAKSWPTLNTLIKIIGNSVGALGNLTLVLAIIVFIFAVVGMQLFGKNYSELRDSDSGLLPRWHMMDFFHAFLIIFRILCGEWIETMWDCMEVSGQSLCLLVFLLVMVIGNLVVLNLFLALLLSSFSADNLTAPDEDREMNNLQLALARIQRGLRFVKRTTWDFCCGLLRQRPQKPAALAAQGQLPSCIATPYSPPPPETEKVPPTRKETRFEEGEQPGQGTPGDPEPVCVPIAVAESDTDDQEEDEENSLGTEEESSKQESQPVSGGPEAPPDSRTWSQVSATASSEAEASASQADWRQQWKAEPQAPGCGETPEDSCSEGSTADMTNTAELLEQIPDLGQDVKDPEDCFTEGCVRRCPCCAVDTTQAPGKVWWRLRKTCYHIVEHSWFETFIIFMILLSSGALAFEDIYLEERKTIKVLLEYADKMFTYVFVLEMLLKWVAYGFKKYFTNAWCWLDFLIVDVSLVSLVANTLGFAEMGPIKSLRTLRALRPLRALSRFEGMRVVVNALVGAIPSIMNVLLVCLIFWLIFSIMGVNLFAGKFGRCINQTEGDLPLNYTIVNNKSQCESLNLTGELYWTKVKVNFDNVGAGYLALLQVATFKGWMDIMYAAVDSRGYEEQPQWEYNLYMYIYFVIFIIFGSFFTLNLFIGVIIDNFNQQKKKLGGQDIFMTEEQKKYYNAMKKLGSKKPQKPIPRPLNKYQGFIFDIVTKQAFDVTIMFLICLNMVTMMVETDDQSPEKINILAKINLLFVAIFTGTVLSDIIQKYFFSPTLFRVIRLARIGRILRLIRGAKGIRTLLFALMMSLPALFNIGLLLFLVMFIYSIFGMANFAYVKWEAGIDDMFNFQTFANSMLCLFQITTSAGWDGLLSPILNTGPPYCDPTLPNSNGSRGDCGSPAVGILFFTTYIIISFLIVVNMYIAIILENFSVATEESTEPLSEDDFDMFYEIWEKFDPEATQFIEYSVLSDFADALSEPLRIAKPNQISLINMDLPMVSGDRIHCMDILFAFTKRVLGESGEMDALKIQMEEKFMAANPSKISYEPITTTLRRKHEEVSAMVIQRAFRRHLLQRSLKHASFLFRQQAGSGLSEEDAPEREGLIAYVMSENFSRPLGPPSSSSISSTSFPPSYDSVTRATSDNLQVRGSDYSHSEDLADFPPSPDRDRESIV
"
misc_feature 574..645
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 670..>1068
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 670..729
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 844..903
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 952..1023
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature <1201..1431
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 1363..1440
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 1576..2199
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Domain of unknown function (DUF3451); Region:
DUF3451; pfam11933"
/db_xref="CDD:204785"
misc_feature 1732..1734
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/experiment="experimental evidence, no additional details
recorded"
/note="Dimethylated arginine, alternate;
Omega-N-methylarginine, alternate; propagated from
UniProtKB/Swiss-Prot (Q14524.2); methylation site"
misc_feature 1771..1773
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/experiment="experimental evidence, no additional details
recorded"
/note="Dimethylated arginine, alternate;
Omega-N-methylarginine, alternate; propagated from
UniProtKB/Swiss-Prot (Q14524.2); methylation site"
misc_feature 2233..2235
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/experiment="experimental evidence, no additional details
recorded"
/note="Dimethylated arginine, alternate;
Omega-N-methylarginine, alternate; propagated from
UniProtKB/Swiss-Prot (Q14524.2); methylation site"
misc_feature 2329..2403
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 2437..2508
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 2452..2973
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 2533..2592
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 2611..2670
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 2719..2781
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 2935..3012
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 3052..3837
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Sodium ion transport-associated; Region:
Na_trans_assoc; pfam06512"
/db_xref="CDD:203469"
misc_feature 3793..3864
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 3904..3981
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 3913..4599
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 4000..4065
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 4078..4143
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 4201..4269
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 4522..4602
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 4762..4833
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 4882..5409
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 4963..5028
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature <5041..5430
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Polycystin cation channel; Region: PKD_channel;
pfam08016"
/db_xref="CDD:203839"
misc_feature 5074..5142
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 5338..5412
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 6016..6027
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
Region: Interaction with NEDD4, NEDD4L and WWP2"
exon 469..587
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
STS 469..587
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="GDB:624564"
/db_xref="UniSTS:158350"
variation 549
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45533640"
exon 588..677
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
exon 678..806
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
variation 681
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45489099"
exon 807..898
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
variation 843
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45475402"
exon 899..1129
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 7, numbering commonly used in
literature and the LOVD database."
