2024-03-28 20:39:28, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001135000 2161 bp mRNA linear PRI 01-JUL-2013 DEFINITION Homo sapiens fermitin family member 2 (FERMT2), transcript variant 3, mRNA. ACCESSION NM_001135000 VERSION NM_001135000.1 GI:201861822 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2161) AUTHORS Zhao,T., Guan,L., Yu,Y., Pei,X., Zhan,J., Han,L., Tang,Y., Li,F., Fang,W. and Zhang,H. TITLE Kindlin-2 promotes genome instability in breast cancer cells JOURNAL Cancer Lett. 330 (2), 208-216 (2013) PUBMED 23211537 REMARK GeneRIF: Kindlin-2 regulates breast cancer progression by inducing genome instability. REFERENCE 2 (bases 1 to 2161) AUTHORS Gao,J., Khan,A.A., Shimokawa,T., Zhan,J., Stromblad,S., Fang,W. and Zhang,H. TITLE A feedback regulation between Kindlin-2 and GLI1 in prostate cancer cells JOURNAL FEBS Lett. 587 (6), 631-638 (2013) PUBMED 23337877 REMARK GeneRIF: A novel regulatory loop has been described between GLI1 and Kindlin-2 that determines cancer cell viability. REFERENCE 3 (bases 1 to 2161) AUTHORS Shen,Z., Ye,Y., Kauttu,T., Seppanen,H., Vainionpaa,S., Wang,S., Mustonen,H. and Puolakkainen,P. TITLE The novel focal adhesion gene kindlin-2 promotes the invasion of gastric cancer cells mediated by tumor-associated macrophages JOURNAL Oncol. Rep. 29 (2), 791-797 (2013) PUBMED 23151599 REMARK GeneRIF: the novel focal adhesion gene kindlin-2 may play an important role in promoting the invasion of gastric cancer cells mediated by tumor-associated macrophages through regulating interleukin expression. REFERENCE 4 (bases 1 to 2161) AUTHORS Yu,Y., Wu,J., Wang,Y., Zhao,T., Ma,B., Liu,Y., Fang,W., Zhu,W.G. and Zhang,H. TITLE Kindlin 2 forms a transcriptional complex with beta-catenin and TCF4 to enhance Wnt signalling JOURNAL EMBO Rep. 13 (8), 750-758 (2012) PUBMED 22699938 REMARK GeneRIF: Kindlin 2 forms a tripartite complex with beta-catenin and TCF4. REFERENCE 5 (bases 1 to 2161) AUTHORS Zhan,J., Zhu,X., Guo,Y., Wang,Y., Wang,Y., Qiang,G., Niu,M., Hu,J., Du,J., Li,Z., Cui,J., Ma,B., Fang,W. and Zhang,H. TITLE Opposite role of Kindlin-1 and Kindlin-2 in lung cancers JOURNAL PLoS ONE 7 (11), E50313 (2012) PUBMED 23209705 REMARK GeneRIF: Kindlin-1 and Kindlin-2 have opposite roles in lung cancers REFERENCE 6 (bases 1 to 2161) AUTHORS Siegel,D.H., Ashton,G.H., Penagos,H.G., Lee,J.V., Feiler,H.S., Wilhelmsen,K.C., South,A.P., Smith,F.J., Prescott,A.R., Wessagowit,V., Oyama,N., Akiyama,M., Al Aboud,D., Al Aboud,K., Al Githami,A., Al Hawsawi,K., Al Ismaily,A., Al-Suwaid,R., Atherton,D.J., Caputo,R., Fine,J.D., Frieden,I.J., Fuchs,E., Haber,R.M., Harada,T., Kitajima,Y., Mallory,S.B., Ogawa,H., Sahin,S., Shimizu,H., Suga,Y., Tadini,G., Tsuchiya,K., Wiebe,C.B., Wojnarowska,F., Zaghloul,A.B., Hamada,T., Mallipeddi,R., Eady,R.A., McLean,W.H., McGrath,J.A. and Epstein,E.H. TITLE Loss of kindlin-1, a human homolog of the Caenorhabditis elegans actin-extracellular-matrix linker protein UNC-112, causes Kindler syndrome JOURNAL Am. J. Hum. Genet. 73 (1), 174-187 (2003) PUBMED 12789646 REFERENCE 7 (bases 1 to 2161) AUTHORS Weinstein,E.J., Bourner,M., Head,R., Zakeri,H., Bauer,C. and Mazzarella,R. TITLE URP1: a member of a novel family of PH and FERM domain-containing membrane-associated proteins is significantly over-expressed in lung and colon carcinomas JOURNAL Biochim. Biophys. Acta 1637 (3), 207-216 (2003) PUBMED 12697302 REFERENCE 8 (bases 1 to 2161) AUTHORS Tu,Y., Wu,S., Shi,X., Chen,K. and Wu,C. TITLE Migfilin and Mig-2 link focal adhesions to filamin and the actin cytoskeleton and function in cell shape modulation JOURNAL Cell 113 (1), 37-47 (2003) PUBMED 12679033 REFERENCE 9 (bases 1 to 2161) AUTHORS