Home |
Help |
Advanced search
2024-04-24 06:42:22, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001135055 2957 bp mRNA linear PRI 24-JUN-2013
DEFINITION Homo sapiens transketolase (TKT), transcript variant 2, mRNA.
ACCESSION NM_001135055
VERSION NM_001135055.2 GI:306518580
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2957)
AUTHORS Meshalkina,L.E., Drutsa,V.L., Koroleva,O.N., Solovjeva,O.N. and
Kochetov,G.A.
TITLE Is transketolase-like protein, TKTL1, transketolase?
JOURNAL Biochim. Biophys. Acta 1832 (3), 387-390 (2013)
PUBMED 23261987
REMARK GeneRIF: Data indicate that transketolase (hTKT). shares 61%
sequence identity with transketolase-like protein (TKTL1).
REFERENCE 2 (bases 1 to 2957)
AUTHORS Fullam,E., Pojer,F., Bergfors,T., Jones,T.A. and Cole,S.T.
TITLE Structure and function of the transketolase from Mycobacterium
tuberculosis and comparison with the human enzyme
JOURNAL Open Biol 2 (1), 110026 (2012)
PUBMED 22645655
REMARK GeneRIF: Structure and function of the transketolase from
Mycobacterium tuberculosis and comparison with the human enzyme.
REFERENCE 3 (bases 1 to 2957)
AUTHORS Schneider,S., Ludtke,S., Schroder-Tittmann,K., Wechsler,C.,
Meyer,D. and Tittmann,K.
TITLE A delta38 deletion variant of human transketolase as a model of
transketolase-like protein 1 exhibits no enzymatic activity
JOURNAL PLoS ONE 7 (10), E48321 (2012)
PUBMED 23118983
REMARK GeneRIF: No transketolase activity of TKTDelta38 can be detected
for conversion of physiological sugar substrates thus arguing
against an intrinsically encoded enzymatic function of TKTL1 in
tumor cell metabolism
REFERENCE 4 (bases 1 to 2957)
AUTHORS Mitschke,L., Parthier,C., Schroder-Tittmann,K., Coy,J., Ludtke,S.
and Tittmann,K.
TITLE The crystal structure of human transketolase and new insights into
its mode of action
JOURNAL J. Biol. Chem. 285 (41), 31559-31570 (2010)
PUBMED 20667822
REMARK GeneRIF: The crystal structure of human transketolase and new
insights into its mode of action.
REFERENCE 5 (bases 1 to 2957)
AUTHORS Sax,C.M., Salamon,C., Kays,W.T., Guo,J., Yu,F.X., Cuthbertson,R.A.
and Piatigorsky,J.
TITLE Transketolase is a major protein in the mouse cornea
JOURNAL J. Biol. Chem. 271 (52), 33568-33574 (1996)
PUBMED 8969223
REFERENCE 6 (bases 1 to 2957)
AUTHORS Usmanov,R.A., Sidorova,N.N. and Kochetov,G.A.
TITLE Interaction of dihydroxyethylthiamine pyrophosphate with
transketolase
JOURNAL Biochem. Mol. Biol. Int. 38 (2), 307-314 (1996)
PUBMED 8850526
REFERENCE 7 (bases 1 to 2957)
AUTHORS McCool,B.A., Plonk,S.G., Martin,P.R. and Singleton,C.K.
TITLE Cloning of human transketolase cDNAs and comparison of the
nucleotide sequence of the coding region in Wernicke-Korsakoff and
non-Wernicke-Korsakoff individuals
JOURNAL J. Biol. Chem. 268 (2), 1397-1404 (1993)
PUBMED 8419340
REFERENCE 8 (bases 1 to 2957)
AUTHORS Abedinia,M., Layfield,R., Jones,S.M., Nixon,P.F. and Mattick,J.S.
