GGRNA Home | Help | Advanced search

2020-10-24 07:05:46, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001145065            6205 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens coiled-coil serine-rich protein 1 (CCSER1), transcript
            variant 1, mRNA.
ACCESSION   NM_001145065
VERSION     NM_001145065.1  GI:222831646
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6205)
  AUTHORS   Luykx,J.J., Bakker,S.C., Lentjes,E., Neeleman,M., Strengman,E.,
            Mentink,L., Deyoung,J., de Jong,S., Sul,J.H., Eskin,E., van
            Eijk,K., van Setten,J., Buizer-Voskamp,J.E., Cantor,R.M., Lu,A.,
            van Amerongen,M., van Dongen,E.P., Keijzers,P., Kappen,T.,
            Borgdorff,P., Bruins,P., Derks,E.M., Kahn,R.S. and Ophoff,R.A.
  TITLE     Genome-wide association study of monoamine metabolite levels in
            human cerebrospinal fluid
  JOURNAL   Mol. Psychiatry (2013) In press
   PUBMED   23319000
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   2  (bases 1 to 6205)
  AUTHORS   Hart,A.B., Engelhardt,B.E., Wardle,M.C., Sokoloff,G., Stephens,M.,
            de Wit,H. and Palmer,A.A.
  TITLE     Genome-wide association study of d-amphetamine response in healthy
            volunteers identifies putative associations, including cadherin 13
            (CDH13)
  JOURNAL   PLoS ONE 7 (8), E42646 (2012)
   PUBMED   22952603
REFERENCE   3  (bases 1 to 6205)
  AUTHORS   Lantieri,F., Glessner,J.T., Hakonarson,H., Elia,J. and Devoto,M.
  TITLE     Analysis of GWAS top hits in ADHD suggests association to two
            polymorphisms located in genes expressed in the cerebellum
  JOURNAL   Am. J. Med. Genet. B Neuropsychiatr. Genet. 153B (6), 1127-1133
            (2010)
   PUBMED   20607790
  REMARK    GeneRIF: Two SNPs located in genes coding for as yet
            uncharacterized proteins expressed in the cerebellum, XKR4 in
            8q12.1, and FAM190A in 4q22.1 suggest association with association
            with attention deficit hyperactivity disorder. [FAM190A]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DB027029.1, AB051467.1 and AC110774.3.
            
            Transcript Variant: This variant (1) encodes the longer isoform
            (1).
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB051467.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-52                DB027029.1         1-52
            53-4316             AB051467.1         1-4264
            4317-6205           AC110774.3         57075-58963
FEATURES             Location/Qualifiers
     source          1..6205
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4q22.1"
     gene            1..6205
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /note="coiled-coil serine-rich protein 1"
                     /db_xref="GeneID:401145"
                     /db_xref="HGNC:29349"
     exon            1..299
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /inference="alignment:Splign:1.39.8"
     variation       37..38
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:142199213"
     variation       259
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187161303"
     variation       261
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190422682"
     exon            300..1664
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /inference="alignment:Splign:1.39.8"
     variation       318
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375470349"
     misc_feature    332..334
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /note="upstream in-frame stop codon"
     variation       335
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:28592243"
     variation       338
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200716258"
     CDS             341..3043
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /note="isoform 1 is encoded by transcript variant 1;
                     protein FAM190A; family with sequence similarity 190,
                     member A; serine-rich coiled-coil domain-containing
                     protein 1"
                     /codon_start=1
                     /product="serine-rich coiled-coil domain-containing
                     protein 1 isoform 1"
                     /protein_id="NP_001138537.1"
                     /db_xref="GI:222831647"
                     /db_xref="CCDS:CCDS47099.1"
                     /db_xref="GeneID:401145"
                     /db_xref="HGNC:29349"
                     /translation="
MGDSGSRRSTLVSRLPIFRRSINRRHDSLPSSPSSSNTVGVHSSSPSSTNSSSGSTGKRRSIFRTPSISFHHKKGSEPKQEPTNQNLSISNGAQPGHSNMQKLSLEEHIKTRGRHSVGFSSSRNKKITRSLTEDFEREKEHSTNKNVFINCLSSGKSEGDDSGFTEDQTRRSVKQSTRKLLPKSFSSHYKFSKPVLQSQSISLVQQSEFSLEVTQYQEREPVLVRASPSCSVDVTERAGSSLQSPLLSADLTTAQTPSEFLALTEDSVSEMDAFSKSGSMASHCDNFGHNDSTSQMSLNSAAVTKTTTELTGTVPCAIMSPGKYRLEGQCSTESNSLPETSAANQKEVLLQIAELPATSVSHSESNLPADSEREENIGLQNGETMLGTNSPRKLGFYEQHKAIAEHVKGIHPISDSKIIPTSGDHHIFNKTSHGYEANPAKVLASSLSPFREGRFIERRLRSSSEGTAGSSRMILKPKDGNIEEVNSLRKQRAGSSSSKMNSLDVLNNLGSCELDEDDLMLDLEFLEEQSLHPSVCREDSYHSVVSCAAVVLTPMEPMIEMKKREEPEFPEPSKQNLSLKLTKDVDQEARCSHISRMPNSPSADWPLQGVEENGGIDSLPFRLMLQDCTAVKTLLLKMKRVLQESADMSPASSTTSLPVSPLTEEPVPFKDIMKDECSMLKLQLKEKDELISQLQEELGKVRHLQKAFASRVDKSTQTELLCYDGLNLKRLETVQGGREATYRNRIVSQNLSTRDRKAIHTPTEDRFRYSAADQTSPYKNKTCQLPSLCLSNFLKDKELAEVIKHSRGTYETLTSDVTQNLRATVGQSSLKPTAKTEGLSTFLEKPKDQVATARQHSTFTGRFGQPPRGPISLHMYSRKNVFLHHNLHSTELQTLGQQDG
"
     variation       360
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199614921"
     variation       370
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200195268"
