GGRNA Home | Help | Advanced search

2019-03-23 03:30:36, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001137671            2243 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens POTE ankyrin domain family, member C (POTEC), mRNA.
ACCESSION   NM_001137671 XM_496269
VERSION     NM_001137671.1  GI:212549545
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2243)
  AUTHORS   Bera,T.K., Zimonjic,D.B., Popescu,N.C., Sathyanarayana,B.K.,
            Kumar,V., Lee,B. and Pastan,I.
  TITLE     POTE, a highly homologous gene family located on numerous
            chromosomes and expressed in prostate, ovary, testis, placenta, and
            prostate cancer
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16975-16980 (2002)
   PUBMED   12475935
  REMARK    Erratum:[Proc Natl Acad Sci U S A. 2003 Feb 4;100(3):1462]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AP006261.1.
            On Nov 14, 2008 this sequence version replaced gi:169212681.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025084, ERS025088
                              [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-975               AP006261.1         153222-154196       c
            976-1090            AP006261.1         148731-148845       c
            1091-1264           AP006261.1         148397-148570       c
            1265-1371           AP006261.1         145497-145603       c
            1372-1509           AP006261.1         143657-143794       c
            1510-1580           AP006261.1         141079-141149       c
            1581-1651           AP006261.1         135509-135579       c
            1652-1696           AP006261.1         134059-134103       c
            1697-1863           AP006261.1         132850-133016       c
            1864-1987           AP006261.1         124258-124381       c
            1988-2243           AP006261.1         122334-122589       c
FEATURES             Location/Qualifiers
     source          1..2243
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18p11.21"
     gene            1..2243
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /note="POTE ankyrin domain family, member C"
                     /db_xref="GeneID:388468"
                     /db_xref="HGNC:33894"
     exon            1..975
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(19)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:112757192"
     variation       complement(29)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112098966"
     variation       complement(30)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202020811"
     variation       complement(40)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113330263"
     variation       complement(72)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200162188"
     variation       complement(96)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56077734"
     variation       complement(123)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372286696"
     variation       complement(148)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:28695525"
     variation       complement(179)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145096970"
     variation       complement(203)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372429458"
     variation       complement(238)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:117130379"
     variation       complement(286)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373560886"
     variation       complement(374)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45604938"
     variation       complement(419)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374959733"
     variation       complement(436)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370435544"
     variation       complement(438)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:367913261"
     variation       complement(438)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201982241"
     variation       complement(439)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:45446896"
     misc_feature    446..448
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /note="upstream in-frame stop codon"
     CDS             455..2083
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /note="cancer/testis antigen family 104, member 6;
                     ANKRD26-like family B, member 2; ANKRD26-like family B
                     member 2; prostate, ovary, testis-expressed protein on
                     chromosome 18"
                     /codon_start=1
                     /product="POTE ankyrin domain family member C"
                     /protein_id="NP_001131143.1"
                     /db_xref="GI:212549546"
                     /db_xref="CCDS:CCDS45835.1"
                     /db_xref="GeneID:388468"
                     /db_xref="HGNC:33894"
                     /translation="
MVTEVCSMPAASAVKKPFDLRSKMGKWFHHRFPCCKGSGKSNMGTSGDHDDSFMKMLRSKMGKCCHHCFPCCRGSGTSNVGTSGDHDNSFMKTLRSKMGKWCCHCFPCCRGSGKSNVGAWGDYDDSAFMEPRYHVRREDLDKLHRAAWWGKVPRKDLIVMLRDTDMNKRDKQKRTALHLASANGNSEVVQLLLDRRCQLNVLDNKKRTALIKAVQCQEDECVLMLLEHGADQNIPDEYGNTTLHYAVHNEDKLMAKALLLYGADIESKNKCGLTPLLLGVHEQKQQVVKFLIKKKANLNALDRYGRTALILAVCCGSASIVNLLLEQNVDVSSQDLSGQTAREYAVSSHHHVICELLSDYKEKQMLKISSENSNPEQDLKLTSEEESQRLKVSENSQPEKMSQEPEINKDCDREVEEEIKKHGSNPVGLPENLTNGASAGNGDDGLIPQRRSRKPENQQFPDTENEEYHSDEQNDTRKQLSEEQNTGISQDEILTNKQKQIEVAEKKMNSELSLSHKKEEDLLRENSMLQEEIAMLISGDWN
