GGRNA Home | Help | Advanced search

2025-07-08 16:09:37, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001136025            3327 bp    mRNA    linear   PRI 01-JUL-2013
DEFINITION  Homo sapiens plastin 3 (PLS3), transcript variant 2, mRNA.
ACCESSION   NM_001136025
VERSION     NM_001136025.3  GI:288915540
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3327)
  AUTHORS   Yokobori,T., Iinuma,H., Shimamura,T., Imoto,S., Sugimachi,K.,
            Ishii,H., Iwatsuki,M., Ota,D., Ohkuma,M., Iwaya,T., Nishida,N.,
            Kogo,R., Sudo,T., Tanaka,F., Shibata,K., Toh,H., Sato,T.,
            Barnard,G.F., Fukagawa,T., Yamamoto,S., Nakanishi,H., Sasaki,S.,
            Miyano,S., Watanabe,T., Kuwano,H., Mimori,K., Pantel,K. and Mori,M.
  TITLE     Plastin3 is a novel marker for circulating tumor cells undergoing
            the epithelial-mesenchymal transition and is associated with
            colorectal cancer prognosis
  JOURNAL   Cancer Res. 73 (7), 2059-2069 (2013)
   PUBMED   23378342
  REMARK    GeneRIF: Overexpression of PLS3 is associated with
            epithelial-mesenchymal transition and is associated with metastasis
            in colorectal cancer
REFERENCE   2  (bases 1 to 3327)
  AUTHORS   Michel,L., Jean-Louis,F., Begue,E., Bensussan,A. and Bagot,M.
  TITLE     Use of PLS3, Twist, CD158k/KIR3DL2, and NKp46 gene expression
            combination for reliable Sezary syndrome diagnosis
  JOURNAL   Blood 121 (8), 1477-1478 (2013)
   PUBMED   23429988
  REMARK    GeneRIF: PLS3, Twist, KIR3DL2 and NKp46 gene expression can model
            efficient molecular Sezary syndrome diagnosis.
REFERENCE   3  (bases 1 to 3327)
  AUTHORS   Su,H., Zhu,J., Cai,C., Pei,W., Wang,J., Dong,H. and Ren,H.
  TITLE     FIMBRIN1 is involved in lily pollen tube growth by stabilizing the
            actin fringe
  JOURNAL   Plant Cell 24 (11), 4539-4554 (2012)
   PUBMED   23150633
REFERENCE   4  (bases 1 to 3327)
  AUTHORS   Jones,C.L., Ferreira,S., McKenzie,R.C., Tosi,I., Caesar,J.A.,
            Bagot,M., Whittaker,S.J. and Mitchell,T.J.
  TITLE     Regulation of T-plastin expression by promoter hypomethylation in
            primary cutaneous T-cell lymphoma
  JOURNAL   J. Invest. Dermatol. 132 (8), 2042-2049 (2012)
   PUBMED   22495182
  REMARK    GeneRIF: PLS3 is expressed in the majority of SS patients and
            provide insight into the molecular regulation of PLS3 expression in
            CTCL
REFERENCE   5  (bases 1 to 3327)
  AUTHORS   Begue,E., Jean-Louis,F., Bagot,M., Jauliac,S., Cayuela,J.M.,
            Laroche,L., Parquet,N., Bachelez,H., Bensussan,A., Courtois,G. and
            Michel,L.
  TITLE     Inducible expression and pathophysiologic functions of T-plastin in
            cutaneous T-cell lymphoma
  JOURNAL   Blood 120 (1), 143-154 (2012)
   PUBMED   22627769
  REMARK    GeneRIF: T-plastin is a marker restricted to malignant lymphocytes
            from Sezary syndrome patients and plays a role for cell survival
            and migration.
REFERENCE   6  (bases 1 to 3327)
  AUTHORS   Arpin,M., Friederich,E., Algrain,M., Vernel,F. and Louvard,D.
  TITLE     Functional differences between L- and T-plastin isoforms
  JOURNAL   J. Cell Biol. 127 (6 PT 2), 1995-2008 (1994)
   PUBMED   7806577
REFERENCE   7  (bases 1 to 3327)
  AUTHORS   Lin,C.S., Park,T., Chen,Z.P. and Leavitt,J.
  TITLE     Human plastin genes. Comparative gene structure, chromosome
            location, and differential expression in normal and neoplastic
            cells
  JOURNAL   J. Biol. Chem. 268 (4), 2781-2792 (1993)
   PUBMED   8428952
REFERENCE   8  (bases 1 to 3327)
  AUTHORS   Lin,C.S., Aebersold,R.H. and Leavitt,J.