Heilig,R., Eckenberg,R., Petit,J.L., Fonknechten,N., Da Silva,C., Cattolico,L., Levy,M., Barbe,V., de Berardinis,V., Ureta-Vidal,A., Pelletier,E., Vico,V., Anthouard,V., Rowen,L., Madan,A., Qin,S., Sun,H., Du,H., Pepin,K., Artiguenave,F., Robert,C., Cruaud,C., Bruls,T., Jaillon,O., Friedlander,L., Samson,G., Brottier,P., Cure,S., Segurens,B., Aniere,F., Samain,S., Crespeau,H., Abbasi,N., Aiach,N., Boscus,D., Dickhoff,R., Dors,M., Dubois,I., Friedman,C., Gouyvenoux,M., James,R., Madan,A., Mairey-Estrada,B., Mangenot,S., Martins,N., Menard,M., Oztas,S., Ratcliffe,A., Shaffer,T., Trask,B., Vacherie,B., Bellemere,C., Belser,C., Besnard-Gonnet,M., Bartol-Mavel,D., Boutard,M., Briez-Silla,S., Combette,S., Dufosse-Laurent,V., Ferron,C., Lechaplais,C., Louesse,C., Muselet,D., Magdelenat,G., Pateau,E., Petit,E., Sirvain-Trukniewicz,P., Trybou,A., Vega-Czarny,N., Bataille,E., Bluet,E., Bordelais,I., Dubois,M., Dumont,C., Guerin,T., Haffray,S., Hammadi,R., Muanga,J., Pellouin,V., Robert,D., Wunderle,E., Gauguet,G., Roy,A., Sainte-Marthe,L., Verdier,J., Verdier-Discala,C., Hillier,L., Fulton,L., McPherson,J., Matsuda,F., Wilson,R., Scarpelli,C., Gyapay,G., Wincker,P., Saurin,W., Quetier,F., Waterston,R., Hood,L. and Weissenbach,J. TITLE The DNA sequence and analysis of human chromosome 14 JOURNAL Nature 421 (6923), 601-607 (2003) PUBMED 12508121 REFERENCE 10 (bases 1 to 2161) AUTHORS Wick,M., Burger,C., Brusselbach,S., Lucibello,F.C. and Muller,R. TITLE Identification of serum-inducible genes: different patterns of gene regulation during G0-->S and G1-->S progression JOURNAL J. Cell. Sci. 107 (PT 1), 227-239 (1994) PUBMED 8175911 REMARK Erratum:[J Cell Sci. 1994 Mar;107 ( Pt 3):preceding table of contents. PMID: 8006057] COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from BC017327.2 and BX161467.1. Transcript Variant: This variant (3) contains an additional in-frame coding exon and is missing the 3' terminal exon compared to variant 1. This results in a shorter isoform (3) with a distinct C-terminus and an internal 7 aa segment missing in isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BX161467.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-79 BC017327.2 1-79 80-2161 BX161467.1 1-2082 FEATURES Location/Qualifiers source 1..2161 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="14" /map="14q22.1" gene 1..2161 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /note="fermitin family member 2" /db_xref="GeneID:10979" /db_xref="HGNC:15767" /db_xref="MIM:607746" exon 1..177 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" variation 157 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /replace="c" /replace="t" /db_xref="dbSNP:2297300" misc_feature 166..168 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /note="upstream in-frame stop codon" exon 178..343 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" CDS 187..2088 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /note="isoform 3 is encoded by transcript variant 3; pleckstrin homology domain containing, family C (with FERM domain) member 1; kindlin-2; mitogen inducible gene 2 protein; pleckstrin homology domain containing, family C member 1; kindlin 2; mitogen-inducible gene 2 protein; PH domain-containing family C member 1; pleckstrin homology domain-containing family C member 1; fermitin family homolog 2" /codon_start=1 /product="fermitin family homolog 2 isoform 3" /protein_id="NP_001128472.1" /db_xref="GI:201861823" /db_xref="CCDS:CCDS45108.1" /db_xref="GeneID:10979" /db_xref="HGNC:15767" /db_xref="MIM:607746" /translation="