     variation       402
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368150393"
     variation       416
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371755465"
     variation       458
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192580573"
     variation       459
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76979602"
     variation       472
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34706417"
     variation       516
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200969775"
     variation       522
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184253075"
     variation       542
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369591675"
     variation       555
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373213361"
     variation       561
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377147993"
     variation       584
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370619679"
     variation       589
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373060209"
     variation       608
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377402944"
     variation       655
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371138602"
     variation       662
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200481128"
     variation       675
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368224537"
     variation       714
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142325447"
     variation       717
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371096921"
     variation       731
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76123304"
     variation       737
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:114592140"
     variation       851
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199696987"
     variation       971
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202076608"
     variation       1049
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200732825"
     variation       1054
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146032287"
     variation       1078
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375348353"
     variation       1099
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35038198"
     variation       1272
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372404975"
     variation       1273
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200529705"
     variation       1276
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369314240"
     variation       1284
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372893740"
     variation       1291
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377342558"
     variation       1292
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368884423"
     variation       1312
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34445159"
     variation       1321
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35057072"
     variation       1342
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371219201"
     variation       1344
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375167122"
     variation       1353
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202060801"
     variation       1354
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370616330"
     variation       1373
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374058079"
     variation       1384
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368109569"
     variation       1385
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72659490"
     variation       1398
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373844112"
     variation       1426
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372479561"
     variation       1435
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368828745"
     variation       1467
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372304488"
     variation       1476
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200176834"
     variation       1484
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12647859"
     variation       1510
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369643100"
     variation       1539
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191663649"
     variation       1551
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372007893"
     variation       1554
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200137337"
     variation       1568
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376784766"
     variation       1595
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202091224"
     variation       1598
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184476624"
     variation       1617
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111729858"
     variation       1618
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188755217"
     variation       1627
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369959947"
     variation       1659
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373458356"
     exon            1665..1849
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /inference="alignment:Splign:1.39.8"
     variation       1675
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187564848"
     variation       1701
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373593209"
     variation       1702