  TITLE     Correction of the N-terminal sequences of the human plastin
            isoforms by using anchored polymerase chain reaction:
            identification of a potential calcium-binding domain
  JOURNAL   Mol. Cell. Biol. 10 (4), 1818-1821 (1990)
   PUBMED   2378651
REFERENCE   9  (bases 1 to 3327)
  AUTHORS   Lin,C.S., Aebersold,R.H., Kent,S.B., Varma,M. and Leavitt,J.
  TITLE     Molecular cloning and characterization of plastin, a human
            leukocyte protein expressed in transformed human fibroblasts
  JOURNAL   Mol. Cell. Biol. 8 (11), 4659-4668 (1988)
   PUBMED   3211125
REFERENCE   10 (bases 1 to 3327)
  AUTHORS   Goldstein,D., Djeu,J., Latter,G., Burbeck,S. and Leavitt,J.
  TITLE     Abundant synthesis of the transformation-induced protein of
            neoplastic human fibroblasts, plastin, in normal lymphocytes
  JOURNAL   Cancer Res. 45 (11 PT 2), 5643-5647 (1985)
   PUBMED   4053036
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DC357886.1, BC039049.1 and
            AC005000.2.
            On Feb 17, 2010 this sequence version replaced gi:226053520.
            
            Summary: Plastins are a family of actin-binding proteins that are
            conserved throughout eukaryote evolution and expressed in most
            tissues of higher eukaryotes. In humans, two ubiquitous plastin
            isoforms (L and T) have been identified. Plastin 1 (otherwise known
            as Fimbrin) is a third distinct plastin isoform which is
            specifically expressed at high levels in the small intestine. The L
            isoform is expressed only in hemopoietic cell lineages, while the T
            isoform has been found in all other normal cells of solid tissues
            that have replicative potential (fibroblasts, endothelial cells,
            epithelial cells, melanocytes, etc.). The C-terminal 570 amino
            acids of the T-plastin and L-plastin proteins are 83% identical. It
            contains a potential calcium-binding site near the N terminus.
            Alternate splicing results in multiple transcript
            variants.[provided by RefSeq, Feb 2010].
            
            Transcript Variant: This variant (2) differs in the 5' UTR compared
            to variant 1. Variants 1 and 2 encode the same isoform (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC039049.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025083 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-101               DC357886.1         1-101
            102-3138            BC039049.1         1-3037
            3139-3327           AC005000.2         19038-19226
FEATURES             Location/Qualifiers
     source          1..3327
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xq23"
     gene            1..3327
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="plastin 3"
                     /db_xref="GeneID:5358"
                     /db_xref="HGNC:9091"
                     /db_xref="MIM:300131"
     exon            1..126
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       9
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12847396"
     variation       92
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370675011"
     exon            127..207
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    132..134
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="upstream in-frame stop codon"
     CDS             135..2027
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="isoform 1 is encoded by transcript variant 2; T
                     fimbrin; plastin-3; T plastin"
                     /codon_start=1
                     /product="plastin-3 isoform 1"
                     /protein_id="NP_001129497.1"
                     /db_xref="GI:209862851"
                     /db_xref="CCDS:CCDS14568.1"
                     /db_xref="GeneID:5358"
                     /db_xref="HGNC:9091"
                     /db_xref="MIM:300131"
                     /translation="
MDEMATTQISKDELDELKEAFAKVDLNSNGFICDYELHELFKEANMPLPGYKVREIIQKLMLDGDRNKDGKISFDEFVYIFQEVKSSDIAKTFRKAINRKEGICALGGTSELSSEGTQHSYSEEEKYAFVNWINKALENDPDCRHVIPMNPNTDDLFKAVGDGIVLCKMINLSVPDTIDERAINKKKLTPFIIQENLNLALNSASAIGCHVVNIGAEDLRAGKPHLVLGLLWQIIKIGLFADIELSRNEALAALLRDGETLEELMKLSPEELLLRWANFHLENSGWQKINNFSADIKDSKAYFHLLNQIAPKGQKEGEPRIDINMSGFNETDDLKRAESMLQQADKLGCRQFVTPADVVSGNPKLNLAFVANLFNKYPALTKPENQDIDWTLLEGETREERTFRNWMNSLGVNPHVNHLYADLQDALVILQLYERIKVPVDWSKVNKPPYPKLGANMKKLENCNYAVELGKHPAKFSLVGIGGQDLNDGNQTLTLALVWQLMRRYTLNVLEDLGDGQKANDDIIVNWVNRTLSEAGKSTSIQSFKDKTISSSLAVVDLIDAIQPGCINYDLVKSGNLTEDDKHNNAKYAVSMARRIGARVYALPEDLVEVKPKMVMTVFACLMGRGMKRV
"
     misc_feature    180..380
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="EF-hand, calcium binding motif; A diverse
                     superfamily of calcium sensors and calcium signal
                     modulators; most examples in this alignment model have 2
                     active canonical EF hands. Ca2+ binding induces a
                     conformational change in the EF-hand motif, leading to...;
                     Region: EFh; cd00051"
                     /db_xref="CDD:28933"
     misc_feature    189..2003
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Ca2+-binding actin-bundling protein fimbrin/plastin
                     (EF-Hand superfamily) [Cytoskeleton]; Region: SAC6;
                     COG5069"
                     /db_xref="CDD:34673"
     misc_feature    order(207..209,213..215,219..221,240..242,327..329,
                     333..335,339..341,360..362)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28933"