"
     misc_feature    866..967
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (B2RU33.2);
                     Region: ANK 1"
     misc_feature    881..1033
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /note="Ankyrin repeats (many copies); Region: Ank_4;
                     pfam13637"
                     /db_xref="CDD:205814"
     misc_feature    953..1330
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    968..1057
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (B2RU33.2);
                     Region: ANK 2"
     misc_feature    983..1261
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    1067..1156
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (B2RU33.2);
                     Region: ANK 3"
     misc_feature    1151..1525
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    1166..1255
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (B2RU33.2);
                     Region: ANK 4"
     misc_feature    1181..1459
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    1265..1354
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (B2RU33.2);
                     Region: ANK 5"
     misc_feature    1364..1453
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (B2RU33.2);
                     Region: ANK 6"
     misc_feature    1463..1573
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (B2RU33.2);
                     Region: ANK 7"
     variation       complement(461)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28535987"
     variation       complement(482)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45488295"
     variation       complement(491)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45561536"
     variation       complement(502)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11873462"
     variation       complement(508)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45502401"
     variation       complement(509)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367762014"
     variation       complement(537)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:45626231"
     variation       complement(538)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45469106"
     variation       complement(543)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:9807633"
     variation       complement(561)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45570841"
     variation       complement(621)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200806970"
     variation       complement(651)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9807555"
     variation       complement(669)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45554841"
     variation       complement(691)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370268513"
     variation       complement(710)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:45469098"
     variation       complement(716)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201764782"
     variation       complement(733)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200779556"
     variation       complement(754)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375344447"
     variation       complement(791)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113041483"
     variation       complement(802)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368540688"
     variation       complement(809)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201849570"
     variation       complement(825)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201022558"
     variation       complement(841)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139820506"
     variation       complement(842)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145930826"
     variation       complement(857)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199534334"
     variation       complement(888)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187147526"
     variation       complement(907)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371316587"
     variation       complement(912)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181229726"
     variation       complement(922)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200619407"
     variation       complement(924)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368940627"
     variation       complement(952)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12454500"
     exon            976..1090
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /inference="alignment:Splign:1.39.8"
     exon            1091..1264
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1093)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6650619"
     variation       complement(1094)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148283099"
     variation       complement(1102)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191178152"
     variation       complement(1115)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7505568"
     variation       complement(1141)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373166777"
     variation       complement(1142)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201891428"
     variation       complement(1160)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377575358"
     variation       complement(1198)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114980174"