variation 939
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45453395"
variation 996
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45587735"
variation 1035
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:72549413"
exon 1130..1193
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 8, numbering commonly used in
literature and the LOVD database."
exon 1194..1335
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 9, numbering commonly used in
literature and the LOVD database."
variation 1212
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:17215493"
variation 1260
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45570333"
exon 1336..1533
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 10, numbering commonly used
in literature and the LOVD database."
variation 1431
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45565936"
exon 1534..1713
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 11, numbering commonly used
in literature and the LOVD database."
variation 1542
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45477694"
exon 1714..2085
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 12, numbering commonly used
in literature and the LOVD database."
variation 1782
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45624133"
variation 1876
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45522138"
variation 1897
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45600438"
exon 2086..2218
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 13, numbering commonly used
in literature and the LOVD database."
exon 2219..2457
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 14, numbering commonly used
in literature and the LOVD database."
variation 2367
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="t"
/db_xref="dbSNP:45583237"
exon 2458..2631
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 15, numbering commonly used
in literature and the LOVD database."
exon 2632..2982
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 16, numbering commonly used
in literature and the LOVD database."
STS 2962..3831
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="Scn5a"
/db_xref="UniSTS:516644"
exon 2983..3423
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 17, numbering commonly used
in literature and the LOVD database."
variation 3316
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45491996"
variation 3363
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45480800"
exon 3424..3582
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
exon 3583..3703
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 19, numbering commonly used
in literature and the LOVD database."
exon 3704..3858
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 20, numbering commonly used
in literature and the LOVD database."
variation 3756
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:17221875"
exon 3859..4032
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 21, numbering commonly used
in literature and the LOVD database."
exon 4033..4155
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 22, numbering commonly used
in literature and the LOVD database."
exon 4156..4437
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 23, numbering commonly used
in literature and the LOVD database."
exon 4438..4491
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 24, numbering commonly used
in literature and the LOVD database."
exon 4492..4629
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 25, numbering commonly used
in literature and the LOVD database."
exon 4630..4734
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 26, numbering commonly used
in literature and the LOVD database."
exon 4735..4909
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
STS 4813..5109
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="Scn3a"