     misc_feature    504..851
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(504..509,513..521,528..530,537..539,735..740,
                     747..749,756..758,762..764,807..812,819..824,828..833,
                     840..845)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    936..1268
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(936..941,945..953,960..962,969..971,1155..1160,
                     1167..1169,1176..1178,1182..1184,1224..1229,1236..1241,
                     1245..1250,1257..1262)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    1011..1013
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P13797.4); phosphorylation site"
     misc_feature    1110..1112
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P13797.4); phosphorylation site"
     misc_feature    1305..1307
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (P13797.4); phosphorylation site"
     misc_feature    1341..1649
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(1341..1343,1350..1352,1359..1361,1533..1538,
                     1545..1547,1557..1559,1563..1565,1608..1613,1620..1625,
                     1629..1634,1641..1646)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    1695..2012
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(1698..1706,1713..1715,1722..1724,1902..1907,
                     1914..1916,1923..1925,1929..1931,1971..1976,1983..1988,
                     1992..1997,2004..2009)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     exon            208..371
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       209
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150018375"
     variation       220
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145235506"
     variation       328
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373153000"
     variation       343
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377475836"
     variation       359
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113492800"
     variation       360
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186923237"
     exon            372..501
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       455
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140121121"
     variation       458
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144784703"
     variation       497
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147957783"
     exon            502..634
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       570
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141907957"
     variation       602
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143815252"
     variation       605
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151153004"
     exon            635..716
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     exon            717..882
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       774
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367830488"
     variation       785
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112589137"
     variation       822
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371332791"
     variation       856
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375187925"
     exon            883..1025
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       884
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376568367"
     variation       1010
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373249162"
     variation       1011
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369914417"
     exon            1026..1121
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1026
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202076515"
     variation       1059
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140968059"
     variation       1092
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137917062"
     variation       1108
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142569974"
     exon            1122..1317
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1184
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113204501"
     variation       1235
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1859671"
     exon            1318..1396
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1326
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377411857"
     variation       1328
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138662773"
     variation       1344
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201842598"
     variation       1376
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2108099"
     variation       1379
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144592792"
     variation       1396
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370999829"
     exon            1397..1511
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1409
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148514983"
     variation       1428
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:871774"
     exon            1512..1645
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1514
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75219193"
     variation       1553
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140768895"
     variation       1610
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35211005"
     exon            1646..1769
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1652
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35525703"