     variation       complement(1205)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369818798"
     exon            1265..1371
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /inference="alignment:Splign:1.39.8"
     exon            1372..1509
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1426)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3852656"
     variation       complement(1464)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199815986"
     variation       complement(1485)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202042216"
     exon            1510..1580
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /inference="alignment:Splign:1.39.8"
     exon            1581..1651
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1597)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:8089144"
     variation       complement(1604)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201278417"
     variation       complement(1607)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149536586"
     variation       complement(1614)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374882920"
     exon            1652..1696
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /inference="alignment:Splign:1.39.8"
     exon            1697..1863
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1806)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138457194"
     exon            1864..1987
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1867)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79514853"
     variation       complement(1868)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200260389"
     variation       complement(1884)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79575795"
     variation       complement(1884)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201788045"
     variation       complement(1889)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200480085"
     variation       complement(1921)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201717447"
     variation       complement(1970)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:28606506"
     variation       complement(1972)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372915751"
     variation       complement(1973)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371810308"
     variation       complement(1985)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369185563"
     variation       complement(1985)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1949282"
     exon            1988..2243
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2025)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370898161"
     variation       complement(2036)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:71362458"
     variation       complement(2192)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200065547"
     variation       complement(2210)
                     /gene="POTEC"
                     /gene_synonym="A26B2; CT104.6; POTE-18; POTE18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201926352"
ORIGIN      
ataacggcttggcttacctgtaacgggtacgcttcgctttgcgttcctcgcttggccttgcgttcctagcttggcttggcgttagtcgctttgcctggtgtttcttgcttggattggcgtttcctccctcgcattcctttgctgggcttgactttttctctgctgggtttggcattcccttgactgggctgggtgtttccttgggagggggggcttggcctttcctggggtgggcgttgggtccccctggtgggcgtgggctttccccgggtgggtgtgggttttccctgggtggggtggactgggctcccttgctggggttggcaagttttggctgggattgacctttctcttcaaacagattggaaacccagggtttcctgctagttggtgaaactggttggtagacgcgatctgttcgctactaccggcctccccgggctgttaaaagcagatggtgactgaggtttgttcaatgcccgctgcctctgctgtgaagaagccattcgatctcaggagcaagatgggcaagtggtttcaccaccgcttcccctgctgcaaggggagcggcaagagcaacatgggcacttctggagaccacgacgactcctttatgaagatgctcaggagcaagatgggcaagtgttgccaccactgcttcccctgctgcagggggagcggcacgagcaacgtgggcacttctggagaccatgacaactcctttatgaagacgctcaggagcaagatgggcaagtggtgctgtcactgcttcccctgctgcagggggagcggcaagagcaacgtgggcgcttggggagactacgacgacagcgccttcatggagccgaggtaccacgtccgtcgagaagatctggacaagctccacagagctgcctggtggggtaaggtccccagaaaggatctcatcgtcatgctcagggacacggacatgaacaagagggacaagcaaaagaggactgctctacatttggcctctgccaatggaaattcagaagtagtacaactcctgctggacagacgatgtcaacttaatgtccttgacaacaaaaaaaggacagctctgataaaggccgtacaatgccaggaagatgaatgtgtgttaatgttgctggaacatggcgctgatcaaaatattccagatgagtatggaaataccactctacactatgctgtccacaatgaagataaattaatggccaaagcactgctcttatatggtgctgatattgaatcaaaaaacaagtgtggcctcacaccacttttgcttggcgtacatgaacaaaaacagcaagtggtgaaatttttaatcaagaaaaaagctaatttaaatgcacttgatagatatggaagaactgccctcatacttgctgtatgttgtggatcagcaagtatagtcaatcttctccttgagcaaaatgttgatgtatcttctcaagatctatctggacagacggccagagagtatgctgtttctagtcatcatcatgtaatttgtgaattactttctgactataaagaaaaacagatgctaaaaatctcttctgaaaacagcaatccagaacaagacttaaagctaacatcagaggaagagtcacaaaggcttaaagtcagtgaaaatagccagccagagaaaatgtctcaagaaccagaaataaataaggactgtgatagagaggttgaagaagaaataaagaagcatggaagtaatcctgtgggattaccagaaaacctgactaatggtgccagtgctggcaatggtgatgatggattaattccacaaaggaggagcagaaaacctgaaaatcagcaatttcctgacactgagaatgaagagtatcacagtgacgaacaaaatgatacccggaaacaactttctgaagaacagaacactggaatatcacaagatgagattctgactaataaacaaaagcagatagaagtggctgaaaagaaaatgaattctgagctttctcttagtcataagaaagaagaagatctcttgcgtgaaaacagcatgttgcaggaagaaattgccatgctaatttctggagactggaactagatgaaacaaaacatcagaaccagctaagggaaaataaaattttggaggaaattgaaagtgtgaaagaaaagactgataaacttctaagggctatgcaattgaatgaagaagcattaacgaaaaccaatatttaagtacagtggacagcttaggattttga
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.