/db_xref="UniSTS:516640"
exon 4910..8406
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 28, numbering commonly used
in literature and the LOVD database."
variation 4920
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45437099"
variation 5344
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45606037"
variation 5553
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1805126"
STS 6009..6365
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="GDB:555574"
/db_xref="UniSTS:157686"
variation 6275
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45601739"
STS 6353..6531
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="D3S4190"
/db_xref="UniSTS:43452"
STS 6398..6695
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="GDB:624573"
/db_xref="UniSTS:158352"
variation 6529
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45459402"
variation 6699
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45615435"
variation 6742
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:4073687"
variation 6806
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45446194"
variation 6824
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45458203"
variation 6969
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45600839"
variation 7169
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45548632"
variation 7351
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45502198"
variation 7583
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45589543"
variation 7715
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:45503498"
variation 7756
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace=""
/replace="c"
/db_xref="dbSNP:45589940"
variation 7768
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45512996"
variation 7771
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45441103"
STS 7821..8361
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="SCN5A_3457"
/db_xref="UniSTS:471751"
variation 7890
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45474195"
variation 7947
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45615238"
variation 7967
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:45610536"
variation 8031
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45624736"
variation 8154
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45593136"
variation 8282
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45502793"
variation 8292..8293
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace=""
/replace="gagaagagagtaggaaaaaggaggg"
/db_xref="dbSNP:45592631"
polyA_signal 8389..8394
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
polyA_site 8406
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
ORIGIN
gagacggcggcggcgcccgtaggatgcagggatcgctcccccggggccgctgagcctgcgcccagtgccccgagccccgcgccgagccgagtccgcgccaagcagcagccgcccaccccggggcccggccgggggaccagcagcttccccacaggcaacgtgaggagagcctgtgcccagaagcaggatgagaagatggcaaacttcctattacctcggggcaccagcagcttccgcaggttcacacgggagtccctggcagccatcgagaagcgcatggcagagaagcaagcccgcggctcaaccaccttgcaggagagccgagaggggctgcccgaggaggaggctccccggccccagctggacctgcaggcctccaaaaagctgccagatctctatggcaatccaccccaagagctcatcggagagcccctggaggacctggaccccttctatagcacccaaaagactttcatcgtactgaataaaggcaagaccatcttccggttcagtgccaccaacgccttgtatgtcctcagtcccttccaccccatccggagagcggctgtgaagattctggttcactcgctcttcaacatgctcatcatgtgcaccatcctcaccaactgcgtgttcatggcccagcacgaccctccaccctggaccaagtatgtcgagtacaccttcaccgccatttacacctttgagtctctggtcaagattctggctcgaggcttctgcctgcacgcgttcactttccttcgggacccatggaactggctggactttagtgtgattatcatggcgtatgtatcagaaaatataaaactaggcaatttgtcggctcttcgaactttcagagtcctgagagctctaaaaactatttcagttatcccagggctgaagaccatcgtgggggccctgatccagtctgtgaagaagctggctgatgtgatggtcctcacagtcttctgcctcagcgtctttgccctcatcggcctgcagctcttcatgggcaacctaaggcacaagtgcgtgcgcaacttcacagcgctcaacggcaccaacggctccgtggaggccgacggcttggtctgggaatccctggacctttacctcagtgatccagaaaattacctgctcaagaacggcacctctgatgtgttactgtgtgggaacagctctgacgctgggacatgtccggagggctaccggtgcctaaaggcaggcgagaaccccgaccacggctacaccagcttcgattcctttgcctgggcctttcttgcactcttccgcctgatgacgcaggactgctgggagcgcctctatcagcagaccctcaggtccgcagggaagatctacatgatcttcttcatgcttgtcatcttcctggggtccttctacctggtgaacctgatcctggccgtggtcgcaatggcctatgaggagcaaaaccaagccaccatcgctgagaccgaggagaaggaaaagcgcttccaggaggccatggaaatgctcaagaaagaacacgaggccctcaccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggccccagtaaacagccatgagagaagaagcaagaggagaaaacggatgtcttcaggaactgaggagtgtggggaggacaggctccccaagtctgactcagaagatggtcccagagcaatgaatcatctcagcctcacccgtggcctcagcaggacttctatgaagccacgttccagccgcgggagcattttcacctttcgcaggcgagacctgggttctgaagcagattttgcagatgatgaaaacagcacagcgggggagagcgagagccaccacacatcactgctggtgccctggcccctgcgccggaccagtgcccagggacagcccagtcccggaacctcggctcctggccacgccctccatggcaaaaagaacagcactgtggactgcaatggggtggtctcattactgggggcaggcgacccagaggccacatccccaggaagccacctcctccgccctgtgatgctagagcacccgccagacacgaccacgccatcggaggagccaggcgggccccagatgctgacctcccaggctccgtgtgtagatggcttcgaggagccaggagcacggcagcgggccctcagcgcagtcagcgtcctcaccagcgcactggaagagttagaggagtctcgccacaagtgtccaccatgctggaaccgtctcgcccagcgctacctgatctgggagtgctgcccgctgtggatgtccatcaagcagggagtgaagttggtggtcatggacccgtttactgacctcaccatcactatgtgcatcgtactcaacacactcttcatggcgctggagcactacaacatgacaagtgaattcgaggagatgctgcaggtcggaaacctggtcttcacagggattttcacagcagagatgaccttcaagatcattgccctcgacccctactactacttccaacagggctggaacatcttcgacagcatcatcgtcatccttagcctcatggagctgggcctgtcccgcatgagcaacttgtcggtgctgcgctccttccgcctgctgcgggtcttcaagctggccaaatcatggcccaccctgaacacactcatcaagatcatcgggaactcagtgggggcactggggaacctgacactggtgctagccatcatcgtgttcatctttgctgtggtgggcatgcagctctttggcaagaactactcggagctgagggacagcgactcaggcctgctgcctcgctggcacatgatggacttctttcatgccttcctcatcatcttccgcatcctctgtggagagtggatcgagaccatgtgggactgcatggaggtgtcggggcagtcattatgcctgctggtcttcttgcttgttatggtcattggcaaccttgtggtcctgaatctcttcctggccttgctgctcagctccttcagtgcagacaacctcacagcccctgatgaggacagagagatgaacaacctccagctggccctggcccgcatccagaggggcctgcgctttgtcaagcggaccacctgggatttctgctgtggtctcctgcggcagcggcctcagaagcccgcagcccttgccgcccagggccagctgcccagctgcattgccaccccctactccccgccacccccagagacggagaaggtgcctcccacccgcaaggaaacacggtttgaggaaggcgagcaaccaggccagggcacccccggggatccagagcccgtgtgtgtgcccatcgctgtggccgagtcagacacagatgaccaagaagaagatgaggagaacagcctgggcacggaggaggagtccagcaagcaggaatcccagcctgtgtccggtggcccagaggcccctccggattccaggacctggagccaggtgtcagcgactgcctcctctgaggccgaggccagtgcatctcaggccgactggcggcagcagtggaaagcggaaccccaggccccagggtgcggtgagaccccagaggacagttgctccgagggcagcacagcagacatgaccaacaccgctgagctcctggagcagatccctgacctcggccaggatgtcaaggacccagaggactgcttcactgaaggctgtgtccggcgctgtccctgctgtgcggtggacaccacacaggccccagggaaggtctggtggcggttgcgcaagacctgctaccacatcgtggagcacagctggttcgagacattcatcatcttcatgatcctactcagcagtggagcgctggccttcgaggacatctacctagaggagcggaagaccatcaaggttctgcttgagtatgccgacaagatgttcacatatgtcttcgtgctggagatgctgctcaagtgggtggcctacggcttcaagaagtacttcaccaatgcctggtgctggctcgacttcctcatcgtagacgtctctctggtcagcctggtggccaacaccctgggctttgccgagatgggccccatcaagtcactgcggacgctgcgtgcactccgtcctctgagagctctgtcacgatttgagggcatgagggtggtggtcaatgccctggtgggcgccatcccgtccatcatgaacgtcctcctcgtctgcctcatcttctggctcatcttcagcatcatgggcgtgaacctctttgcggggaagtttgggaggtgcatcaaccagacagagggagacttgcctttgaactacaccatcgtgaacaacaagagccagtgtgagtccttgaacttgaccggagaattgtactggaccaaggtgaaagtcaactttgacaacgtgggggccgggtacctggcccttctgcaggtggcaacatttaaaggctggatggacattatgtatgcagctgtggactccagggggtatgaagagcagcctcagtgggaatacaacctctacatgtacatctattttgtcattttcatcatctttgggtctttcttcaccctgaacctctttattggtgtcatcattgacaacttcaaccaacagaagaaaaagttagggggccaggacatcttcatgacagaggagcagaagaagtactacaatgccatgaagaagctgggctccaagaagccccagaagcccatcccacggcccctgaacaagtaccagggcttcatattcgacattgtgaccaagcaggcctttgacgtcaccatcatgtttctgatctgcttgaatatggtgaccatgatggtggagacagatgaccaaagtcctgagaaaatcaacatcttggccaagatcaacctgctctttgtggccatcttcacaggcactgtgctctcggacatcatccagaagtacttcttctccccgacgctcttccgagtcatccgcctggcccgaataggccgcatcctcagactgatccgaggggccaaggggatccgcacgctgctctttgccctcatgatgtccctgcctgccctcttcaacatcgggctgctgctcttcctcgtcatgttcatctactccatctttggcatggccaacttcgcttatgtcaagtgggaggctggcatcgacgacatgttcaacttccagaccttcgccaacagcatgctgtgcctcttccagatcaccacgtcggccggctgggatggcctcctcagccccatcctcaacactgggccgccctactgcgaccccactctgcccaacagcaatggctctcggggggactgcgggagcccagccgtgggcatcctcttcttcaccacctacatcatcatctccttcctcatcgtggtcaacatgtacattgccatcatcctggagaacttcagcgtggccacggaggagagcaccgagcccctgagtgaggacgacttcgatatgttctatgagatctgggagaaatttgacccagaggccactcagtttattgagtattcggtcctgtctgactttgccgatgccctgtctgagccactccgtatcgccaagcccaaccagataagcctcatcaacatggacctgcccatggtgagtggggaccgcatccattgcatggacattctctttgccttcaccaaaagggtcctgggggagtctggggagatggacgccctgaagatccagatggaggagaagttcatggcagccaacccatccaagatctcctacgagcccatcaccaccacactccggcgcaagcacgaagaggtgtcggccatggttatccagagagccttccgcaggcacctgctgcaacgctctttgaagcatgcctccttcctcttccgtcagcaggcgggcagcggcctctccgaagaggatgcccctgagcgagagggcctcatcgcctacgtgatgagtgagaacttctcccgaccccttggcccaccctccagctcctccatctcctccacttccttcccaccctcctatgacagtgtcactagagccaccagcgataacctccaggtgcgggggtctgactacagccacagtgaagatctcgccgacttccccccttctccggacagggaccgtgagtccatcgtgtgagcctcggcctggctggccaggacacactgaaaagcagcctttttcaccatggcaaacctaaatgcagtcagtcacaaaccagcctggggccttcctggctttgggagtaagaaatgggcctcagccccgcggatcaaccaggcagagttctgtggcgccgcgtggacagccggagcagttggcctgtgcttggaggcctcagatagacctgtgacctggtctggtcaggcaatgccctgcggctctggaaagcaacttcatcccagctgctgaggcgaaatataaaactgagactgtatatgttgtgaatgggctttcataaatttattatatttgatatttttttacttgagcaaagaactaaggatttttccatggacatgggcagcaattcacgctgtctcttcttaaccctgaacaagagtgtctatggagcagccggaagtctgttctcaaagcagaagtggaatccagtgtggctcccacaggtcttcactgcccaggggtcgaatggggtccccctcccacttgacctgagatgctgggagggctgaacccccactcacacaagcacacacacacagtcctcacacacggaggccagacacaggccgtgggacccaggctcccagcctaagggagacaggcctttccctgccggccccccaaggatggggttcttgtccacggggctcactctggccccctattgtctccaaggtcccattttccccctgtgttttcacgcaggtcatattgtcagtcctacaaaaataaaaggcttccagaggagagtggcctgggtcccagggctggccctaggcactgatagttgccttttcttcccctcctgtaagagtattaacaaaaccaaaggacacaagggtgcaagccccattcacggcctggcatgcagcttgtccttgctcctggaacctggcaggccctgcccagccagccatcggaagagagggctgagccatgggggtttggggctaagaagttcaccagccctgagccatggcggcccctcagcctgcctgaagagaggaaactggcgatctcccagggctctctggaccatacgcggaggagttttctgtgtggtctccagctcctctccagacacagagacatgggagtggggagcggagcttggccctgcgccctgtgcagggaaagggatggtcaggcccagttctcgtgcccttagaggggaatgaaccatggcacctttgagagagggggcactgtggtcaggcccagcctctctggctcagcccgggatcctgatggcacccacacagaggacctctttggggcaagatccaggtggtcccataggtcttgtgaaaaggctttttcagggaaaaatattttactagtccaatcacccccaggacctcttcagctgctgacaatcctatttagcatatgcaaatcttttaacatagagaactgtcaccctgaggtaacagggtcaactggcgaagcctgagcaggcaggggcttggctgccccattccagctctcccatggagcccctccaccgggcgcatgcctcccaggccacctcagtctcacctgccggctctgggctggctgctcctaacctacctcgccgagctgtcggagggctggacatttgtggcagtgctgaagggggcattgccggcgagtaaagtattatgtttcttcttgtcaccccagttcccttggtggcaaccccagacccaacccatgcccctgacagatctagttctcttctcctgtgttccctttgagtccagtgtgggacacggtttaactgtcccagcgacatttctccaagtggaaatcctatttttgtagatctccatgctttgctctcaaggcttggagaggtatgtgcccctcctgggtgctcaccgcctgctacacaggcaggaatgcggttgggaggcaggtcgggctgccagcccagctggccggaaggagactgtggtttttgtgtgtgtggacagcccgggagctttgagacaggtgcctggggctggctgcagacggtgtggttgggggtgggaggtgagctagacccaacccttagcttttagcctggctgtcacctttttaatttccagaactgcacaatgaccagcaggagggaaggacagacatcaagtgccagatgttgtctgaactaatcgagcacttctcaccaaacttcatgtataaataaaatacatatttttaaaacaaaccaataaatggcttacatga
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6331 -> Molecular function: GO:0005248 [voltage-gated sodium channel activity] evidence: IDA
GeneID:6331 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0030506 [ankyrin binding] evidence: IDA
GeneID:6331 -> Molecular function: GO:0044325 [ion channel binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IDA
GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IMP
