Home |
Help |
Advanced search
2024-04-19 16:55:13, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001146068 3270 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens calpain 2, (m/II) large subunit (CAPN2), transcript
variant 2, mRNA.
ACCESSION NM_001146068
VERSION NM_001146068.1 GI:225703099
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3270)
AUTHORS Storr,S.J., Safuan,S., Woolston,C.M., Abdel-Fatah,T., Deen,S.,
Chan,S.Y. and Martin,S.G.
TITLE Calpain-2 expression is associated with response to platinum based
chemotherapy, progression-free and overall survival in ovarian
cancer
JOURNAL J. Cell. Mol. Med. 16 (10), 2422-2428 (2012)
PUBMED 22435971
REMARK GeneRIF: High expression of calpain-2 is significantly associated
with resistance to platinum-based adjuvant chemotherapy.
REFERENCE 2 (bases 1 to 3270)
AUTHORS Storr,S.J., Lee,K.W., Woolston,C.M., Safuan,S., Green,A.R.,
Macmillan,R.D., Benhasouna,A., Parr,T., Ellis,I.O. and Martin,S.G.
TITLE Calpain system protein expression in basal-like and triple-negative
invasive breast cancer
JOURNAL Ann. Oncol. 23 (9), 2289-2296 (2012)
PUBMED 22745213
REMARK GeneRIF: Expression of the large catalytic subunit of calpain-2 is
significantly associated with clinical outcome of patients with
triple-negative and basal-like disease.
REFERENCE 3 (bases 1 to 3270)
AUTHORS Wang,C.F. and Huang,Y.S.
TITLE Calpain 2 activated through N-methyl-D-aspartic acid receptor
signaling cleaves CPEB3 and abrogates CPEB3-repressed translation
in neurons
JOURNAL Mol. Cell. Biol. 32 (16), 3321-3332 (2012)
PUBMED 22711986
REMARK GeneRIF: cleavage of CPEB3 by NMDA-activated calpain 2 accounts for
the activity-related translation of CPEB3-targeted RNAs
REFERENCE 4 (bases 1 to 3270)
AUTHORS Shen,C., Yu,Y., Li,H., Yan,G., Liu,M., Shen,H. and Yang,P.
TITLE Global profiling of proteolytically modified proteins in human
metastatic hepatocellular carcinoma cell lines reveals CAPN2
centered network
JOURNAL Proteomics 12 (12), 1917-1927 (2012)
PUBMED 22623320
REMARK GeneRIF: Two human hepatocellular carcinoma cell lines were
researched using proteomics. A proteolysis network was built up, of
which the CAPN2 centered subnetwork, including SPTBN1, ATP5B, and
VIM, was more active in the highly metastatic HCC cell line.
REFERENCE 5 (bases 1 to 3270)
AUTHORS Ma,J., Cui,W., He,S.M., Duan,Y.H., Heng,L.J., Wang,L. and Gao,G.D.
TITLE Human U87 astrocytoma cell invasion induced by interaction of
betaig-h3 with integrin alpha5beta1 involves calpain-2
JOURNAL PLoS ONE 7 (5), E37297 (2012)
PUBMED 22629380
REMARK GeneRIF: betaig-h3 co-localized with integrin alpha5beta1 to
enhance the invasion of U87 cells, and that calpain-2, is involved
in this process, acting as a downstream molecule.
REFERENCE 6 (bases 1 to 3270)
AUTHORS Adachi,Y., Kitahara-Ozawa,A., Sugamura,K., Lee,W.J., Yodoi,J.,
Maki,M., Murachi,T. and Hatanaka,M.
TITLE Expression of calpain II gene in human hematopoietic system cells
infected with human T-cell leukemia virus type I
JOURNAL J. Biol. Chem. 267 (27), 19373-19378 (1992)
PUBMED 1527057
REFERENCE 7 (bases 1 to 3270)
AUTHORS Ohno,S., Minoshima,S., Kudoh,J., Fukuyama,R., Shimizu,Y.,
Ohmi-Imajoh,S., Shimizu,N. and Suzuki,K.
TITLE Four genes for the calpain family locate on four distinct human
chromosomes
JOURNAL Cytogenet. Cell Genet. 53 (4), 225-229 (1990)
PUBMED 2209092
REFERENCE 8 (bases 1 to 3270)
AUTHORS Hata,A., Ohno,S., Akita,Y. and Suzuki,K.
TITLE Tandemly reiterated negative enhancer-like elements regulate
transcription of a human gene for the large subunit of
calcium-dependent protease
JOURNAL J. Biol. Chem. 264 (11), 6404-6411 (1989)
PUBMED 2539381
REFERENCE 9 (bases 1 to 3270)
AUTHORS Imajoh,S., Aoki,K., Ohno,S., Emori,Y., Kawasaki,H., Sugihara,H. and
Suzuki,K.