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367744361"
     variation       1769
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142352144"
     variation       1787
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200976407"
     variation       1798
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368916233"
     exon            1850..1943
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /inference="alignment:Splign:1.39.8"
     variation       1866
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35235945"
     variation       1938
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369051250"
     exon            1944..2064
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /inference="alignment:Splign:1.39.8"
     variation       1968
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370139962"
     variation       1973
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374464125"
     variation       1984
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182106294"
     variation       1987
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150977627"
     variation       2003
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187207325"
     exon            2065..2272
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /inference="alignment:Splign:1.39.8"
     variation       2070
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371946210"
     variation       2078
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375334932"
     variation       2089
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200539996"
     variation       2091
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368111669"
     variation       2127
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371365258"
     variation       2133
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201505045"
     variation       2143
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375966943"
     variation       2149
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369689377"
     variation       2177
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202243228"
     variation       2206
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369064746"
     variation       2239
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375090018"
     variation       2246
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369597376"
     variation       2250
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373209732"
     exon            2273..2350
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /inference="alignment:Splign:1.39.8"
     variation       2274
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200214194"
     variation       2313
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371145987"
     variation       2316
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376190647"
     variation       2322
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201489889"
     exon            2351..2434
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /inference="alignment:Splign:1.39.8"
     variation       2354
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61743906"
     variation       2374
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373571745"
     exon            2435..2512
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /inference="alignment:Splign:1.39.8"
     exon            2513..2557
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /inference="alignment:Splign:1.39.8"
     variation       2541
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76504638"
     exon            2558..6205
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /inference="alignment:Splign:1.39.8"
     variation       2649
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370719096"
     variation       2807
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199543790"
     variation       2849
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374138135"
     variation       2878
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377349774"
     variation       2901
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370398819"
     variation       3054
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374846974"
     variation       3108
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142684466"
     variation       3161
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:189219877"
     variation       3189
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72658064"
     variation       3201
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:62311870"
     variation       3246
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368053715"
     variation       3254
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:9991015"
     variation       3256
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181969780"
     variation       3262
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375859720"
     variation       3309
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140819001"
     variation       3319
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368349378"
     variation       3333
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10013578"
     variation       3502
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77808276"
     variation       3513
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186539249"
     variation       3521
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190716650"
     variation       3663
