2024-04-26 19:02:23, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001135686 897 bp mRNA linear PRI 14-MAY-2013 DEFINITION Homo sapiens T cell-interacting, activating receptor on myeloid cells 1 (TARM1), mRNA. ACCESSION NM_001135686 XM_001127643 XM_001718727 XM_497642 VERSION NM_001135686.1 GI:208879428 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 897) AUTHORS Kohn,L., Bowne,S.J., S Sullivan,L., Daiger,S.P., Burstedt,M.S., Kadzhaev,K., Sandgren,O. and Golovleva,I. TITLE Breakpoint characterization of a novel approximately 59 kb genomic deletion on 19q13.42 in autosomal-dominant retinitis pigmentosa with incomplete penetrance JOURNAL Eur. J. Hum. Genet. 17 (5), 651-655 (2009) PUBMED 19050727 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from DQ479398.1. On or before Oct 8, 2008 this sequence version replaced gi:169214465, gi:169214024, gi:169213424. ##Evidence-Data-START## Transcript exon combination :: DQ479398.1 [ECO:0000332] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..897 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="19" /map="19q13.42" gene 1..897 /gene="TARM1" /gene_synonym="OLT-2" /note="T cell-interacting, activating receptor on myeloid cells 1" /db_xref="GeneID:441864" /db_xref="HGNC:37250" exon 1..59 /gene="TARM1" /gene_synonym="OLT-2" /inference="alignment:Splign:1.39.8" misc_feature 14..16 /gene="TARM1" /gene_synonym="OLT-2" /note="upstream in-frame stop codon" CDS 26..841 /gene="TARM1" /gene_synonym="OLT-2" /note="T-cell-interacting, activating receptor on myeloid cells protein 1; OSCAR-like transcript-2 protein" /codon_start=1 /product="T-cell-interacting, activating receptor on myeloid cells protein 1 precursor" /protein_id="NP_001129158.1" /db_xref="GI:208879429" /db_xref="CCDS:CCDS46173.1" /db_xref="GeneID:441864" /db_xref="HGNC:37250" /translation="
MIPKLLSLLCFRLCVGQGDTRGDGSLPKPSLSAWPSSVVPANSNVTLRCWTPARGVSFVLRKGGIILESPKPLDSTEGAAEFHLNNLKVRNAGEYTCEYYRKASPHILSQRSDVLLLLVTGHLSKPFLRTYQRGTVTAGGRVTLQCQKRDQLFVPIMFALLKAGTPSPIQLQSPAGKEIDFSLVDVTAGDAGNYSCMYYQTKSPFWASEPSDQLEILVTVPPGTTSSNYSLGNFVRLGLAAVIVVIMGAFLVEAWYSRNVSPGESEAFKPE
" sig_peptide 26..73 /gene="TARM1" /gene_synonym="OLT-2" /inference="COORDINATES: ab initio prediction:SignalP:4.0" mat_peptide 74..838 /gene="TARM1" /gene_synonym="OLT-2" /product="T-cell-interacting, activating receptor on myeloid cells protein 1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (B6A8C7.1)" misc_feature 104..385 /gene="TARM1" /gene_synonym="OLT-2" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:213125" misc_feature 395..682 /gene="TARM1" /gene_synonym="OLT-2" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:213125" misc_feature 734..796 /gene="TARM1" /gene_synonym="OLT-2" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (B6A8C7.1); transmembrane region" exon 60..95 /gene="TARM1" /gene_synonym="OLT-2" /inference="alignment:Splign:1.39.8" exon 96..386 /gene="TARM1" /gene_synonym="OLT-2" /inference="alignment:Splign:1.39.8" variation 266 /gene="TARM1" /gene_synonym="OLT-2" /replace="a" /replace="g" /db_xref="dbSNP:2361558" exon 387..683 /gene="TARM1" /gene_synonym="OLT-2" /inference="alignment:Splign:1.39.8" STS 412..673 /gene="TARM1" /gene_synonym="OLT-2" /standard_name="REN91435" /db_xref="UniSTS:416233" exon 684..897 /gene="TARM1" /gene_synonym="OLT-2" /inference="alignment:Splign:1.39.8" ORIGIN
actctgggagggctaaggagccatcatgatccctaagctgctttccctcctctgtttcagactgtgcgtgggccaaggagacacaaggggagatgggtcactgcccaagccgtccctcagtgcctggcccagctcggtggtccctgccaacagcaatgtgacgctgcgatgttggactcctgccagaggtgtgagctttgttctcaggaagggaggaattattctggagtccccgaagccccttgattctacagagggcgcggccgaatttcacctcaataatctaaaagtcagaaatgctggagagtacacctgtgaatactacagaaaagcatccccccacatcctttcacagcgcagtgacgtccttctactgttggtgacaggacatttatctaaacctttcctccgaacctaccaaaggggtacagtgaccgcaggtggaagggtgactctgcagtgccagaagcgagaccaattgtttgtgcctatcatgttcgctctactgaaggcagggacgccatcacccatccagctgcagagtccagcggggaaggagatagacttctctctggtggacgtgacagccggcgatgctgggaactacagctgcatgtactaccagacaaagtctcccttctgggcctcagaacccagtgatcagcttgagatattggtgacagttcccccaggtaccacatcgagcaactactccctgggtaacttcgtacgactgggtctggctgccgtaattgtggttatcatgggagctttcctggtggaggcctggtacagccggaatgtgtctccaggtgaatcagaggccttcaaaccagagtgactccatcttgaaccggggctgggtaaactgaggctgcaacctgctggactgcattc
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:441864 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.