2024-04-25 01:57:36, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001136109 1275 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant b, mRNA. ACCESSION NM_001136109 VERSION NM_001136109.1 GI:209870070 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1275) AUTHORS Zhu,Q., Lin,L., Cheng,Q., Xu,Q., Zhang,J., Tomlinson,S., Jin,J., Chen,X. and He,S. TITLE The role of acid sphingomyelinase and caspase 5 in hypoxia-induced HuR cleavage and subsequent apoptosis in hepatocytes JOURNAL Biochim. Biophys. Acta 1821 (12), 1453-1461 (2012) PUBMED 22906436 REMARK GeneRIF: Data show that exposure of hepatocytes to direct hypoxia resulted in acid sphingomyelinase activation and ceramide elevation associated with activation of caspase 5 and the subsequent cleavage of HuR and apoptotic cell death. REFERENCE 2 (bases 1 to 1275) AUTHORS Mittal,R.D., Mittal,T., Singh,A.K. and Mandal,R.K. TITLE Association of caspases with an increased prostate cancer risk in north Indian population JOURNAL DNA Cell Biol. 31 (1), 67-73 (2012) PUBMED 21668377 REMARK GeneRIF: Data suggest a positive association of caspase-3 and diplotype analysis of caspase-5 to be associated with prostate cancer risk. REFERENCE 3 (bases 1 to 1275) AUTHORS Bian,Z.M., Elner,S.G., Khanna,H., Murga-Zamalloa,C.A., Patil,S. and Elner,V.M. TITLE Expression and functional roles of caspase-5 in inflammatory responses of human retinal pigment epithelial cells JOURNAL Invest. Ophthalmol. Vis. Sci. 52 (12), 8646-8656 (2011) PUBMED 21969293 REMARK GeneRIF: Mutual activation between caspase-5 and -1 suggests caspase-5 may work predominantly in concert with caspase-1 in modulating retinal pigment epithelium inflammatory responses. Publication Status: Online-Only REFERENCE 4 (bases 1 to 1275) AUTHORS Mittal,R.D., Srivastava,P., Mittal,T., Verma,A., Jaiswal,P.K., Singh,V., Mandal,R.K. and Mandhani,A. TITLE Association of death receptor 4, Caspase 3 and 5 gene polymorphism with increased risk to bladder cancer in North Indians JOURNAL Eur J Surg Oncol 37 (8), 727-733 (2011) PUBMED 21700414 REMARK GeneRIF: Association of death receptor 4, Caspase 3 and 5 gene polymorphism with increased risk to bladder cancer in North Indians. REFERENCE 5 (bases 1 to 1275) AUTHORS Eckhart,L., Kittel,C., Gawlas,S., Gruber,F., Mildner,M., Jilma,B. and Tschachler,E. TITLE Identification of a novel exon encoding the amino-terminus of the predominant caspase-5 variants JOURNAL Biochem. Biophys. Res. Commun. 348 (2), 682-688 (2006) PUBMED 16893518 REMARK GeneRIF: novel exon was present in six alternatively spliced caspase-5 mRNA variants expressed in human peripheral blood mononuclear cells (PBMC) and encoded the previously unknown amino-terminus of caspase-5. REFERENCE 6 (bases 1 to 1275) AUTHORS Waterhouse,N.J., Finucane,D.M., Green,D.R., Elce,J.S., Kumar,S., Alnemri,E.S., Litwack,G., Khanna,K., Lavin,M.F. and Watters,D.J. TITLE Calpain activation is upstream of caspases in radiation-induced apoptosis JOURNAL Cell Death Differ. 5 (12), 1051-1061 (1998) PUBMED 9894612 REFERENCE 7 (bases 1 to 1275) AUTHORS Caulin,C., Salvesen,G.S. and Oshima,R.G. TITLE Caspase cleavage of keratin 18 and reorganization of intermediate filaments during epithelial cell apoptosis JOURNAL J. Cell Biol. 138 (6), 1379-1394 (1997) PUBMED 9298992 REFERENCE 8 (bases 1 to 1275) AUTHORS Nasir,J., Theilmann,J.L., Vaillancourt,J.P., Munday,N.A., Ali,A., Scherer,S., Beatty,B., Nicholson,D.W. and Hayden,M.R. TITLE Interleukin-1beta-converting enzyme (ICE) and related cell death genes ICErel-II and ICErel-III map to the same PAC clone at band 11q22.2-22.3 JOURNAL Mamm. Genome 8 (8), 611-613 (1997) PUBMED 9250871 REFERENCE 9 (bases 1 to 1275) AUTHORS Faucheu,C., Blanchet,A.M., Collard-Dutilleul,V., Lalanne,J.L. and Diu-Hercend,A. TITLE Identification of a cysteine protease closely related to interleukin-1 beta-converting enzyme JOURNAL Eur. J. Biochem. 