     variation       1679
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140069545"
     variation       1680
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199893556"
     variation       1730
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372389185"
     variation       1732
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377191528"
     variation       1749
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150069454"
     variation       1762
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191246889"
     exon            1770..1894
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1795
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:181782110"
     variation       1866
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149142111"
     variation       1874
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145393426"
     exon            1895..3327
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       2026
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369448909"
     variation       2067
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373177061"
     variation       2078
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376407795"
     variation       2243
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184318952"
     variation       2411
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144589761"
     variation       2671
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11551495"
     variation       2743
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370865892"
     variation       2919
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373978498"
     polyA_signal    3117..3122
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
     polyA_site      3138
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
     variation       3169
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376902216"
     variation       3249
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148073444"
ORIGIN      
gacttgctctctaaagttgcaattgtaagaagaatgttgggtttccagattgctcttctgggcgtgggagaaggttctgtctatcagtgctgcgagaaaggaaagaaacaagtttgctctcagcggatctttaaatggatgagatggctaccactcagatttccaaagatgagcttgatgaactcaaagaggcctttgcaaaagttgatctcaacagcaacggattcatttgtgactatgaacttcatgagctcttcaaggaagctaatatgccattaccaggatataaagtgagagaaattattcagaaactcatgctggatggtgacaggaataaagatgggaaaataagttttgacgaatttgtttatatttttcaagaggtaaaaagtagtgatattgccaagaccttccgcaaagcaatcaacaggaaagaaggtatttgtgctctgggtggaacttcagagttgtccagcgaaggaacacagcattcttactcagaggaagaaaaatatgcttttgttaactggataaacaaagctttggaaaatgatcctgattgtagacatgttataccaatgaaccctaacaccgatgacctgttcaaagctgttggtgatggaattgtgctttgtaaaatgattaacctttcagttcctgataccattgatgaaagagcaatcaacaagaagaaacttacacccttcatcattcaggaaaacttgaacttggcactgaactctgcttctgccattgggtgtcatgttgtgaacattggtgcagaagatttgagggctgggaaacctcatctggttttgggactgctttggcagatcattaagatcggtttgttcgctgacattgaattaagcaggaatgaagccttggctgctttactccgagatggtgagactttggaggaacttatgaaattgtctccagaagagcttctgcttagatgggcaaactttcatttggaaaactcgggctggcaaaaaattaacaactttagtgctgacatcaaggattccaaagcctatttccatcttctcaatcaaatcgcaccaaaaggacaaaaggaaggtgaaccacggatagatattaacatgtcaggtttcaatgaaacagatgatttgaagagagctgagagtatgcttcaacaagcagataaattaggttgcagacagtttgttacccctgctgatgttgtcagtggaaaccccaaactcaacttagctttcgtggctaacctgtttaataaatacccagcactaactaagccagagaaccaggatattgactggactctattagaaggagaaactcgtgaagaaagaaccttccgtaactggatgaactctcttggtgtcaatcctcacgtaaaccatctctatgctgacctgcaagatgccctggtaatcttacagttatatgaacgaattaaagttcctgttgactggagtaaggttaataaacctccatacccgaaactgggagccaacatgaaaaagctagaaaactgcaactatgctgttgaattagggaagcatcctgctaaattctccctggttggcattggagggcaagacctgaatgatgggaaccaaaccctgactttagctttagtctggcagctgatgagaagatataccctcaatgtcctggaagatcttggagatggtcagaaagccaatgacgacatcattgtgaactgggtgaacagaacgttgagtgaagctggaaaatcaacttccattcagagttttaaggacaagacgatcagctccagtttggcagttgtggatttaattgatgccatccagccaggctgtataaactatgaccttgtgaagagtggcaatctaacagaagatgacaagcacaataatgccaagtatgcagtgtcaatggctagaagaatcggagccagagtgtatgctctccctgaagaccttgtggaagtaaagcccaagatggtcatgactgtgtttgcatgtttgatgggcaggggaatgaagagagtgtaaaataaccaatctgaataaaacagccatgctcccaggtgcatgattcgcaggtcagctatttccaggtgaagtgcttatggcttaaggaactcttggccattcaaaggacttttcattttgattaacaggactagcttatcatgagagccctcaggggaaagggtttaagaaaaacaactcctctttcccatagtcagagttgaatttgtcaggcacgcctgaaatgtgctcatagccaaaacattttactctctcctcctagaatgctgcccttgacatttcccattgctgtatgttatttcttgctctgttatcttttgccctcttagaatgtccctctcttgggacttgcttagatgatgggatatgaatattattagacagtaattttgctttccatccagtatgctagttcttattcgagaactatggtcagagcgtatttggatatgagtatcctttgcttatctttgtagtactgaaaatttgccgaagtaactggctgtgcagaatgtaatagaagcttttcttattcttttattcttaagatcagtatctttttacagtattctttctacatgatccttttttgtacatttaagaatattttgattatattaaacaagactgctgattttgctactttttttaaggggtcttcaagtaagtaaaacatacatcgtagctagaagaaaaatgtaccttaaatttgcatcttccctctcatacccaagctgtaaacaattgaaatattttgtcttaaatcacttggttcaatacatgcttatttgttttaaaacctgtatcatcaaactctctctctaaatttaaaatgctgttgaatatgatacttttgaggagagagtgtgctcagaacttagacgggatttggtaggccaagtatgctaagtgtacaatatattttttaattttacacctgaaacaaagaaatgtggtcactaaaaataaaagtatatatgtaggaattaatgtactcttgctttgtcaagctgtttgctatagtttccaaggtattatgttactctaactctgaaaagtgatgtaatctggtagcaatgtagtagttcaaataaaggcatttacataataattagtctgttcttcatgcttttgtctcttaggaagtatgccaatgtttgtcaggatttttttctttttgtttttctgatgtattctgtaaaatggtgtttgttaaatttgagttttgggagctgaattagaggtactgaattaaggacagtacaaatgaagtaaaaaggttttctccaatttaccaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5358 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
            GeneID:5358 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:5358 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.