GeneID:6331 -> Molecular function: GO:0097110 [scaffold protein binding] evidence: IPI
GeneID:6331 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP
GeneID:6331 -> Biological process: GO:0003231 [cardiac ventricle development] evidence: ISS
GeneID:6331 -> Biological process: GO:0003360 [brainstem development] evidence: ISS
GeneID:6331 -> Biological process: GO:0006814 [sodium ion transport] evidence: IDA
GeneID:6331 -> Biological process: GO:0010765 [positive regulation of sodium ion transport] evidence: IDA
GeneID:6331 -> Biological process: GO:0014894 [response to denervation involved in regulation of muscle adaptation] evidence: ISS
GeneID:6331 -> Biological process: GO:0021537 [telencephalon development] evidence: ISS
GeneID:6331 -> Biological process: GO:0021549 [cerebellum development] evidence: ISS
GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IDA
GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IMP
GeneID:6331 -> Biological process: GO:0042475 [odontogenesis of dentin-containing tooth] evidence: ISS
GeneID:6331 -> Biological process: GO:0045760 [positive regulation of action potential] evidence: ISS
GeneID:6331 -> Biological process: GO:0050679 [positive regulation of epithelial cell proliferation] evidence: ISS
GeneID:6331 -> Biological process: GO:0051899 [membrane depolarization] evidence: IDA
GeneID:6331 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
GeneID:6331 -> Biological process: GO:0060307 [regulation of ventricular cardiac muscle cell membrane repolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0060371 [regulation of atrial cardiac muscle cell membrane depolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0060372 [regulation of atrial cardiac muscle cell membrane repolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0060373 [regulation of ventricular cardiac muscle cell membrane depolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0071277 [cellular response to calcium ion] evidence: IDA
GeneID:6331 -> Biological process: GO:0086002 [regulation of cardiac muscle cell action potential involved in contraction] evidence: IMP
GeneID:6331 -> Biological process: GO:0086004 [regulation of cardiac muscle cell contraction] evidence: IMP
GeneID:6331 -> Biological process: GO:0086005 [regulation of ventricular cardiac muscle cell action potential] evidence: IMP
GeneID:6331 -> Biological process: GO:0086010 [membrane depolarization involved in regulation of action potential] evidence: IDA
GeneID:6331 -> Biological process: GO:0086012 [membrane depolarization involved in regulation of cardiac muscle cell action potential] evidence: IMP
GeneID:6331 -> Biological process: GO:0086046 [membrane depolarization involved in regulation of SA node cell action potential] evidence: ISS
GeneID:6331 -> Biological process: GO:0086067 [AV node cell to bundle of His cell communication] evidence: IMP
GeneID:6331 -> Biological process: GO:0086069 [bundle of His cell to Purkinje myocyte communication] evidence: IMP
GeneID:6331 -> Biological process: GO:0086070 [SA node cell to atrial cardiac muscle cell communication] evidence: IMP
GeneID:6331 -> Biological process: GO:0086091 [regulation of heart rate by cardiac conduction] evidence: IMP
GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IC
GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IDA
GeneID:6331 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IDA
GeneID:6331 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:6331 -> Cellular component: GO:0005901 [caveola] evidence: TAS
GeneID:6331 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: IDA
GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: ISS
GeneID:6331 -> Cellular component: GO:0016021 [integral to membrane] evidence: IDA
GeneID:6331 -> Cellular component: GO:0030315 [T-tubule] evidence: IDA
GeneID:6331 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.