2024-04-19 15:58:12, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001142502 3122 bp mRNA linear PRI 21-APR-2013 DEFINITION Homo sapiens protein phosphatase 1, regulatory subunit 13 like (PPP1R13L), transcript variant 1, mRNA. ACCESSION NM_001142502 VERSION NM_001142502.1 GI:215820634 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3122) AUTHORS Chae,Y.S., Kim,J.G., Kang,B.W., Lee,S.J., Jeon,H.S., Park,J.S., Choi,G.S. and Lee,W.K. TITLE PPP1R13L variant associated with prognosis for patients with rectal cancer JOURNAL J. Cancer Res. Clin. Oncol. 139 (3), 465-473 (2013) PUBMED 23180017 REMARK GeneRIF: The PPP1R13L rs1970764 variant is a possible prognostic marker for patients with rectal cancer. REFERENCE 2 (bases 1 to 3122) AUTHORS Skene-Arnold,T.D., Luu,H.A., Uhrig,R.G., De Wever,V., Nimick,M., Maynes,J., Fong,A., James,M.N., Trinkle-Mulcahy,L., Moorhead,G.B. and Holmes,C.F. TITLE Molecular mechanisms underlying the interaction of protein phosphatase-1c with ASPP proteins JOURNAL Biochem. J. 449 (3), 649-659 (2013) PUBMED 23088536 REMARK GeneRIF: When the Px(T)PxR motif is deleted or mutated via insertion of a phosphorylation site mimic (T311D), PP-1c fails to bind to all three ASPP proteins, ASPP1, ASPP2 and iASPP. REFERENCE 3 (bases 1 to 3122) AUTHORS Wang,L., Xing,H., Tian,Z., Peng,L., Li,Y., Tang,K., Rao,Q., Wang,M. and Wang,J. TITLE iASPPsv antagonizes apoptosis induced by chemotherapeutic agents in MCF-7 cells and mouse thymocytes JOURNAL Biochem. Biophys. Res. Commun. 424 (3), 414-420 (2012) PUBMED 22766503 REMARK GeneRIF: These findings showed that iAPSS/iASPPsv reduced the growth inhibition and apoptosis induced by Dex or VP-16, with DNA damage accumulating which might promote the pathogenesis and/or progression of cancer. REFERENCE 4 (bases 1 to 3122) AUTHORS Cai,Y., Qiu,S., Gao,X., Gu,S.Z. and Liu,Z.J. TITLE iASPP inhibits p53-independent apoptosis by inhibiting transcriptional activity of p63/p73 on promoters of proapoptotic genes JOURNAL Apoptosis 17 (8), 777-783 (2012) PUBMED 22538442 REMARK GeneRIF: iASPP inhibited apoptosis independently of p53 in tumor cells, mainly by inhibiting the transcriptional activity of p63/p73 on the promoters of proapoptotic genes REFERENCE 5 (bases 1 to 3122) AUTHORS Li,S., Shi,G., Yuan,H., Zhou,T., Zhang,Q., Zhu,H. and Wang,X. TITLE Abnormal expression pattern of the ASPP family of proteins in human non-small cell lung cancer and regulatory functions on apoptosis through p53 by iASPP JOURNAL Oncol. Rep. 28 (1), 133-140 (2012) PUBMED 22552744 REMARK GeneRIF: Downregulation of iASPP by siRNA stimulated apoptosis through p53 in two non-small cell lung cancer cell lines REFERENCE 6 (bases 1 to 3122) AUTHORS Slee,E.A., Gillotin,S., Bergamaschi,D., Royer,C., Llanos,S., Ali,S., Jin,B., Trigiante,G. and Lu,X. TITLE The N-terminus of a novel isoform of human iASPP is required for its cytoplasmic localization JOURNAL Oncogene 23 (56), 9007-9016 (2004) PUBMED 15489900 REFERENCE 7 (bases 1 to 3122) AUTHORS Colland,F., Jacq,X., Trouplin,V., Mougin,C., Groizeleau,C., Hamburger,A., Meil,A., Wojcik,J., Legrain,P. and Gauthier,J.M. TITLE Functional proteomics mapping of a human signaling pathway JOURNAL Genome Res. 14 (7), 1324-1332 (2004) PUBMED 15231748 REFERENCE 8 (bases 1 to 3122) AUTHORS Bergamaschi,D., Samuels,Y., O'Neil,N.J., Trigiante,G., Crook,T., Hsieh,J.K., O'Connor,D.J., Zhong,S., Campargue,I., Tomlinson,M.L., Kuwabara,P.E. and Lu,X. TITLE iASPP oncoprotein is a key inhibitor of p53 conserved from worm to human JOURNAL Nat. Genet. 