236 (1), 207-213 (1996) PUBMED 8617266 REFERENCE 10 (bases 1 to 1275) AUTHORS Munday,N.A., Vaillancourt,J.P., Ali,A., Casano,F.J., Miller,D.K., Molineaux,S.M., Yamin,T.T., Yu,V.L. and Nicholson,D.W. TITLE Molecular cloning and pro-apoptotic activity of ICErelII and ICErelIII, members of the ICE/CED-3 family of cysteine proteases JOURNAL J. Biol. Chem. 270 (26), 15870-15876 (1995) PUBMED 7797592 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK296660.1, DQ228673.1, DR005081.1 and X94993.1. Summary: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. Overexpression of the active form of this enzyme induces apoptosis in fibroblasts. Max, a central component of the Myc/Max/Mad transcription regulation network important for cell growth, differentiation, and apoptosis, is cleaved by this protein; this process requires Fas-mediated dephosphorylation of Max. The expression of this gene is regulated by interferon-gamma and lipopolysaccharide. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]. Transcript Variant: This variant (b) is lacking an in-frame coding exon compared to transcript variant a, resulting in a shorter isoform (b) missing a 58 aa protein segment compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK296660.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025082, ERS025084 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-39 AK296660.1 1-39 40-173 DQ228673.1 8-141 174-382 DR005081.1 402-610 383-1275 X94993.1 418-1310 FEATURES Location/Qualifiers source 1..1275 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="11" /map="11q22.2-q22.3" gene 1..1275 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /note="caspase 5, apoptosis-related cysteine peptidase" /db_xref="GeneID:838" /db_xref="HGNC:1506" /db_xref="MIM:602665" exon 1..39 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /inference="alignment:Splign:1.39.8" variation 20 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /replace="a" /replace="g" /db_xref="dbSNP:41462946" CDS 33..1163 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /EC_number="3.4.22.58" /note="isoform b precursor is encoded by transcript variant b; caspase 5, apoptosis-related cysteine protease; TY protease; caspase-5; CASP-5; protease TY; ICE(rel)-III; protease ICH-3" /codon_start=1 /product="caspase-5 isoform b precursor" /protein_id="NP_001129581.1" /db_xref="GI:209870071" /db_xref="CCDS:CCDS44719.1" /db_xref="GeneID:838" /db_xref="HGNC:1506" /db_xref="MIM:602665" /translation="
MAEDNHKKKTVKMLEYLGKDVLHGVFNYLAKHDVLTLKEEEKKKYYDTKIEDKALILVDSLRKNRVAHQMFTQTLLNMDQKITSVKPLLQIEAGPPESAESTNILKLCPREEFLRLCKKNHDEIYPIKKREDRRRLALIICNTKFDHLPARNGAHYDIVGMKRLLQGLGYTVVDEKNLTARDMESVLRAFAARPEHKSSDSTFLVLMSHGILEGICGTAHKKKKPDVLLYDTIFQIFNNRNCLSLKDKPKVIIVQACRGEKHGELWVRDSPASLALISSQSSENLEADSVCKIHEEKDFIAFCSSTPHNVSWRDRTRGSIFITELITCFQKYSCCCHLMEIFRKVQKSFEVPQAKAQMPTIERATLTRDFYLFPGN
" misc_feature 45..284 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /note="The Death Domain Superfamily of protein-protein interaction domains; Region: DD_superfamily; cl14633" /db_xref="CDD:209876" mat_peptide 270..839 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /product="caspase-5 large subunit" misc_feature 402..1151 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /note="Caspase, interleukin-1 beta converting enzyme (ICE) homologues; Cysteine-dependent aspartate-directed proteases that mediate programmed cell death (apoptosis). Caspases are synthesized as inactive zymogens and activated by proteolysis of the peptide...; Region: CASc; cd00032" /db_xref="CDD:28914" misc_feature order(483..485,660..662,795..797,816..818,960..977, 987..992) /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /note="substrate pocket [chemical binding]; other site" /db_xref="CDD:28914" misc_feature order(657..659,801..803) /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /note="active site" /db_xref="CDD:28914" misc_feature order(819..821,915..920,939..941,948..950,957..959, 1026..1028,1050..1052,1068..1070,1098..1100,1113..1115, 1119..1121,1125..1127,1134..1139) /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:28914" misc_feature order(822..824,912..914) /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /note="proteolytic cleavage site; other site" /db_xref="CDD:28914" mat_peptide 897..1160 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /product="caspase-5 small subunit" exon 