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372716124"
     variation       3701
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150133247"
     variation       3741
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377313809"
     variation       3776
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372980376"
     variation       3831
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181963575"
     variation       3833
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185203412"
     variation       3877
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10014070"
     variation       3899
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:57495859"
     variation       3910
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189627589"
     variation       3953
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182700147"
     variation       3977
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185435003"
     variation       3981
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191021457"
     variation       4036
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62311871"
     variation       4079
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:6841541"
     variation       4103
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147697678"
     variation       4171
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116651948"
     variation       4263
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183697283"
     variation       4284
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374737908"
     variation       4301
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116108384"
     variation       4317
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1516697"
     variation       4322
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188269688"
     variation       4426
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:62311872"
     variation       4434
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112360537"
     variation       4549
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142390777"
     variation       4589
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73836298"
     variation       4645
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192365520"
     variation       4791..4794
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace=""
                     /replace="tttc"
                     /db_xref="dbSNP:148742254"
     variation       4864
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78673189"
     variation       4974..4977
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace=""
                     /replace="atta"
                     /db_xref="dbSNP:144720566"
     variation       5134
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146363069"
     variation       5155
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183323025"
     variation       5158
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139023511"
     variation       5318
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35647723"
     variation       5341
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186910767"
     variation       5433
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73836299"
     variation       5466
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143349832"
     variation       5486..5487
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:376345641"
     variation       5561
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372471250"
     variation       5615
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1914240"
     variation       5656
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191426308"
     variation       5740
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143806543"
     variation       5895
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148159189"
     variation       5912
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369849530"
     variation       5930
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183623288"
     variation       5937
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187178477"
     STS             6025..6108
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /standard_name="1150"
                     /db_xref="UniSTS:28046"
     variation       6070..6071
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:148066440"
     variation       6076
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374024992"
     variation       6077
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192601124"
     variation       6083
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370280119"
     variation       6193
                     /gene="CCSER1"
                     /gene_synonym="FAM190A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72886336"
ORIGIN      