33 (2), 162-167 (2003) PUBMED 12524540 REFERENCE 9 (bases 1 to 3122) AUTHORS Takada,N., Sanda,T., Okamoto,H., Yang,J.P., Asamitsu,K., Sarol,L., Kimura,G., Uranishi,H., Tetsuka,T. and Okamoto,T. TITLE RelA-associated inhibitor blocks transcription of human immunodeficiency virus type 1 by inhibiting NF-kappaB and Sp1 actions JOURNAL J. Virol. 76 (16), 8019-8030 (2002) PUBMED 12134007 REMARK GeneRIF: Effect of RAI on transcription and replication of human immunodeficiency virus type 1 (HIV-1). REFERENCE 10 (bases 1 to 3122) AUTHORS Yang,J.P., Hori,M., Sanda,T. and Okamoto,T. TITLE Identification of a novel inhibitor of nuclear factor-kappaB, RelA-associated inhibitor JOURNAL J. Biol. Chem. 274 (22), 15662-15670 (1999) PUBMED 10336463 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from DB209153.1, BC064913.1 and AC092309.3. Summary: IASPP is one of the most evolutionarily conserved inhibitors of p53 (TP53; MIM 191170), whereas ASPP1 (MIM 606455) and ASPP2 (MIM 602143) are activators of p53.[supplied by OMIM, Mar 2008]. Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC064913.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025088 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-37 DB209153.1 1-37 38-670 BC064913.1 1-633 671-691 AC092309.3 30266-30286 c 692-3118 BC064913.1 655-3081 3119-3122 AC092309.3 13255-13258 c FEATURES Location/Qualifiers source 1..3122 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="19" /map="19q13.32" gene 1..3122 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /note="protein phosphatase 1, regulatory subunit 13 like" /db_xref="GeneID:10848" /db_xref="HGNC:18838" /db_xref="MIM:607463" exon 1..58 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" exon 59..134 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" CDS 80..2566 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /note="retinoic acid induced 4; NFkB interacting protein 1; inhibitor of apoptosis stimulating protein of p53; protein iASPP; PPP1R13B-like protein; inhibitor of ASPP protein; NFkB-interacting protein 1; protein phosphatase 1, regulatory (inhibitor) subunit 13 like" /codon_start=1 /product="relA-associated inhibitor" /protein_id="NP_001135974.1" /db_xref="GI:215820635" /db_xref="CCDS:CCDS33050.1" /db_xref="GeneID:10848" /db_xref="HGNC:18838" /db_xref="MIM:607463" /translation="
MDSEAFQSARDFLDMNFQSLAMKHMDLKQMELDTAAAKVDELTKQLESLWSDSPAPPGPQAGPPSRPPRYSSSSIPEPFGSRGSPRKAATDGADTPFGRSESAPTLHPYSPLSPKGRPSSPRTPLYLQPDAYGSLDRATSPRPRAFDGAGSSLGRAPSPRPGPGPLRQQGPPTPFDFLGRAGSPRGSPLAEGPQAFFPERGPSPRPPATAYDAPASAFGSSLLGSGGSAFAPPLRAQDDLTLRRRPPKAWNESDLDVAYEKKPSQTASYERLDVFARPASPSLQLLPWRESSLDGLGGTGKDNLTSATLPRNYKVSPLASDRRSDAGSYRRSLGSAGPSGTLPRSWQPVSRIPMPPSSPQPRGAPRQRPIPLSMIFKLQNAFWEHGASRAMLPGSPLFTRAPPPKLQPQPQPQPQPQSQPQPQLPPQPQTQPQTPTPAPQHPQQTWPPVNEGPPKPPTELEPEPEIEGLLTPVLEAGDVDEGPVARPLSPTRLQPALPPEAQSVPELEEVARVLAEIPRPLKRRGSMEQAPAVALPPTHKKQYQQIISRLFHRHGGPGPGGPEPELSPITEGSEARAGPPAPAPPAPIPPPAPSQSSPPEQPQSMEMRSVLRKAGSPRKARRARLNPLVLLLDAALTGELEVVQQAVKEMNDPSQPNEEGITALHNAICGANYSIVDFLITAGANVNSPDSHGWTPLHCAASCNDTVICMALVQHGAAIFATTLSDGATAFEKCDPYREGYADCATYLADVEQSMGLMNSGAVYALWDYSAEFGDELSFREGESVTVLRRDGPEETDWWWAALHGQEGYVPRNYFGLFPRVKPQRSKV
" misc_feature 383..385 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 407..409 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 416..418 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 434..436 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 437..439 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 446..448 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 479..481 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 626..628 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 638..640 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 686..688 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 