TITLE Nucleotide and predicted amino acid sequence of a cDNA clone
encoding part of human transketolase
JOURNAL Biochem. Biophys. Res. Commun. 183 (3), 1159-1166 (1992)
PUBMED 1567394
REFERENCE 9 (bases 1 to 2957)
AUTHORS Lapsys,N.M., Layfield,R., Baker,E., Callen,D.F., Sutherland,G.R.,
Abedinia,M., Nixon,P.F. and Mattick,J.S.
TITLE Chromosomal location of the human transketolase gene
JOURNAL Cytogenet. Cell Genet. 61 (4), 274-275 (1992)
PUBMED 1486804
REFERENCE 10 (bases 1 to 2957)
AUTHORS Mocali,A. and Paoletti,F.
TITLE Transketolase from human leukocytes. Isolation, properties and
induction of polyclonal antibodies
JOURNAL Eur. J. Biochem. 180 (1), 213-219 (1989)
PUBMED 2495942
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB503248.1, BX647248.1,
AC097015.2 and BE504944.1.
This sequence is a reference standard in the RefSeqGene project.
On Sep 10, 2010 this sequence version replaced gi:205277462.
Summary: This gene encodes a thiamine-dependent enzyme which plays
a role in the channeling of excess sugar phosphates to glycolysis
in the pentose phosphate pathway. Alternatively spliced transcript
variants encoding multiple isoforms have been observed for this
gene. [provided by RefSeq, Apr 2012].
Transcript Variant: This variant (2) represents the longest
transcript. Variants 1 and 2 encode the same isoform (1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BX647248.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025088 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-114 DB503248.1 1-114
115-2661 BX647248.1 1-2547
2662-2944 AC097015.2 83739-84021 c
2945-2957 BE504944.1 1-13 c
FEATURES Location/Qualifiers
source 1..2957
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3p14.3"
gene 1..2957
/gene="TKT"
/gene_synonym="TK; TKT1"
/note="transketolase"
/db_xref="GeneID:7086"
/db_xref="HGNC:11834"
/db_xref="MIM:606781"
exon 1..279
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
variation 122
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="g"
/replace="t"
/db_xref="dbSNP:17030930"
CDS 173..2044
/gene="TKT"
/gene_synonym="TK; TKT1"
/EC_number="2.2.1.1"
/note="isoform 1 is encoded by transcript variant 2"
/codon_start=1
/product="transketolase isoform 1"
/protein_id="NP_001128527.1"
/db_xref="GI:205277463"
/db_xref="CCDS:CCDS2871.1"
/db_xref="GeneID:7086"
/db_xref="HGNC:11834"
/db_xref="MIM:606781"
/translation="
MESYHKPDQQKLQALKDTANRLRISSIQATTAAGSGHPTSCCSAAEIMAVLFFHTMRYKSQDPRNPHNDRFVLSKGHAAPILYAVWAEAGFLAEAELLNLRKISSDLDGHPVPKQAFTDVATGSLGQGLGAACGMAYTGKYFDKASYRVYCLLGDGELSEGSVWEAMAFASIYKLDNLVAILDINRLGQSDPAPLQHQMDIYQKRCEAFGWHAIIVDGHSVEELCKAFGQAKHQPTAIIAKTFKGRGITGVEDKESWHGKPLPKNMAEQIIQEIYSQIQSKKKILATPPQEDAPSVDIANIRMPSLPSYKVGDKIATRKAYGQALAKLGHASDRIIALDGDTKNSTFSEIFKKEHPDRFIECYIAEQNMVSIAVGCATRNRTVPFCSTFAAFFTRAFDQIRMAAISESNINLCGSHCGVSIGEDGPSQMALEDLAMFRSVPTSTVFYPSDGVATEKAVELAANTKGICFIRTSRPENAIIYNNNEDFQVGQAKVVLKSKDDQVTVIGAGVTLHEALAAAELLKKEKINIRVLDPFTIKPLDRKLILDSARATKGRILTVEDHYYEGGIGEAVSSAVVGEPGITVTHLAVNRVPRSGKPAELLKMFGIDRDAIAQAVRGLITKA
"
misc_feature 173..175
/gene="TKT"
/gene_synonym="TK; TKT1"
/experiment="experimental evidence, no additional details
recorded"
/note="N-acetylmethionine; propagated from
UniProtKB/Swiss-Prot (P29401.3); acetylation site"
misc_feature 188..190
/gene="TKT"
/gene_synonym="TK; TKT1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P29401.3); acetylation site"
misc_feature 194..2032
/gene="TKT"
/gene_synonym="TK; TKT1"
/note="transketolase; Reviewed; Region: PRK05899"
/db_xref="CDD:180309"
misc_feature 203..205
/gene="TKT"
