GGRNA Home | Help | Advanced search

2019-03-23 03:28:45, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001146               4338 bp    mRNA    linear   PRI 15-JUL-2013
DEFINITION  Homo sapiens angiopoietin 1 (ANGPT1), transcript variant 1, mRNA.
ACCESSION   NM_001146
VERSION     NM_001146.3  GI:21328452
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4338)
  AUTHORS   Yamakawa,D., Kidoya,H., Sakimoto,S., Jia,W., Naito,H. and
            Takakura,N.
  TITLE     Ligand-independent Tie2 dimers mediate kinase activity stimulated
            by high dose angiopoietin-1
  JOURNAL   J. Biol. Chem. 288 (18), 12469-12477 (2013)
   PUBMED   23504320
  REMARK    GeneRIF: ligand-independent dimerization of Tie2 is essential for a
            strong response upon stimulation with high dose Ang1.
REFERENCE   2  (bases 1 to 4338)
  AUTHORS   Yu,X., Seegar,T.C., Dalton,A.C., Tzvetkova-Robev,D., Goldgur,Y.,
            Rajashankar,K.R., Nikolov,D.B. and Barton,W.A.
  TITLE     Structural basis for angiopoietin-1-mediated signaling initiation
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 110 (18), 7205-7210 (2013)
   PUBMED   23592718
  REMARK    GeneRIF: the crystal structures of Ang1 both unbound and in complex
            with the Tie2 ectodomain, are presented.
REFERENCE   3  (bases 1 to 4338)
  AUTHORS   Boscolo,E., Mulliken,J.B. and Bischoff,J.
  TITLE     Pericytes from infantile hemangioma display proangiogenic
            properties and dysregulated angiopoietin-1
  JOURNAL   Arterioscler. Thromb. Vasc. Biol. 33 (3), 501-509 (2013)
   PUBMED   23288163
  REMARK    GeneRIF: Preicytes isolated from infantile hemangioma exhibited
            proangiogenic properties and produced low levels of angiopoietin 1.
REFERENCE   4  (bases 1 to 4338)
  AUTHORS   Lauc,G., Huffman,J.E., Pucic,M., Zgaga,L., Adamczyk,B., Muzinic,A.,
            Novokmet,M., Polasek,O., Gornik,O., Kristic,J., Keser,T.,
            Vitart,V., Scheijen,B., Uh,H.W., Molokhia,M., Patrick,A.L.,
            McKeigue,P., Kolcic,I., Lukic,I.K., Swann,O., van Leeuwen,F.N.,
            Ruhaak,L.R., Houwing-Duistermaat,J.J., Slagboom,P.E., Beekman,M.,
            de Craen,A.J., Deelder,A.M., Zeng,Q., Wang,W., Hastie,N.D.,
            Gyllensten,U., Wilson,J.F., Wuhrer,M., Wright,A.F., Rudd,P.M.,
            Hayward,C., Aulchenko,Y., Campbell,H. and Rudan,I.
  TITLE     Loci associated with N-glycosylation of human immunoglobulin G show
            pleiotropy with autoimmune diseases and haematological cancers
  JOURNAL   PLoS Genet. 9 (1), E1003225 (2013)
   PUBMED   23382691
REFERENCE   5  (bases 1 to 4338)
  AUTHORS   Choi,J.S., Kwak,K.A., Park,M.J., Kim,Y.H., Gil,H.W., Song,H.Y. and
            Hong,S.Y.
  TITLE     Ratio of angiopoietin-2 to angiopoietin-1 predicts mortality in
            acute lung injury induced by paraquat
  JOURNAL   Med. Sci. Monit. 19, 28-33 (2013)
   PUBMED   23302768
  REMARK    GeneRIF: The Ang-2: Ang-1 ratio was significantly higher in the
            early death group (2.41 +/- 2.54) than in the survivors (0.90 +/-
            0.49) and the late death group (1.33 +/- 0.64).
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 4338)
  AUTHORS   Ristimaki,A., Narko,K., Enholm,B., Joukov,V. and Alitalo,K.