acaaatagtcgccgacctactgccaatccgcctctcctctctctctctctctgtctcaacatgactgactgggaagcggtggctcgggcagagcagctccgctggcgcaggcaggaggagcaggaggattattaaataacgcagctggactctgtgcaactgggagtggagaggagcccaacagccgagaaggggagggagggcagaggagggggaccaggaaggacacccccgtgccccgaagacataaatccctgagtgcccgggaggagccttaacaagcgcacggagccctcaaggctgcaaagttggctttcacagtgcaagcctttgattcccaatgggggactcaggatcaagacgatctaccctggtctcccggttgccaatattcagaagaagtattaacagaagacatgattctcttccttcttcaccttcttccagtaatacagttggtgtccacagttcctctccttccagcactaactcaagctcaggtagcacaggtaaacggaggagcatattccgtactccttccattagcttccaccataagaaggggagtgagcctaagcaagagcctaccaaccagaaccttagtatttcaaatggtgctcaacctggtcacagcaatatgcagaaactgagtttggaagaacatattaagaccaggggaagacattctgttggttttagtagttcacgaaataagaagataacaagatctttgacagaggattttgaaagggaaaaagagcactcaactaacaagaatgtctttataaattgtctaagttctggcaaaagtgaaggggatgattctggtttcacagaagaccaaactcgtcgttctgttaagcagtcaacaaggaagctactccctaaatctttttcatctcactataaattttctaagccagttctacagagccaatccatttcattggtacaacagtctgaattctcattggaagttacacagtaccaagagagagaacctgtattagtaagagcttcgccatcctgttctgtggatgtaacagaacgggcaggaagctctttacaatctcctttgctttctgctgatcttaccacagctcagacaccttcagaatttttagccttgactgaagattctgtgtctgaaatggatgcattttctaaaagtggaagcatggcatcccactgtgacaactttggccacaatgattctacctctcagatgtccctcaattctgctgctgttacaaagacaacaacagaacttacgggaactgttccctgtgcaattatgtctcctgggaaatataggttagagggtcaatgtagcactgaatctaattcattaccggaaacctctgctgctaatcagaaggaagtgttattacaaattgctgaactacctgctacaagtgtgagccactcagagagtaacctaccagcagatagtgaaagagaagaaaatatagggttacaaaatggtgaaacaatgctggggacaaactccccaaggaaacttggattttatgagcaacataaagcaatagcggaacatgtaaaagggatccatcctatttcagattcaaagataatacctacttctggtgatcatcatatttttaacaaaacatcacatggatatgaagcaaatcctgccaaagttcttgccagtagtctcagtccatttcgtgaaggaagatttatagagaggagactgcgatcctcgtcagaaggcactgcagggagtagcagaatgattttgaaaccgaaagatggaaatatagaagaagttaatagtttaagaaagcaaagagcaggttcttcatcttcaaaaatgaacagtttggatgttttgaataatttgggatcttgtgaactggatgaagatgatctaatgcttgatcttgaatttttagaggaacagagtcttcacccttctgtttgccgggaggactcatatcactctgtcgtctcatgtgccgcagtagttcttactcctatggaaccaatgatagaaatgaagaaaagagaagaaccagaatttcctgagccttccaaacagaatctttccctgaaattaacaaaggacgttgatcaagaagccaggtgttcccacatcagccgaatgcccaacagtccatctgcggattggcctctacaaggtgtggaagaaaacggaggcatagattctctgccattcagactgatgttacaggactgcacggcagtcaagacgttattattaaagatgaagagagttcttcaagagagtgcagacatgagtccagcaagcagtaccacgtcacttcctgttagtcctcttactgaagagccagtgcctttcaaggatataatgaaagatgaatgctcgatgctcaagctgcagctgaaagagaaggatgaactcatttcccaacttcaggaagagctgggaaaagtccggcatttacagaaggcttttgcttcaagagtagataaatccacacagactgaactactatgctatgatggtttaaacttgaaaagactagagacagtacaaggagggagagaggctacatatcgaaatcgaattgtgagccaaaatctcagcacaagggacagaaaagcaatacatactcccaccgaggaccgttttaggtattcggcagcggaccagacaagcccctacaaaaacaagacctgtcaactcccaagtctctgtttaagtaatttcctgaaggacaaggaactagcagaagttatcaaacattcaagaggaacttatgaaaccctcacttcagacgttacacagaacttacgggccaccgttgggcagagctctctgaagccaacagctaagacagaagggctctccacgttcttagagaaaccaaaggaccaagttgctacggcccgacagcattcgacctttacaggcaggtttggacagccacccagagggccaatctctttacacatgtacagcaggaagaatgtgtttctccaccacaatttacacagcactgagctgcaaactctaggccagcaggatgggtaattaaatcaccgtattcctgtctttgggtaggataaagatggttagtgtttctcgtgcatagttcatattaaaattgtcatgtactttttcttacattttagttataaacagagttgtgttgttgggttttttttcttagtcataaacaaagacttgtgggttttttttttccaagagtgaaagtttgagcatgttaattgaactaggttgcattgccttgaagactttactatataggtgtataataaatgggaccatcatgatcgtttatatagtccataatttatttattttttatctctatcacttactgatatgcattaaggtttcagaagataatatcaaatagcaatctgttcactgttaatggtgttactataaaagtagacctgatgaaaaatagataaaggaattataaagaattttaaattatataattaatagaaggaggaaaaaagagaaatgttaacgtcttatatttggtggtatatttatttgaagaatgtggcttgcttgcatgtaacctagagatgtgtttgtctctattacatacattcaagctcatcttgtgatactagtaagggggaaatggctgtattttttttcctttaaacgtttagttcatactagttcacaaaggatttcagacagagtaattgctagccaaatagagaatgacagctctgatctttgaaaaattttgcttttagtttttgttattgatgttgaagtaccgtgacataacacaaggtgataaagttggttgaattttgtcagatgatgcataaatactgacatgctatattctttgagccactgtcatggcaatataaacattttttcaaaatttcaaggatgaaacatcctaagaaaattattctttttctttactttccttattttttaaaatgttcttttttatgtaaatccaattttggtttatatacatcaacccatatctataattttatgaactgaagaacagaaagtcagtattttagtagccagcatacaatattctgactatgcagaaatctagatttggaacaaaagtaaagtaaatgtgaacattggcaatttaatcttagaaataagcttctaacaggaatatttaaaacccatttgatggcaaatatttctctttgacaaataaggcccaaatatgttataatatgttatatacttatgtgcactttagatcaatatatgaattgatctatggataattccatcatgttcaattagtagcagagcagaatcaaagagtacaattgaatacataaataaataatttttaaaagactaataggaatcaaggctgcagttttcttatacacatcagagctgttaagtacatccacattagccatagtccatgcaaattgaaactgtcatacctactgcatgatctgtttcccttgcattttctaacagaatctgtcagcgtgcacaagcaagatgaacaaagggaaattgagatagcagttttagcatggcatctgacaacttgcttaaattaaagctgtgtgcaaaatgcatctcctattataaaaatgtatttgtgccctgtgctttggggaaaagccattagacactccacccctgagctttaactactgaactttgatacatttgcaaacttagattggaactgataaagtaaggagtcgagtggatatgttgtacttgtaattttggttttccaaaggaacacacatgtgcatcaaggcagacatttgccaaatgttttctttctttgcgtgtttgtaattctgccaaaagagaacaatatacactgcaaattgcttgacttaatgagattgccatctaaagttcccaccatactttggaagctataatgatcatgcagatatacactttgggctgggcaatatttaagaaatgataggaaaatagaaaaatcatgattattaattgtggaattcagcttgatttgtcctaaatgttggtgtctgttgctagagtattttaaatctgtacataaataagcatgataaaataatcaaggattttttcccaggatatggaagaactatgtatcacaaataatgtttttgatttggacttttggagttgatagttttgttttcctggaagatagacttttgaattatactttataaaaataatctatttatagaagatctgtcatttaatagacattttaagagatgttttaaacgctagtattttcttgaaaaatcttttttaaagctgaatcattcaaaagaaaacctggattaaacagttcgattttaaaaggaagggtattttttggaaatatcatcttaaagctgttttgtatcagtattttcaacattgttataatattatttgtaatactaagtgtaactcaggcctggagaaggtgtaagcccactatgctaatgtacatcagtaactgtaaaacaggggttctttgtaagttcctcttgtgtatatatagtaacttataacaatggcatgtgggcattctttcagtgaattgctttctttgtactaaaatctctagttttctaagacagttccatgtataaaaatgatttatgcatttctccaaggcggtacatatccaaagacatgacaccagggggaaaaagtgcttgtttttctgatggaagcagtggtcttttcttttctttcctctttcttttgtgcatgtgtatgtgtagctaagcctaaataaccctgtaaaatttctgctgcaaattgtctcttctgaatttagaatgtgttttaaaggaacacttaggaagagaaataccttgaagaaaagctgtttccacctgaaataaactgttcccatttttataattattggaacatgaaactgtatttctatgaactcaatgatttttttccataaaattatatgctaagagagtcaccacaaaactatgaattctctcccgaattatttttgcttctttggagcaccatagtctttgttcaaatcacaacatgaaactgttgctgcaatgctaaagatgtgaatccaccactatcaatacggtcagggtaaaacctggagccacatgttattcaagttatttttgttatctaatgattgacatgaaaataaaatagtaagccaatattaatttgtaggcatagttgccccacttaaagtgtttacaaaga
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.