Home |
Help |
Advanced search
2024-04-27 11:58:52, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001136110 1023 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens caspase 5, apoptosis-related cysteine peptidase
(CASP5), transcript variant c, mRNA.
ACCESSION NM_001136110
VERSION NM_001136110.1 GI:209870072
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1023)
AUTHORS Zhu,Q., Lin,L., Cheng,Q., Xu,Q., Zhang,J., Tomlinson,S., Jin,J.,
Chen,X. and He,S.
TITLE The role of acid sphingomyelinase and caspase 5 in hypoxia-induced
HuR cleavage and subsequent apoptosis in hepatocytes
JOURNAL Biochim. Biophys. Acta 1821 (12), 1453-1461 (2012)
PUBMED 22906436
REMARK GeneRIF: Data show that exposure of hepatocytes to direct hypoxia
resulted in acid sphingomyelinase activation and ceramide elevation
associated with activation of caspase 5 and the subsequent cleavage
of HuR and apoptotic cell death.
REFERENCE 2 (bases 1 to 1023)
AUTHORS Mittal,R.D., Mittal,T., Singh,A.K. and Mandal,R.K.
TITLE Association of caspases with an increased prostate cancer risk in
north Indian population
JOURNAL DNA Cell Biol. 31 (1), 67-73 (2012)
PUBMED 21668377
REMARK GeneRIF: Data suggest a positive association of caspase-3 and
diplotype analysis of caspase-5 to be associated with prostate
cancer risk.
REFERENCE 3 (bases 1 to 1023)
AUTHORS Bian,Z.M., Elner,S.G., Khanna,H., Murga-Zamalloa,C.A., Patil,S. and
Elner,V.M.
TITLE Expression and functional roles of caspase-5 in inflammatory
responses of human retinal pigment epithelial cells
JOURNAL Invest. Ophthalmol. Vis. Sci. 52 (12), 8646-8656 (2011)
PUBMED 21969293
REMARK GeneRIF: Mutual activation between caspase-5 and -1 suggests
caspase-5 may work predominantly in concert with caspase-1 in
modulating retinal pigment epithelium inflammatory responses.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 1023)
AUTHORS Mittal,R.D., Srivastava,P., Mittal,T., Verma,A., Jaiswal,P.K.,
Singh,V., Mandal,R.K. and Mandhani,A.
TITLE Association of death receptor 4, Caspase 3 and 5 gene polymorphism
with increased risk to bladder cancer in North Indians
JOURNAL Eur J Surg Oncol 37 (8), 727-733 (2011)
PUBMED 21700414
REMARK GeneRIF: Association of death receptor 4, Caspase 3 and 5 gene
polymorphism with increased risk to bladder cancer in North
Indians.
REFERENCE 5 (bases 1 to 1023)
AUTHORS Eckhart,L., Kittel,C., Gawlas,S., Gruber,F., Mildner,M., Jilma,B.
and Tschachler,E.
TITLE Identification of a novel exon encoding the amino-terminus of the
predominant caspase-5 variants
JOURNAL Biochem. Biophys. Res. Commun. 348 (2), 682-688 (2006)
PUBMED 16893518
REMARK GeneRIF: novel exon was present in six alternatively spliced
caspase-5 mRNA variants expressed in human peripheral blood
mononuclear cells (PBMC) and encoded the previously unknown
amino-terminus of caspase-5.
REFERENCE 6 (bases 1 to 1023)
AUTHORS Waterhouse,N.J., Finucane,D.M., Green,D.R., Elce,J.S., Kumar,S.,
Alnemri,E.S., Litwack,G., Khanna,K., Lavin,M.F. and Watters,D.J.
TITLE Calpain activation is upstream of caspases in radiation-induced
apoptosis
JOURNAL Cell Death Differ. 5 (12), 1051-1061 (1998)
PUBMED 9894612
REFERENCE 7 (bases 1 to 1023)
AUTHORS Caulin,C., Salvesen,G.S. and Oshima,R.G.
TITLE Caspase cleavage of keratin 18 and reorganization of intermediate
filaments during epithelial cell apoptosis
JOURNAL J. Cell Biol. 138 (6), 1379-1394 (1997)
PUBMED 9298992
REFERENCE 8 (bases 1 to 1023)
AUTHORS Nasir,J., Theilmann,J.L., Vaillancourt,J.P., Munday,N.A., Ali,A.,
Scherer,S., Beatty,B., Nicholson,D.W. and Hayden,M.R.