  TITLE     Proinflammatory cytokines regulate expression of the lymphatic
            endothelial mitogen vascular endothelial growth factor-C
  JOURNAL   J. Biol. Chem. 273 (14), 8413-8418 (1998)
   PUBMED   9525952
REFERENCE   7  (bases 1 to 4338)
  AUTHORS   Maisonpierre,P.C., Suri,C., Jones,P.F., Bartunkova,S.,
            Wiegand,S.J., Radziejewski,C., Compton,D., McClain,J.,
            Aldrich,T.H., Papadopoulos,N., Daly,T.J., Davis,S., Sato,T.N. and
            Yancopoulos,G.D.
  TITLE     Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo
            angiogenesis
  JOURNAL   Science 277 (5322), 55-60 (1997)
   PUBMED   9204896
REFERENCE   8  (bases 1 to 4338)
  AUTHORS   Suri,C., Jones,P.F., Patan,S., Bartunkova,S., Maisonpierre,P.C.,
            Davis,S., Sato,T.N. and Yancopoulos,G.D.
  TITLE     Requisite role of angiopoietin-1, a ligand for the TIE2 receptor,
            during embryonic angiogenesis
  JOURNAL   Cell 87 (7), 1171-1180 (1996)
   PUBMED   8980224
REFERENCE   9  (bases 1 to 4338)
  AUTHORS   Davis,S., Aldrich,T.H., Jones,P.F., Acheson,A., Compton,D.L.,
            Jain,V., Ryan,T.E., Bruno,J., Radziejewski,C., Maisonpierre,P.C.
            and Yancopoulos,G.D.
  TITLE     Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by
            secretion-trap expression cloning
  JOURNAL   Cell 87 (7), 1161-1169 (1996)
   PUBMED   8980223
REFERENCE   10 (bases 1 to 4338)
  AUTHORS   Ruegg,C. and Pytela,R.
  TITLE     Sequence of a human transcript expressed in T-lymphocytes and
            encoding a fibrinogen-like protein
  JOURNAL   Gene 160 (2), 257-262 (1995)
   PUBMED   7642106
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from D13628.2, AL700429.1 and
            AW069541.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Jun 7, 2002 this sequence version replaced gi:20532339.
            
            Summary: Angiopoietins are proteins with important roles in
            vascular development and angiogenesis. All angiopoietins bind with
            similar affinity to an endothelial cell-specific tyrosine-protein
            kinase receptor. The protein encoded by this gene is a secreted
            glycoprotein that activates the receptor by inducing its tyrosine
            phosphorylation. It plays a critical role in mediating reciprocal
            interactions between the endothelium and surrounding matrix and
            mesenchyme and inhibits endothelial permeability. The protein also
            contributes to blood vessel maturation and stability, and may be
            involved in early development of the heart. Alternative splicing
            results in multiple transcript variants encoding distinct
            isoforms.[provided by RefSeq, Dec 2010].
            
            Transcript Variant: This variant (1) represents the longer
            transcript and encodes the longer isoform (1).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX648814.1, BC152411.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025098 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..4338
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8q23.1"
     gene            1..4338
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="angiopoietin 1"
                     /db_xref="GeneID:284"
                     /db_xref="HGNC:484"
                     /db_xref="HPRD:03392"
                     /db_xref="MIM:601667"
     exon            1..765
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    388..390
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="upstream in-frame stop codon"
     CDS             469..1965
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="isoform 1 precursor is encoded by transcript
                     variant 1; ANG-1"
                     /codon_start=1
                     /product="angiopoietin-1 isoform 1 precursor"
                     /protein_id="NP_001137.2"
                     /db_xref="GI:20532340"
                     /db_xref="CCDS:CCDS6306.1"
                     /db_xref="GeneID:284"
                     /db_xref="HGNC:484"
                     /db_xref="HPRD:03392"