TITLE Molecular cloning of the cDNA for the large subunit of the
high-Ca2+-requiring form of human Ca2+-activated neutral protease
JOURNAL Biochemistry 27 (21), 8122-8128 (1988)
PUBMED 2852952
REFERENCE 10 (bases 1 to 3270)
AUTHORS Kopp,S.
TITLE Reproducibility of response to a questionnaire on symptoms of
masticatory dysfunction
JOURNAL Community Dent Oral Epidemiol 4 (5), 205-209 (1976)
PUBMED 1067155
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AK297800.1, BC011828.2,
DA448245.1, AB209855.1 and AI089162.1.
Summary: The calpains, calcium-activated neutral proteases, are
nonlysosomal, intracellular cysteine proteases. The mammalian
calpains include ubiquitous, stomach-specific, and muscle-specific
proteins. The ubiquitous enzymes consist of heterodimers with
distinct large, catalytic subunits associated with a common small,
regulatory subunit. This gene encodes the large subunit of the
ubiquitous enzyme, calpain 2. Multiple heterogeneous
transcriptional start sites in the 5' UTR have been reported. Two
transcript variants encoding different isoforms have been found for
this gene. [provided by RefSeq, Mar 2009].
Transcript Variant: This variant (2) differs in the 5' UTR and
coding sequence compared to variant 1. The resulting isoform (2)
has a shorter and distinct N-terminus compared to isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK297800.1, AK316211.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025085 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-307 AK297800.1 1-307
308-583 BC011828.2 530-805
584-584 DA448245.1 165-165
585-1820 BC011828.2 807-2042
1821-3091 AB209855.1 1908-3178
3092-3270 AI089162.1 1-179 c
FEATURES Location/Qualifiers
source 1..3270
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q41-q42"
gene 1..3270
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="calpain 2, (m/II) large subunit"
/db_xref="GeneID:824"
/db_xref="HGNC:1479"
/db_xref="MIM:114230"
exon 1..239
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 79
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:376461497"
variation 95..96
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace=""
/replace="a"
/db_xref="dbSNP:201695010"
variation 151
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:28550947"
variation 154
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:2404355"
variation 175
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:138112561"
misc_feature 204..206
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="upstream in-frame stop codon"
variation 221
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:4511081"
variation 231
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:184603953"
variation 233
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:187427384"
CDS 237..2105
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/EC_number="3.4.22.53"
/note="isoform 2 is encoded by transcript variant 2;
calpain, large polypeptide L2; calpain 2, large subunit;
calpain 2, large [catalytic] subunit; calpain-2 catalytic
subunit; calpain M-type; M-calpain; millimolar-calpain;
CANP 2; calpain-2 large subunit; calpain large polypeptide
L2; calcium-activated neutral proteinase 2"
/codon_start=1
/product="calpain-2 catalytic subunit isoform 2"
/protein_id="NP_001139540.1"
/db_xref="GI:225703100"
/db_xref="CCDS:CCDS53478.1"
/db_xref="GeneID:824"
/db_xref="HGNC:1479"
/db_xref="MIM:114230"
/translation="
MEICADPQFIIGGATRTDICQGALGDCWLLAAIASLTLNEEILARVVPLNQSFQENYAGIFHFQFWQYGEWVEVVVDDRLPTKDGELLFVHSAEGSEFWSALLEKAYAKINGCYEALSGGATTEGFEDFTGGIAEWYELKKPPPNLFKIIQKALQKGSLLGCSIDITSAADSEAITFQKLVKGHAYSVTGAEEVESNGSLQKLIRIRNPWGEVEWTGRWNDNCPSWNTIDPEERERLTRRHEDGEFWMSFSDFLRHYSRLEICNLTPDTLTSDTYKKWKLTKMDGNWRRGSTAGGCRNYPNTFWMNPQYLIKLEEEDEDEEDGESGCTFLVGLIQKHRRRQRKMGEDMHTIGFGIYEVPEELSGQTNIHLSKNFFLTNRARERSDTFINLREVLNRFKLPPGEYILVPSTFEPNKDGDFCIRVFSEKKADYQAVDDEIEANLEEFDISEDDIDDGFRRLFAQLAGEDAEISAFELQTILRRVLAKRQDIKSDGFSIETCKIMVDMLDSDGSGKLGLKEFYILWTKIQKYQKIYREIDVDRSGTMNSYEMRKALEEAGFKMPCQLHQVIVARFADDQLIIDFDNFVRCLVRLETLFKIFKQLDPENTGTIELDLISWLCFSVL
"
misc_feature 237..1028
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="Calpains, domains IIa, IIb; calcium-dependent
cytoplasmic cysteine proteinases, papain-like. Functions
in cytoskeletal remodeling processes, cell
differentiation, apoptosis and signal transduction;
Region: CysPc; cd00044"
/db_xref="CDD:28925"
misc_feature order(315..317,786..788,858..860)
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="catalytic site [active]"
/db_xref="CDD:28925"
misc_feature 1062..1538
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="Calpain, subdomain III. Calpains are
calcium-activated cytoplasmic cysteine proteinases,
participate in cytoskeletal remodeling processes, cell
differentiation, apoptosis and signal transduction.