/gene_synonym="TK; TKT1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P29401.3); acetylation site"
misc_feature 230..964
/gene="TKT"
/gene_synonym="TK; TKT1"
/note="Thiamine pyrophosphate (TPP) family, Transketolase
(TK) subfamily, TPP-binding module; TK catalyzes the
transfer of a two-carbon unit from ketose phosphates to
aldose phosphates. In heterotrophic organisms, TK provides
a link between glycolysis and the...; Region: TPP_TK;
cd02012"
/db_xref="CDD:48175"
misc_feature 281..283
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="Important for catalytic activity (By similarity);
propagated from UniProtKB/Swiss-Prot (P29401.3); other
site"
misc_feature order(401..403,539..541,545..547,635..640,650..652,
725..727,731..733,737..739,944..946)
/gene="TKT"
/gene_synonym="TK; TKT1"
/note="TPP-binding site [chemical binding]; other site"
/db_xref="CDD:48175"
misc_feature order(473..475,497..502,506..508,542..547,551..553,
644..655,662..667,674..676,686..688,734..739,785..787)
/gene="TKT"
/gene_synonym="TK; TKT1"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:48175"
misc_feature 602..604
/gene="TKT"
/gene_synonym="TK; TKT1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P29401.3); acetylation site"
misc_feature 782..784
/gene="TKT"
/gene_synonym="TK; TKT1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P29401.3); acetylation site"
misc_feature 893..895
/gene="TKT"
/gene_synonym="TK; TKT1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P29401.3); acetylation site"
misc_feature 944..946
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="Important for catalytic activity (By similarity);
propagated from UniProtKB/Swiss-Prot (P29401.3); other
site"
misc_feature 950..952
/gene="TKT"
/gene_synonym="TK; TKT1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P29401.3); acetylation site"
misc_feature 995..997
/gene="TKT"
/gene_synonym="TK; TKT1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (P29401.3); phosphorylation site"
misc_feature 1031..1033
/gene="TKT"
/gene_synonym="TK; TKT1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (P29401.3); phosphorylation site"
misc_feature 1055..1057
/gene="TKT"
/gene_synonym="TK; TKT1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P29401.3); phosphorylation site"
misc_feature 1127..1594
/gene="TKT"
/gene_synonym="TK; TKT1"
/note="Pyrimidine (PYR) binding domain of
1-deoxy-D-xylulose-5-phosphate synthase (DXS),
transketolase (TK), and related proteins; Region:
TPP_PYR_DXS_TK_like; cd07033"
/db_xref="CDD:132916"
misc_feature order(1169..1171,1175..1177,1193..1195,1244..1246,
1253..1255,1259..1276,1283..1288,1292..1300,1355..1357,
1364..1369,1442..1444,1451..1453,1499..1504,1565..1567)
/gene="TKT"
/gene_synonym="TK; TKT1"
/note="PYR/PP interface [polypeptide binding]; other site"
/db_xref="CDD:132916"
misc_feature order(1193..1195,1253..1255,1262..1270,1352..1357,
1361..1363,1442..1444,1448..1450,1475..1480,1484..1489,
1493..1495)
/gene="TKT"
/gene_synonym="TK; TKT1"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:132916"
misc_feature order(1262..1264,1268..1270,1346..1348,1355..1357)
/gene="TKT"
/gene_synonym="TK; TKT1"
/note="TPP binding site [chemical binding]; other site"
/db_xref="CDD:132916"
misc_feature 1646..2008
/gene="TKT"
/gene_synonym="TK; TKT1"
/note="Transketolase, C-terminal domain; Region:
Transketolase_C; pfam02780"
/db_xref="CDD:202391"
misc_feature 1979..1981
/gene="TKT"
/gene_synonym="TK; TKT1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P29401.3); acetylation site"
variation 224