TITLE Interleukin-1beta-converting enzyme (ICE) and related cell death
genes ICErel-II and ICErel-III map to the same PAC clone at band
11q22.2-22.3
JOURNAL Mamm. Genome 8 (8), 611-613 (1997)
PUBMED 9250871
REFERENCE 9 (bases 1 to 1023)
AUTHORS Faucheu,C., Blanchet,A.M., Collard-Dutilleul,V., Lalanne,J.L. and
Diu-Hercend,A.
TITLE Identification of a cysteine protease closely related to
interleukin-1 beta-converting enzyme
JOURNAL Eur. J. Biochem. 236 (1), 207-213 (1996)
PUBMED 8617266
REFERENCE 10 (bases 1 to 1023)
AUTHORS Munday,N.A., Vaillancourt,J.P., Ali,A., Casano,F.J., Miller,D.K.,
Molineaux,S.M., Yamin,T.T., Yu,V.L. and Nicholson,D.W.
TITLE Molecular cloning and pro-apoptotic activity of ICErelII and
ICErelIII, members of the ICE/CED-3 family of cysteine proteases
JOURNAL J. Biol. Chem. 270 (26), 15870-15876 (1995)
PUBMED 7797592
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AK296660.1, DQ228674.1 and
X94993.1.
Summary: This gene encodes a member of the cysteine-aspartic acid
protease (caspase) family. Sequential activation of caspases plays
a central role in the execution-phase of cell apoptosis. Caspases
exist as inactive proenzymes which undergo proteolytic processing
at conserved aspartic residues to produce two subunits, large and
small, that dimerize to form the active enzyme. Overexpression of
the active form of this enzyme induces apoptosis in fibroblasts.
Max, a central component of the Myc/Max/Mad transcription
regulation network important for cell growth, differentiation, and
apoptosis, is cleaved by this protein; this process requires
Fas-mediated dephosphorylation of Max. The expression of this gene
is regulated by interferon-gamma and lipopolysaccharide.
Alternatively spliced transcript variants have been identified for
this gene. [provided by RefSeq, Aug 2010].
Transcript Variant: This variant (c) is lacking two consecutive
in-frame coding exons compared to transcript variant a, resulting
in a shorter isoform (c) missing a 142 aa protein segment compared
to isoform a.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
RNAseq introns :: mixed/partial sample support ERS025082, ERS025084
[ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-39 AK296660.1 1-39
40-605 DQ228674.1 8-573
606-1023 X94993.1 893-1310
FEATURES Location/Qualifiers
source 1..1023
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q22.2-q22.3"
gene 1..1023
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/note="caspase 5, apoptosis-related cysteine peptidase"
/db_xref="GeneID:838"
/db_xref="HGNC:1506"
/db_xref="MIM:602665"
exon 1..39
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/inference="alignment:Splign:1.39.8"
variation 20
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/replace="a"
/replace="g"
/db_xref="dbSNP:41462946"
CDS 33..911
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/EC_number="3.4.22.58"
/note="isoform c is encoded by transcript variant c;
caspase 5, apoptosis-related cysteine protease; TY
protease; caspase-5; CASP-5; protease TY; ICE(rel)-III;
protease ICH-3"
/codon_start=1
/product="caspase-5 isoform c"
/protein_id="NP_001129582.1"
/db_xref="GI:209870073"
/db_xref="CCDS:CCDS44718.1"
/db_xref="GeneID:838"
/db_xref="HGNC:1506"
/db_xref="MIM:602665"
/translation="
MAALLQIEAGPPESAESTNILKLCPREEFLRLCKKNHDEIYPIKKREDRRRLALIICNTKFDHLPARNGAHYDIVGMKRLLQGLGYTVVDEKNLTARDMESVLRAFAARPEHKSSDSTFLVLMSHGILEGICGTAHKKKKPDVLLYDTIFQIFNNRNCLSLKDKPKVIIVQACRGEKHGELWVRDSPASLALISSQSSENLEADSVCKIHEEKDFIAFCSSTPHNVSWRDRTRGSIFITELITCFQKYSCCCHLMEIFRKVQKSFEVPQAKAQMPTIERATLTRDFYLFPGN
"
misc_feature 150..899
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/note="Caspase, interleukin-1 beta converting enzyme (ICE)
homologues; Cysteine-dependent aspartate-directed
proteases that mediate programmed cell death (apoptosis).