Catalytic domain and the two calmodulin-like domains
are...; Region: Calpain_III; cd00214"
/db_xref="CDD:29269"
misc_feature order(1176..1184,1215..1217)
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="acidic loop; other site"
/db_xref="CDD:29269"
misc_feature 1632..1811
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="EF-hand domain pair; Region: EF_hand_6; pfam13833"
/db_xref="CDD:206004"
misc_feature 1731..1895
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="EF-hand, calcium binding motif; A diverse
superfamily of calcium sensors and calcium signal
modulators; most examples in this alignment model have 2
active canonical EF hands. Ca2+ binding induces a
conformational change in the EF-hand motif, leading to...;
Region: EFh; cd00051"
/db_xref="CDD:28933"
misc_feature order(1755..1757,1761..1763,1767..1769,1788..1790,
1845..1847,1851..1853,1857..1859,1878..1880)
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:28933"
misc_feature 1812..>2087
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="Ca2+-binding protein (EF-Hand superfamily) [Signal
transduction mechanisms / Cytoskeleton / Cell division and
chromosome partitioning / General function prediction
only]; Region: FRQ1; COG5126"
/db_xref="CDD:34727"
exon 240..309
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 249
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:146935874"
variation 268
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:200558564"
variation 282
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:144316024"
variation 303
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:371602613"
variation 308
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:17596"
exon 310..428
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 370
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:369599821"
variation 374
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:372591359"
variation 375
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:375820403"
variation 422
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:139777234"
exon 429..562
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 437
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:146548007"
variation 441
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:12122278"
variation 443
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:147841921"
variation 450
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:369131658"
variation 473
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:372898901"
variation 482
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:17597"
variation 488
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:377263295"
variation 492
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:141894173"
variation 500
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:17598"
variation 515
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:3738377"
variation 521
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:149399445"
variation 545
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:370792781"
variation 552
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:147235023"
variation 557
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:146165743"
exon 563..731
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 584
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:17600"
variation 614
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:139316104"
variation 646
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:201961877"
variation 658
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:147824152"
variation 709
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140704789"
exon 732..815
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 734
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:371937820"
variation 741
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:149026969"
exon 816..901
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 849
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:149096348"
variation 851
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:75929332"
variation 884
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:200144173"
variation 889
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:146546882"
variation 893
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:138405763"
exon 902..976
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 918
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:201613674"
variation 920
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:201171878"
variation 921
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:200300250"
variation 956
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:190784958"
exon 977..1137
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 995
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:201694370"
variation 1007
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:28370081"
variation 1011
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:142874360"
variation 1012
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:139659399"
variation 1046
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:28370082"
variation 1053
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:149659079"
variation 1102
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:374476504"
variation 1112
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:377763395"
variation 1114
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:145466296"
variation 1115
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:145344369"
variation 1116
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:199728877"
variation 1136
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:141342575"
exon 1138..1307
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1156
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:201781579"
variation 1193
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:201268064"
variation 1194
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:368366230"
variation 1211
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:372088631"
variation 1252
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:148370103"
variation 1254
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:375412773"
variation 1271
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:368949645"
variation 1277
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:371353695"
exon 1308..1319
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
exon 1320..1531
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1333
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:376104085"
variation 1373
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:150813013"
variation 1374
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:370722848"
variation 1384
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:148169772"
variation 1408
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:143885626"
variation 1412
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:374384888"
variation 1429
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:9804140"
variation 1443
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:148678361"
variation 1444
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:151234089"
variation 1464
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:144006318"
variation 1478
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:201955876"
variation 1501
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:201053061"
variation 1502
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:375605587"
exon 1532..1568
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1539
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:369320951"
variation 1558
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:192016088"
variation 1563
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:28370127"
exon 1569..1634
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1581
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:145816861"
variation 1591
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:369150450"
variation 1602
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:1130848"
variation 1617
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:372646959"
exon 1635..1692
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1640
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:144506321"
variation 1661
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:202078174"
variation 1662
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:192850510"
variation 1664
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:199718662"
variation 1677
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:199816050"
variation 1679
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:201111260"
exon 1693..1757
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1696
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:201138626"
variation 1704
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:17599"
variation 1712
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:371565778"
variation 1726
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="t"
/db_xref="dbSNP:200417819"
exon 1758..1826
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1760
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:139113564"
variation 1801
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:192780261"
variation 1817
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:375441224"
exon 1827..1905
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1842
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="t"
/db_xref="dbSNP:150551571"
variation 1845
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:144592508"
variation 1847
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:369952708"
variation 1885
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:148485450"
variation 1891
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:372461819"
variation 1900
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:199643396"
variation 1905
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:369104615"
exon 1906..2022
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1938
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:146423555"
variation 1940
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:374729587"
variation 1947
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:143262618"
variation 1965
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:200435825"
variation 1994
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:367730701"
variation 2015
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:145389568"
variation 2017
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:139047155"
exon 2023..2081
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 2031
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:2230082"
variation 2045
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:372396856"
variation 2046
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:200476814"
variation 2053
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:201100784"
variation 2070
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:200236165"
exon 2082..3266
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 2089
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:76751378"
variation 2095
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:148122411"
variation 2098
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:184347397"
variation 2136
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:372699410"
variation 2177
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:188792767"
STS 2183..2521
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/db_xref="UniSTS:56629"
variation 2206
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:16842201"
variation 2293
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:28370175"
variation 2295
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:187383102"
variation 2310
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:369415939"
variation 2344
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:28370176"
variation 2363
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:28370177"
variation 2379
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:375053676"
variation 2465
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:28370178"
variation 2468
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:28370179"
variation 2475
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:10961"
variation 2489
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:12043790"
variation 2526..2527
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace=""