917..919 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 1025..1027 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 1073..1075 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 1655..1657 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 1778..1780 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 1868..1870 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); phosphorylation site" misc_feature 1991..2323 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /note="ankyrin repeats; ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204" /db_xref="CDD:29261" misc_feature 1991..2245 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:205076" misc_feature 2054..2152 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); Region: ANK 1" misc_feature 2153..2251 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q8WUF5.4); Region: ANK 2" misc_feature 2360..2530 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /note="Src Homology 3 (SH3) domain of Inhibitor of ASPP protein (iASPP); Region: SH3_iASPP; cd11952" /db_xref="CDD:212885" misc_feature order(2384..2386,2393..2398,2402..2407,2459..2464, 2468..2473,2504..2506,2510..2512,2516..2518) /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /note="p53 binding site [polypeptide binding]; other site" /db_xref="CDD:212885" exon 135..277 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" variation 241 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /replace="c" /replace="t" /db_xref="dbSNP:35414341" exon 278..791 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" variation 769 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /replace="c" /replace="t" /db_xref="dbSNP:34843313" exon 792..890 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" exon 891..982 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" exon 983..1433 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" exon 1434..1894 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" exon 1895..2026 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" exon 2027..2160 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" exon 2161..2327 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" variation 2185 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /replace="a" /replace="g" /db_xref="dbSNP:35566234" exon 2328..2527 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" exon 2528..3122 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /inference="alignment:Splign:1.39.8" variation 2808 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /replace="c" /replace="t" /db_xref="dbSNP:35812347" STS 2835..3003 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /standard_name="STS-W67936" /db_xref="UniSTS:11944" variation 3052 /gene="PPP1R13L" /gene_synonym="IASPP; NKIP1; RAI; RAI4" /replace="a" /replace="t" /db_xref="dbSNP:6966" ORIGIN
cttcctaagccttaaagagacaggacggtcgattggtctgaaattcttgaagagacaggcgcccgctccggccggcaccatggacagcgaggcattccagagcgcgcgggactttctggacatgaacttccagtcgctggccatgaaacacatggatctgaagcagatggagctggacacggcggcggccaaggtggatgaactgaccaagcagctggagtcgctgtggtcagactctcccgcgcctcctggcccgcaggccggacccccttctaggccgccccggtacagctccagctcgatccctgagcccttcggcagccgagggtccccccggaaggcggccaccgacggcgcagacaccccgttcggacgatcagagagtgccccaaccctacacccctacagcccgctgtcccccaagggacggccgtcgtcgccgcgcaccccgctctacctgcagccggacgcctacggcagcctggaccgcgcgacctcgccccggccccgcgccttcgatggcgcaggcagctccctcggccgtgcgccctccccgcggcccgggccaggcccgctccgccagcagggtccccccacgcctttcgacttcctgggccgcgcaggctccccccgcggcagccccctggcggaggggccccaggccttcttccccgagcgtgggccgtcaccgcgcccccctgccacagcctacgacgcgccagcgtccgccttcgggagctccctgctaggctccggcggcagcgcattcgccccgcctctgcgcgcgcaagacgacctgacgctgcgccggcggcctccgaaagcctggaacgagtctgacctggacgtggcgtacgagaagaagccttcgcagacagcgagctatgaacgcctggacgtcttcgcaaggcctgcctcgccgagcctgcagctgttgccttggagggagagcagcctggatggactggggggcaccggcaaggacaacctcactagcgccaccctgccgcgcaattacaaggtctctcctctggccagcgaccggcgttcagacgcgggcagctaccggcgctcgctgggctccgcggggccgtcgggcactttgcctcgcagctggcagcccgtcagccgcatccccatgcccccctccagcccccagccccgcggggccccgcgccagcgtcccatccccctcagcatgatcttcaagctgcagaacgccttctgggagcacggggccagccgcgccatgctccctgggtcccccctcttcacccgagcacccccgcctaagctgcagccccaaccacaaccacagccccagccacaatcacaaccacagccccagctgcccccacagccccagacccaaccccaaacccctaccccagccccccagcatccccaacagacatggccccctgtgaacgaaggaccccccaaaccccccaccgagctggagcctgagccggagatagaggggctgctgacaccagtgctggaggctggcgatgtggatgaaggccctgtagcaaggcctctcagccccacgaggctgcagccagcactgccaccggaggcacagtcggtgcccgagctggaggaggtggcacgggtgttggcggaaattccccggcccctcaaacgcaggggctccatggagcaggcccctgctgtggccctgccccctacccacaagaaacagtaccagcagatcatcagccgcctcttccatcgtcatggggggccagggcccggggggccggagccagagctgtcccccatcactgagggatctgaggccagggcagggccccctgctcctgccccaccagctcccattccacccccggccccgtcccagagcagcccaccagagcagccgcagagcatggagatgcgctctgtgctgcggaaggcgggctccccgcgcaaggcccgccgcgcgcgcctcaaccctctggtgctcctcctggacgcggcgctgaccggggagctggaggtggtgcagcaggcggtgaaggagatgaacgacccgagccagcccaacgaggagggcatcactgccttgcacaacgccatctgcggcgccaactactctatcgtggatttcctcatcaccgcgggtgccaatgtcaactcccccgacagccacggctggacacccttgcactgcgcggcgtcgtgcaacgacacagtcatctgcatggcgctggtgcagcacggcgctgcaatcttcgccaccacgctcagcgacggcgccaccgccttcgagaagtgcgacccttaccgcgagggttatgctgactgcgccacctacctggcagacgtcgagcagagtatggggctgatgaacagcggggcagtgtacgctctctgggactacagcgccgagttcggggacgagctgtccttccgcgagggcgagtcggtcaccgtgctgcggagggacgggccggaggagaccgactggtggtgggccgcgctgcacggccaggagggctacgtgccgcggaactacttcgggctgttccccagggtgaagcctcaaaggagtaaagtctagcaggatagaaggaggtttctgaggctgacagaaacaagcattcctgccttccctccagacctctccctctgttttttgctgcctttatctgcacccctcaccctgctggtggtggtccttgccaccggttctctgttctcctggaagtccagggaagaaggagggccccagccttaaatttagtaatctgccttagccttgggaggtctgggaagggctggaaatcactggggacaggaaaccacttccttttgccaaatcagatcccgtccaaagtgcctcccatgcctaccaccatcatcacatcccccagcaagccagccacctgcccagccgggcctgggatgggccaccacaccactggatattcctgggagtcactgctgacaccatctctcccagcagtcttggggtctgggtgggaaacattggtctctaccaggatccctgccccacctctccccaattaagtgccttcacacagcactggtttaatgtttataaacaaaatagagaaactttccttataaataaaagtagtttgcacagaaattga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:10848 -> Molecular function: GO:0003714 [transcription corepressor activity] evidence: TAS GeneID:10848 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:10848 -> Molecular function: GO:0008134 [transcription factor binding] evidence: TAS GeneID:10848 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA GeneID:10848 -> Biological process: GO:0003215 [cardiac right ventricle morphogenesis] evidence: IEA GeneID:10848 -> Biological process: GO:0003229 [ventricular cardiac muscle tissue development] evidence: IEA GeneID:10848 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:10848 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:10848 -> Biological process: GO:0009791 [post-embryonic development] evidence: IEA GeneID:10848 -> Biological process: GO:0031076 [embryonic camera-type eye development] evidence: IEA GeneID:10848 -> Biological process: GO:0035264 [multicellular organism growth] evidence: IEA GeneID:10848 -> Biological process: GO:0042633 [hair cycle] evidence: IEA GeneID:10848 -> Biological process: GO:0048871 [multicellular organismal homeostasis] evidence: IEA GeneID:10848 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IEA GeneID:10848 -> Cellular component: GO:0005634 [nucleus] evidence: IEA GeneID:10848 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.