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:78293061"
variation 264
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11556005"
exon 280..397
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
variation 326
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11556004"
exon 398..511
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
variation 424
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:11556006"
exon 512..609
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
variation 565
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11556002"
exon 610..801
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
variation 637
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1051483"
variation 754
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051485"
exon 802..920
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
exon 921..1114
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
exon 1115..1279
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
variation 1267
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1131728"
exon 1280..1436
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
STS 1387..1586
/gene="TKT"
/gene_synonym="TK; TKT1"
/standard_name="MARC_13462-13463:1002299004:1"
/db_xref="UniSTS:267499"
exon 1437..1567
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
variation 1508
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11556003"
exon 1568..1651
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
exon 1652..1745
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
variation 1710
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2229694"
exon 1746..1868
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
STS 1862..2008
/gene="TKT"
/gene_synonym="TK; TKT1"
/standard_name="WI-18916"
/db_xref="UniSTS:6220"
exon 1869..2049
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
variation 1966
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="a"
/replace="g"
/db_xref="dbSNP:3163"
variation 2039
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1802929"
exon 2050..2952
/gene="TKT"
/gene_synonym="TK; TKT1"
/inference="alignment:Splign:1.39.8"
STS 2586..2917
/gene="TKT"
/gene_synonym="TK; TKT1"
/standard_name="SHGC-57226"
/db_xref="UniSTS:55105"
variation 2621
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056076"
variation 2863
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1056082"
variation 2902
/gene="TKT"
/gene_synonym="TK; TKT1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1056083"
polyA_signal 2928..2933
/gene="TKT"
/gene_synonym="TK; TKT1"
polyA_site 2952
/gene="TKT"
/gene_synonym="TK; TKT1"
ORIGIN
gatccgagccccgcctcctccccctgccccgcctctcccatccccgccccgccccgcccggcgacttaacgcgcccccgccccgcgcccggcctcggcagccgcctgtcgccgcgggagcagccgctatctctgtgtgtccgcgtgtgcgcccggtccccgcctgccgcaccatggagagctaccacaagcctgaccagcagaagctgcaggccttgaaggacacggccaaccgcctacgtatcagctccatccaggccaccactgcggcgggctctggccaccccacgtcatgctgcagcgccgcagagatcatggctgtcctctttttccacaccatgcgctacaagtcccaggacccccggaatccgcacaatgaccgctttgtgctctccaagggccatgcagctcccatcctctacgcggtctgggctgaagctggtttcctggccgaggcggagctgctgaacctgaggaagatcagctccgacttggacgggcacccggtcccgaaacaagctttcaccgacgtggccactggctccctgggccagggcctcggggccgcttgtgggatggcctacaccggcaaatacttcgacaaggccagctaccgagtctattgcttgctgggagacggggagctgtcagagggctctgtatgggaggccatggccttcgccagcatctataagctggacaaccttgtggccattctagacatcaatcgcctgggccagagtgacccggccccactgcagcaccagatggacatctaccagaagcggtgcgaggccttcggttggcatgccatcatcgtggatggacacagcgtggaggagctgtgcaaggcctttggccaggccaagcaccagccaacagccatcattgccaagaccttcaagggccgagggatcacgggggtagaagataaggagtcttggcatgggaagcccctccccaaaaacatggctgagcagatcatccaggagatctacagccagatccagagcaaaaagaagatcctggcaacccctccacaggaggacgcaccctcagtggacattgccaacatccgcatgcccagcctgcccagctacaaagttggggacaagatagccacccgcaaggcctacgggcaggcactggccaagctgggccatgccagtgaccgcatcatcgccctggatggggacaccaaaaattccaccttctcggagatcttcaaaaaggagcacccggaccgcttcatcgagtgctacattgctgagcagaacatggtgagcatcgcggtgggctgtgccacccgcaacaggacggtgcccttctgcagcacttttgcagccttcttcacgcgggcctttgaccagattcgcatggccgccatctccgagagcaacatcaacctctgcggctcccactgcggcgtttccatcggggaagacgggccctcccagatggccctagaagatctggctatgtttcggtcagtccccacatcaactgtcttttacccaagtgatggcgttgctacagagaaggcagtggaactagccgccaatacaaagggtatctgcttcatccggaccagccgcccagaaaatgccatcatctataacaacaatgaggacttccaggtcggacaagccaaggtggtcctgaagagcaaggatgaccaggtgaccgttatcggggctggggtgaccctgcacgaggccttggccgctgccgaactgctgaagaaagaaaagatcaacatccgcgtgctggaccccttcaccatcaagcccctggacagaaaactcattctcgacagcgctcgtgccaccaagggcaggatcctcaccgtggaggaccattattatgaaggtggcattggtgaggctgtgtccagtgcagtagtgggcgagcctggcatcactgtcacccacctggcagttaaccgggtaccaagaagtgggaagccggctgagctgctgaagatgtttggtatcgacagggatgccattgcacaagctgtgaggggcctcatcaccaaggcctagggcggccagtgcaggttctggggaagaagcgtggagggtgcgctagggaggctggtgtccttggtcctgggccaggacctgggtgtcccaagtccccttggaatcacctgcaactgccctcaacctccagaactatcgctgcctcccattcatcaccaggtgacatttgactgcaacctgccttctagctgagaggctgagacctacatccctcattgtgacctcagtccacctggccctgagcgggctggggaactgcctcagtctggaagctgaccaggcactctcagggccgccccacctcccccaagtccccacagccttgcagtcaggtctcctgggatagggaggttcacttgcttgttgtccctcgtccttgtcatatccttttaactaggcatctcagagaagcagagacagggcagccttcgtcctgggggaaaagggaccctcaggatggcatgagaggtcctcaatcccaagtgtggaactgtccccctcaacttgttaaaatgcagatttctgggtcttgccaatggggcctgggactccatgtgacaactggcccaggagcttctgatgtcacacagaattctgcagtcccaagctccagccccgacctgctctgctgttcctaggtgactgccctcacactgctgaccacagtggatttctccccctgctgctcgggctcagctggggtcagccctgcttataaggtcaactgtgcaaaaccttatactggccaagaacaaactagtgctgggggaggagggctgggtgccccggccactggtggagtccccaggaaatcctcagagctgttgcgaggatgagacacatttgtggacacgtccacctgtcctcctgaccgtctggagagaataaacctgtcaaagccaaggtcaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:7086 -> Molecular function: GO:0004802 [transketolase activity] evidence: EXP
GeneID:7086 -> Molecular function: GO:0004802 [transketolase activity] evidence: IDA
GeneID:7086 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IDA
GeneID:7086 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
GeneID:7086 -> Molecular function: GO:0048037 [cofactor binding] evidence: IDA
GeneID:7086 -> Biological process: GO:0005975 [carbohydrate metabolic process] evidence: TAS
GeneID:7086 -> Biological process: GO:0005999 [xylulose biosynthetic process] evidence: TAS
GeneID:7086 -> Biological process: GO:0006098 [pentose-phosphate shunt] evidence: TAS
GeneID:7086 -> Biological process: GO:0006112 [energy reserve metabolic process] evidence: TAS
GeneID:7086 -> Biological process: GO:0009052 [pentose-phosphate shunt, non-oxidative branch] evidence: NAS
GeneID:7086 -> Biological process: GO:0040008 [regulation of growth] evidence: IEA
GeneID:7086 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:7086 -> Biological process: GO:0046166 [glyceraldehyde-3-phosphate biosynthetic process] evidence: IDA
GeneID:7086 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:7086 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:7086 -> Cellular component: GO:0005777 [peroxisome] evidence: ISS
GeneID:7086 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001128527 -> EC 2.2.1.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.