/replace="tt"
/db_xref="dbSNP:373808822"
variation 2587
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:28370180"
variation 2681
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:189292302"
variation 2754
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace=""
/replace="c"
/db_xref="dbSNP:3835626"
variation 2796
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:1803242"
STS 2799..2900
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/standard_name="D1S3584"
/db_xref="UniSTS:5231"
STS 2802..2953
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/standard_name="SHGC-76403"
/db_xref="UniSTS:42019"
variation 2813
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:13341"
variation 2836
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:180963689"
variation 2844
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:1063453"
variation 2853
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:185195602"
variation 2879
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:190247452"
variation 2957
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:28370182"
variation 2989
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:28370183"
variation 3014
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:7331"
polyA_signal 3060..3065
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
variation 3075
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="t"
/db_xref="dbSNP:3820472"
polyA_site 3092
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
variation 3131..3132
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace=""
/replace="g"
/db_xref="dbSNP:35076255"
polyA_signal 3230..3235
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
polyA_site 3266
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
ORIGIN
actcagactctgatggctctgtagctaactggcccatcctcagagactaacgcaaaggaacgaatttccaggatgttcgactatgtggagaaaacaaaaaaaaagcaaagaaaaaaatatttttaaagaaagaaagaaggccaggtgcagtggctcacgcctgtaatcccaacactttgggaggccgaggcagacagatcacctgaggtcaggagttcaagaccagcctggccaacatggagatctgcgctgacccccagtttatcattggaggagccacccgcacagacatctgccaaggagccctgggtgactgctggctgctggcagccattgcctccctcaccttgaatgaagaaatcctggctcgagtcgtccccctaaaccagagcttccaggaaaactatgcagggatctttcacttccagttctggcaatacggcgagtgggtggaggtggtggtggatgacaggctgcccaccaaggacggggagctgctctttgtgcattcagccgaagggagcgagttctggagcgccctgctggagaaggcatacgccaagatcaacggatgctatgaagcgctatcagggggtgccaccactgagggcttcgaagacttcaccggaggcattgctgagtggtatgagttgaagaagccccctcccaacctgttcaagatcatccagaaagctctgcaaaaaggctctctccttggctgctccatcgacatcaccagcgccgcggactcggaggccatcacgtttcagaagctggtgaaggggcacgcgtactcggtcaccggagccgaggaggttgaaagtaacggaagcctacagaaactgatccgcatccgaaatccctggggagaagtggagtggacagggcggtggaatgacaactgcccaagctggaacactatagacccagaggagagggaaaggctgaccagacggcatgaagatggagaattctggatgtctttcagtgacttcctgaggcactattcccgcctggagatctgtaacctgaccccagacactctcaccagcgatacctacaagaagtggaaactcaccaaaatggatgggaactggaggcggggctccaccgcgggaggttgcaggaactacccgaacacattctggatgaaccctcagtacctgatcaagctggaggaggaggatgaggacgaggaggatggggagagcggctgcaccttcctggtggggctcattcagaagcaccgacggcggcagaggaagatgggcgaggacatgcacaccatcggctttggcatctatgaggttccagaggagttaagtgggcagaccaacatccacctcagcaaaaacttcttcctgacgaatcgcgccagggagcgctcagacaccttcatcaacctccgggaggtgctcaaccgcttcaagctgccgccaggagagtacattctcgtgccttccaccttcgaacccaacaaggatggggatttctgcatccgggtcttttctgaaaagaaagctgactaccaagctgtcgatgatgaaatcgaggccaatcttgaagagttcgacatcagcgaggatgacattgatgatggattcaggagactgtttgcccagttggcaggagaggatgcggagatctctgcctttgagctgcagaccatcctgagaagggttctagcaaagcgccaagatatcaagtcagatggcttcagcatcgagacatgcaaaattatggttgacatgctagattcggacgggagtggcaagctggggctgaaggagttctacattctctggacgaagattcaaaaataccaaaaaatttaccgagaaatcgacgttgacaggtctggtaccatgaattcctatgaaatgcggaaggcattagaagaagcaggtttcaagatgccctgtcaactccaccaagtcatcgttgctcggtttgcagatgaccagctcatcatcgattttgataattttgttcggtgtttggttcggctggaaacgctattcaagatatttaagcagctggatcccgagaatactggaacaatagagctcgaccttatctcttggctctgtttctcagtactttgaagttataactaatctgcctgaagacttctcatgatggaaaatcagccaaggactaagcttccatagaaatacactttgtatctggacctcaaaattatgggaacatttacttaaacggatgatcatagctgaaaataatgatactgtcaatttgagatagcagaagtttcacacatcaaagtaaaagatttgcatatcattatactaaatgcaaatgagtcgcttaacccttgacaaggtcaaagaaagctttaaatctgtaaatagtatacactttttacttttacacactttcctgttcatagcaatattaaatcaggaaaaaaaaatgcagggaggtatttaacagctgagcaaaaacattgagtcgctctcaaaggacacgaggcccttggcagggaatatttaaagcaacttcaagtttaaaatgcagctgttgattctaccaaacaacagtccaagattaccatttcccatgagccaactgggaaacatggtatatcatgaagtaatcttgtcaaggcatctggagagtccaggagagaagactcacctctgtcgcttgggttaaacaagagacaggttttgtagaatattgattggtaatagtaaatcgttctccttacaatcaagttcttgaccctattcggccttatacatctggtcttacaaagaccaaagggatcctgcgcttgatcaactgaaccagtatgccaaaaccaggcatccaatttgtaaaccaattatgataaaggacaaaataagctgtttgccacctcaaaactttatgaacttcaccaccactagtgtctgtccatggagttagaggggacatcacttagaagttcttatagaaaggacacaagtttgtttcctggctttaccttgggaaaatgctagcaacattatagaaattttgccttgttgccttatcttcttccaaatgtactgttaaataaaaataaagggttaccccatgcaatcacaccatgccatgttttccttcctggagggcagccccacaggacggtttatgagcacacaattatagcttgtttctactttaacaaggtatgctgcctctgtaaattcatgtattcaaaggaaaagacaccttgcctataattaaaatgtggaactataaaattttttaaaatccaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:824 -> Molecular function: GO:0004198 [calcium-dependent cysteine-type endopeptidase activity] evidence: IEA
GeneID:824 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
GeneID:824 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:824 -> Molecular function: GO:0008092 [cytoskeletal protein binding] evidence: IEA
GeneID:824 -> Molecular function: GO:0008234 [cysteine-type peptidase activity] evidence: TAS
GeneID:824 -> Molecular function: GO:0046982 [protein heterodimerization activity] evidence: IEA
GeneID:824 -> Biological process: GO:0001666 [response to hypoxia] evidence: IEA
GeneID:824 -> Biological process: GO:0001824 [blastocyst development] evidence: IEA
GeneID:824 -> Biological process: GO:0006508 [proteolysis] evidence: IEA
GeneID:824 -> Biological process: GO:0007520 [myoblast fusion] evidence: IEA
GeneID:824 -> Biological process: GO:0016540 [protein autoprocessing] evidence: IEA
GeneID:824 -> Cellular component: GO:0000785 [chromatin] evidence: IEA
GeneID:824 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
GeneID:824 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:824 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001139540 -> EC 3.4.22.53
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.