Caspases are synthesized as inactive zymogens and
activated by proteolysis of the peptide...; Region: CASc;
cd00032"
/db_xref="CDD:28914"
misc_feature order(231..233,408..410,543..545,564..566,708..725,
735..740)
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/note="substrate pocket [chemical binding]; other site"
/db_xref="CDD:28914"
misc_feature order(405..407,549..551)
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/note="active site"
/db_xref="CDD:28914"
misc_feature order(567..569,663..668,687..689,696..698,705..707,
774..776,798..800,816..818,846..848,861..863,867..869,
873..875,882..887)
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:28914"
misc_feature order(570..572,660..662)
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/note="proteolytic cleavage site; other site"
/db_xref="CDD:28914"
exon 40..149
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/inference="alignment:Splign:1.39.8"
variation 109
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/replace="a"
/replace="g"
/db_xref="dbSNP:3181179"
exon 150..323
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/inference="alignment:Splign:1.39.8"
variation 255
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/replace="c"
/replace="g"
/db_xref="dbSNP:3181326"
exon 324..558
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/inference="alignment:Splign:1.39.8"
variation 353
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/replace="c"
/replace="t"
/db_xref="dbSNP:45501691"
variation 499
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/replace="a"
/replace="g"
/db_xref="dbSNP:45464699"
exon 559..702
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/inference="alignment:Splign:1.39.8"
variation 663
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/replace="a"
/replace="g"
/db_xref="dbSNP:45619739"
exon 703..812
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/inference="alignment:Splign:1.39.8"
variation 704
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/replace="c"
/replace="t"
/db_xref="dbSNP:45620437"
STS 732..864
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/standard_name="RH71301"
/db_xref="UniSTS:53271"
variation 750
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/replace="c"
/replace="g"
/db_xref="dbSNP:45458695"
exon 813..915
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/inference="alignment:Splign:1.39.8"
exon 916..1023
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
/inference="alignment:Splign:1.39.8"
polyA_signal 1002..1007
/gene="CASP5"
/gene_synonym="ICE(rel)III; ICEREL-III; ICH-3"
ORIGIN
agtgctgtacaaagagacagaggctgttagctatggctgctcttctgcaaatcgaggctggaccacctgagtcagcagaatctacaaatatactcaaactttgtcctcgtgaagaattcctgagactgtgtaaaaaaaatcatgatgagatctatccaataaaaaagagagaggaccgcagacgcctggctctcatcatatgcaatacaaagtttgatcacctgcctgcaaggaatggggctcactatgacatcgtggggatgaaaaggctgcttcaaggcctgggctacactgtggttgacgaaaagaatctcacagccagggatatggagtcagtgctgagggcatttgctgccagaccagagcacaagtcctctgacagcacgttcttggtactcatgtctcatggcatcctagagggaatctgcggaactgcgcataaaaagaaaaaaccggatgtgctgctttatgacaccatcttccagatattcaacaaccgcaactgcctcagtctaaaggacaaacccaaggtcatcattgtccaggcctgcagaggtgaaaaacatggggaactctgggtcagagactctccagcatccttggcactcatctcttcacagtcatctgagaacctggaggcagattctgtttgcaagatccacgaggagaaggacttcattgctttctgttcttcaacaccacataacgtgtcctggagagaccgcacaaggggctccatcttcattacggaactcatcacatgcttccagaaatattcttgctgctgccacctaatggaaatatttcggaaggtacagaaatcatttgaagttccacaggctaaagcccagatgcccaccatagaacgagcaaccttgacaagagatttctacctctttcctggcaattgaaaatgaaaccacaggcagcccagccctcctctgtcaacatcaaagagcacatttaccagtatagcttgcatagtcaatatttggtatttcaataaaagtaaagactgtatct
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:838 -> Molecular function: GO:0004197 [cysteine-type endopeptidase activity] evidence: IEA
GeneID:838 -> Molecular function: GO:0008234 [cysteine-type peptidase activity] evidence: TAS
GeneID:838 -> Biological process: GO:0006508 [proteolysis] evidence: IEA
GeneID:838 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:838 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: IEA
GeneID:838 -> Biological process: GO:0071260 [cellular response to mechanical stimulus] evidence: IEP
GeneID:838 -> Cellular component: GO:0072558 [NLRP1 inflammasome complex] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001129582 -> EC 3.4.22.58
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.