                     /db_xref="MIM:601667"
                     /translation="
MTVFLSFAFLAAILTHIGCSNQRRSPENSGRRYNRIQHGQCAYTFILPEHDGNCRESTTDQYNTNALQRDAPHVEPDFSSQKLQHLEHVMENYTQWLQKLENYIVENMKSEMAQIQQNAVQNHTATMLEIGTSLLSQTAEQTRKLTDVETQVLNQTSRLEIQLLENSLSTYKLEKQLLQQTNEILKIHEKNSLLEHKILEMEGKHKEELDTLKEEKENLQGLVTRQTYIIQELEKQLNRATTNNSVLQKQQLELMDTVHNLVNLCTKEGVLLKGGKREEEKPFRDCADVYQAGFNKSGIYTIYINNMPEPKKVFCNMDVNGGGWTVIQHREDGSLDFQRGWKEYKMGFGNPSGEYWLGNEFIFAITSQRQYMLRIELMDWEGNRAYSQYDRFHIGNEKQNYRLYLKGHTGTAGKQSSLILHGADFSTKDADNDNCMCKCALMLTGGWWFDACGPSNLNGMFYTAGQNHGKLNGIKWHYFKGPSYSLRSTTMMIRPLDF
"
     sig_peptide     469..528
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    1309..1956
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="Fibrinogen-related domains (FReDs); C terminal
                     globular domain of fibrinogen. Fibrinogen is involved in
                     blood clotting, being activated by thrombin to assemble
                     into fibrin clots. The N-termini of 2 times 3 chains come
                     together to form a globular...; Region: FReD; cd00087"
                     /db_xref="CDD:28971"
     misc_feature    1672..1674
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="gamma-gamma dimer interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:28971"
     misc_feature    order(1759..1761,1765..1767,1771..1773)
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28971"
     misc_feature    order(1783..1785,1792..1797,1822..1827)
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="polymerization pocket; other site"
                     /db_xref="CDD:28971"
     STS             751..1331
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /standard_name="Agpt"
                     /db_xref="UniSTS:166624"
     exon            766..921
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            922..1043
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            1044..1276
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            1277..1404
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     STS             1287..1744
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /standard_name="Angpt1"
                     /db_xref="UniSTS:471085"
     exon            1405..1506
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            1507..1673
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            1674..1804
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            1805..4338
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     variation       2269..2314
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:45624134"
     variation       2914
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1954727"
     variation       3187
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41322349"
     variation       3334..3379
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:45532734"
     STS             3549..3685
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /standard_name="RH25244"
                     /db_xref="UniSTS:16614"
     variation       3564
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41343148"
     variation       3621..3666
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45545232"
     variation       3666
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41364248"
     variation       3674
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41421548"
     variation       3786
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41415945"
     STS             3860..4101
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /standard_name="RH17369"
                     /db_xref="UniSTS:81911"
     variation       4164..4208
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace=""
                     /replace="cattt"
                     /db_xref="dbSNP:45614542"
     variation       4200..4240
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:45517437"
     variation       4205..4206
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace=""
                     /replace="tttca"
                     /db_xref="dbSNP:41516446"
     polyA_signal    4311..4316