40..291 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /inference="alignment:Splign:1.39.8" variation 82 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /replace="g" /replace="t" /db_xref="dbSNP:45585331" variation 174 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /replace="a" /replace="g" /db_xref="dbSNP:507879" exon 292..401 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /inference="alignment:Splign:1.39.8" variation 361 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /replace="a" /replace="g" /db_xref="dbSNP:3181179" exon 402..575 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /inference="alignment:Splign:1.39.8" variation 507 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /replace="c" /replace="g" /db_xref="dbSNP:3181326" exon 576..810 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /inference="alignment:Splign:1.39.8" variation 605 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /replace="c" /replace="t" /db_xref="dbSNP:45501691" variation 751 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /replace="a" /replace="g" /db_xref="dbSNP:45464699" exon 811..954 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /inference="alignment:Splign:1.39.8" variation 915 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /replace="a" /replace="g" /db_xref="dbSNP:45619739" exon 955..1064 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /inference="alignment:Splign:1.39.8" variation 956 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /replace="c" /replace="t" /db_xref="dbSNP:45620437" STS 984..1116 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /standard_name="RH71301" /db_xref="UniSTS:53271" variation 1002 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /replace="c" /replace="g" /db_xref="dbSNP:45458695" exon 1065..1167 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /inference="alignment:Splign:1.39.8" exon 1168..1275 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" /inference="alignment:Splign:1.39.8" polyA_signal 1254..1259 /gene="CASP5" /gene_synonym="ICE(rel)III; ICEREL-III; ICH-3" ORIGIN
agtgctgtacaaagagacagaggctgttagctatggctgaagacaaccacaaaaaaaaaacagttaagatgttggaatacctgggcaaagatgttcttcatggtgtttttaattatttggcaaaacacgatgttctgacattgaaggaagaggaaaagaaaaaatattatgataccaaaattgaagacaaggccctgatcttggtagactctttgcgaaagaatcgcgtggctcatcaaatgtttacccaaacacttctcaatatggaccaaaagatcaccagtgtaaaacctcttctgcaaatcgaggctggaccacctgagtcagcagaatctacaaatatactcaaactttgtcctcgtgaagaattcctgagactgtgtaaaaaaaatcatgatgagatctatccaataaaaaagagagaggaccgcagacgcctggctctcatcatatgcaatacaaagtttgatcacctgcctgcaaggaatggggctcactatgacatcgtggggatgaaaaggctgcttcaaggcctgggctacactgtggttgacgaaaagaatctcacagccagggatatggagtcagtgctgagggcatttgctgccagaccagagcacaagtcctctgacagcacgttcttggtactcatgtctcatggcatcctagagggaatctgcggaactgcgcataaaaagaaaaaaccggatgtgctgctttatgacaccatcttccagatattcaacaaccgcaactgcctcagtctaaaggacaaacccaaggtcatcattgtccaggcctgcagaggtgaaaaacatggggaactctgggtcagagactctccagcatccttggcactcatctcttcacagtcatctgagaacctggaggcagattctgtttgcaagatccacgaggagaaggacttcattgctttctgttcttcaacaccacataacgtgtcctggagagaccgcacaaggggctccatcttcattacggaactcatcacatgcttccagaaatattcttgctgctgccacctaatggaaatatttcggaaggtacagaaatcatttgaagttccacaggctaaagcccagatgcccaccatagaacgagcaaccttgacaagagatttctacctctttcctggcaattgaaaatgaaaccacaggcagcccagccctcctctgtcaacatcaaagagcacatttaccagtatagcttgcatagtcaatatttggtatttcaataaaagtaaagactgtatct
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:838 -> Molecular function: GO:0004197 [cysteine-type endopeptidase activity] evidence: IEA GeneID:838 -> Molecular function: GO:0008234 [cysteine-type peptidase activity] evidence: TAS GeneID:838 -> Biological process: GO:0006508 [proteolysis] evidence: IEA GeneID:838 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:838 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: IEA GeneID:838 -> Biological process: GO:0071260 [cellular response to mechanical stimulus] evidence: IEP GeneID:838 -> Cellular component: GO:0072558 [NLRP1 inflammasome complex] evidence: IDA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_001129581 -> EC 3.4.22.58
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.