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
     polyA_site      4338
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /experiment="experimental evidence, no additional details
                     recorded"
ORIGIN      
ggggcacactcatgcattcctgtcaagtcatcttgtgaaaggctgcctgcttccagcttggcttggatgtgcaaccttaataaaactcactgaggtctgggagaaaatagcagatctgcagcagatagggtagaggaaagggtctagaatatgtacacgcagctgactcaggcaggctccatgctgaacggtcacacagagaggaaacaataaatctcagctactatgcaataaatatctcaagttttaacgaagaaaaacatcattgcagtgaaataaaaaattttaaaattttagaacaaagctaacaaatggctagttttctatgattcttcttcaaacgctttctttgagggggaaagagtcaaacaaacaagcagttttacctgaaataaagaactagttttagaggtcagaagaaaggagcaagttttgcgagaggcacggaaggagtgtgctggcagtacaatgacagttttcctttcctttgctttcctcgctgccattctgactcacatagggtgcagcaatcagcgccgaagtccagaaaacagtgggagaagatataaccggattcaacatgggcaatgtgcctacactttcattcttccagaacacgatggcaactgtcgtgagagtacgacagaccagtacaacacaaacgctctgcagagagatgctccacacgtggaaccggatttctcttcccagaaacttcaacatctggaacatgtgatggaaaattatactcagtggctgcaaaaacttgagaattacattgtggaaaacatgaagtcggagatggcccagatacagcagaatgcagttcagaaccacacggctaccatgctggagataggaaccagcctcctctctcagactgcagagcagaccagaaagctgacagatgttgagacccaggtactaaatcaaacttctcgacttgagatacagctgctggagaattcattatccacctacaagctagagaagcaacttcttcaacagacaaatgaaatcttgaagatccatgaaaaaaacagtttattagaacataaaatcttagaaatggaaggaaaacacaaggaagagttggacaccttaaaggaagagaaagagaaccttcaaggcttggttactcgtcaaacatatataatccaggagctggaaaagcaattaaacagagctaccaccaacaacagtgtccttcagaagcagcaactggagctgatggacacagtccacaaccttgtcaatctttgcactaaagaaggtgttttactaaagggaggaaaaagagaggaagagaaaccatttagagactgtgcagatgtatatcaagctggttttaataaaagtggaatctacactatttatattaataatatgccagaacccaaaaaggtgttttgcaatatggatgtcaatgggggaggttggactgtaatacaacatcgtgaagatggaagtctagatttccaaagaggctggaaggaatataaaatgggttttggaaatccctccggtgaatattggctggggaatgagtttatttttgccattaccagtcagaggcagtacatgctaagaattgagttaatggactgggaagggaaccgagcctattcacagtatgacagattccacataggaaatgaaaagcaaaactataggttgtatttaaaaggtcacactgggacagcaggaaaacagagcagcctgatcttacacggtgctgatttcagcactaaagatgctgataatgacaactgtatgtgcaaatgtgccctcatgttaacaggaggatggtggtttgatgcttgtggcccctccaatctaaatggaatgttctatactgcgggacaaaaccatggaaaactgaatgggataaagtggcactacttcaaagggcccagttactccttacgttccacaactatgatgattcgacctttagatttttgaaagcgcaatgtcagaagcgattatgaaagcaacaaagaaatccggagaagctgccaggtgagaaactgtttgaaaacttcagaagcaaacaatattgtctcccttccagcaataagtggtagttatgtgaagtcaccaaggttcttgaccgtgaatctggagccgtttgagttcacaagagtctctacttggggtgacagtgctcacgtggctcgactatagaaaactccactgactgtcgggctttaaaaagggaagaaactgctgagcttgctgtgcttcaaactactactggaccttattttggaactatggtagccagatgataaatatggttaatttcatgtaaaacagaaaaaaagagtgaaaaagagaatatacatgaagaatagaaacaagcctgccataatcctttggaaaagatgtattataccagtgaaaaggtgttatatctatgcaaacctactaacaaattatactgttgcacaattttgataaaaatttagaacagcattgtcctctgagttggttaaatgttaatggatttcagaagcctaattccagtatcatacttactagttgatttctgcttacccatcttcaaatgaaaattccatttttgtaagccataatgaactgtagtacatggacaataagtgtgtggtagaaacaaactccattactctgatttttgatacagttttcagaaaaagaaatgaacataatcaagtaaggatgtatgtggtgaaaacttaccacccccatactatggttttcatttactctaaaaactgattgaatgatatataaatatatttatagcctgagtaaagttaaaagaatgtaaaatatatcatcaagttcttaaaataatatacatgcatttaatatttcctttgatattatacaggaaagcaatattttggagtatgttaagttgaagtaaaagcaagtactctggagcagttcattttacagtatctacttgcatgtgtatacatacatgtaacttcattattttaaaaatatttttagaactccaatactcaccctgttatgtcttgctaatttaaattttgctaattaactgaaacatgcttaccagattcacactgttccagtgtctataaaagaaacactttgaagtctataaaaaataaaataattataaatatcattgtacatagcatgtttatatctgcaaaaaacctaatagctaattaatctggaatatgcaacattgtccttaattgatgcaaataacacaaatgctcaaagaaatctactatatcccttaatgaaatacatcattcttcatatatttctccttcagtccattcccttaggcaatttttaatttttaaaaattattatcaggggagaaaaattggcaaaactattatatgtaagggaaatatatacaaaaagaaaattaatcatagtcacctgactaagaaattctgactgctagttgccataaataactcaatggaaatattcctatgggataatgtattttaagtgaatttttggggtgcttgaagttactgcattattttatcaagaagtcttctctgcctgtaagtgtccaaggttatgacagtaaacagtttttattaaaacatgagtcactatgggatgagaaaattgaaataaagctactgggcctcctctcataaaagagacagttgttggcaaggtagcaataccagtttcaaacttggtgacttgatccactatgccttaatggtttcctccatttgagaaaataaagctattcacattgttaagaaaaatactttttaaagtttaccatcaagtcttttttatatttatgtgtctgtattctacccctttttgccttacaagtgatatttgcaggtattataccatttttctattcttggtggcttcttcatagcaggtaagcctctccttctaaaaacttctcaactgttttcatttaagggaaagaaaatgagtattttgtccttttgtgttcctacagacactttcttaaaccagtttttggataaagaatactatttccaaactcatattacaaaaacaaaataaaataataaaaaaagaaagcatgatatttactgttttgttgtctgggtttgagaaatgaaatattgtttccaattatttataataaatcagtataaaatgttttatgattgttatgtgtattatgtaatacgtacatgtttatggcaatttaacatgtgtattcttttaattgtttcagaataggataattaggtattcgaattttgtctttaaaattcatgtggtttctatgcaaagttcttcatatcatcacaacattatttgatttaaataaaattgaaagtaatatttgtgcaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:284 -> Molecular function: GO:0030971 [receptor tyrosine kinase binding] evidence: IPI
            GeneID:284 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:284 -> Biological process: GO:0001936 [regulation of endothelial cell proliferation] evidence: IDA
            GeneID:284 -> Biological process: GO:0002040 [sprouting angiogenesis] evidence: IDA
            GeneID:284 -> Biological process: GO:0002092 [positive regulation of receptor internalization] evidence: IDA
            GeneID:284 -> Biological process: GO:0007162 [negative regulation of cell adhesion] evidence: IDA
            GeneID:284 -> Biological process: GO:0007171 [activation of transmembrane receptor protein tyrosine kinase activity] evidence: IDA
            GeneID:284 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:284 -> Biological process: GO:0010595 [positive regulation of endothelial cell migration] evidence: IDA
            GeneID:284 -> Biological process: GO:0014068 [positive regulation of phosphatidylinositol 3-kinase cascade] evidence: IEA
            GeneID:284 -> Biological process: GO:0014842 [regulation of satellite cell proliferation] evidence: IDA
            GeneID:284 -> Biological process: GO:0030097 [hemopoiesis] evidence: IEA
            GeneID:284 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA
            GeneID:284 -> Biological process: GO:0030210 [heparin biosynthetic process] evidence: IDA
            GeneID:284 -> Biological process: GO:0031398 [positive regulation of protein ubiquitination] evidence: IDA
            GeneID:284 -> Biological process: GO:0031589 [cell-substrate adhesion] evidence: IEA
            GeneID:284 -> Biological process: GO:0033138 [positive regulation of peptidyl-serine phosphorylation] evidence: IEA
            GeneID:284 -> Biological process: GO:0034394 [protein localization to cell surface] evidence: IDA
            GeneID:284 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IDA
            GeneID:284 -> Biological process: GO:0043116 [negative regulation of vascular permeability] evidence: IDA
            GeneID:284 -> Biological process: GO:0043536 [positive regulation of blood vessel endothelial cell migration] evidence: IDA
            GeneID:284 -> Biological process: GO:0045785 [positive regulation of cell adhesion] evidence: IEA
            GeneID:284 -> Biological process: GO:0048014 [Tie signaling pathway] evidence: IDA
            GeneID:284 -> Biological process: GO:0050731 [positive regulation of peptidyl-tyrosine phosphorylation] evidence: IDA
            GeneID:284 -> Biological process: GO:0050900 [leukocyte migration] evidence: TAS
            GeneID:284 -> Biological process: GO:0050918 [positive chemotaxis] evidence: IDA
            GeneID:284 -> Biological process: GO:0051897 [positive regulation of protein kinase B signaling cascade] evidence: IDA
            GeneID:284 -> Biological process: GO:0070374 [positive regulation of ERK1 and ERK2 cascade] evidence: IDA
            GeneID:284 -> Biological process: GO:0072012 [glomerulus vasculature development] evidence: ISS
            GeneID:284 -> Biological process: GO:2000352 [negative regulation of endothelial cell apoptotic process] evidence: IDA
            GeneID:284 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
            GeneID:284 -> Cellular component: GO:0005615 [extracellular space] evidence: IDA
            GeneID:284 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:284 -> Cellular component: GO:0005902 [microvillus] evidence: IDA
            GeneID:284 -> Cellular component: GO:0045121 [membrane raft] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.