MALDGIRMPDGCYADGTWELSVHVTDLNRDVTLRVTGEVHIGGVMLKLVEKLDVKKDWSDHALWWEKKRTWLLKTHWTLDKYGIQADAKLQFTPQHKLLRLQLPNMKYVKVKVNFSDRVFKAVSDICKTFNIRHPEELSLLKKPRDPTKKKKKKLDDQSEDEALELEGPLITPGSGSIYSSPGLYSKTMTPTYDAHDGSPLSPTSAWFGDSALSEGNPGILAVSQPITSPEILAKMFKPQALLDKAKINQGWLDSSRSLMEQDVKENEALLLRFKYYSFFDLNPKYDAIRINQLYEQAKWAILLEEIECTEEEMMMFAALQYHINKLSIMTSENHLNNSDKEVDEVDAALSDLEITLEGGKTSTILGDITSIPELADYIKVFKPKKLTLKGYKQYWCTFKDTSISCYKSKEESSGTPAHQMNLRGCEVTPDVNISGQKFNIKLLIPVAEGMNEIWLRCDNEKQYAHWMAACRLASKGKTMADSSYNLEVQNILSFLKMQHLNPDPQLIPEQITTDITPECLVSPRYLKKYKNKQPGYIRDLITARILEAHQNVAQMSLIEAKMRFIQAWQSLPEFGITHFIARFQGGKKEELIGIAYNRLIRMDASTGDAIKTWRFSNMKQWNVNWEIKMVNS
" misc_feature 304..429 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q96AC1.1); Region: Interaction with membranes containing phosphatidylinositol phosphate" misc_feature 661..663 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q96AC1.1); phosphorylation site" misc_feature 727..729 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q96AC1.1); phosphorylation site" misc_feature <907..>1158 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /note="Band 4.1 homologues; Region: B41; smart00295" /db_xref="CDD:197635" misc_feature 1039..>1164 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /note="FERM central domain; Region: FERM_M; pfam00373" /db_xref="CDD:201187" misc_feature 1201..1203 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q96AC1.1); phosphorylation site" misc_feature 1237..1239 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q96AC1.1); phosphorylation site" misc_feature 1303..1620 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /note="Unc-112 pleckstrin homology (PH) domain; Region: Unc112; cd01237" /db_xref="CDD:176313" misc_feature order(1309..1332,1363..1386,1390..1410,1441..1479, 1504..1524,1543..1560,1573..1608) /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /note="core domain; other site" /db_xref="CDD:176313" misc_feature <1759..1926 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /note="FERM central domain; Region: FERM_M; pfam00373" /db_xref="CDD:201187" exon 344..577 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" exon 578..712 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" STS 649..1009 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /standard_name="Plekhc1" /db_xref="UniSTS:498247" exon 713..938 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" exon 939..1041 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" exon 1042..1149 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" exon 1150..1284 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" variation 1263 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1130597" exon 1285..1334 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" exon 1335..1459 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" exon 1460..1566 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" exon 1567..1788 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" exon 1789..1809 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" exon 1810..1934 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" exon 1935..2161 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" /inference="alignment:Splign:1.39.8" polyA_signal 2138..2143 /gene="FERMT2" /gene_synonym="KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B" ORIGIN
gggtggagcgcggggagccaggcgaggggccgcgacgacgggactccattagccgctccggccacaggcagcgcttcgccagccgaggaaccggacgcggacaccgccgccccgcgagcctccagcccctcgcctgttgccgcgcgagtcccgggcccggagcgctaggagcgcgcggaaggagccatggctctggacgggataaggatgccagatggctgctacgcggacgggacgtgggaactgagtgtccatgtgacggacctgaaccgcgatgtcaccctgagagtgaccggcgaggtgcacattggaggcgtgatgcttaagctggtggagaaactcgatgtaaaaaaagattggtctgaccatgctctctggtgggaaaagaagagaacttggcttctgaagacacattggaccttagataagtatggtattcaggcagatgctaagcttcagttcacccctcagcacaaactgctccgcctgcagcttcccaacatgaagtatgtgaaggtgaaagtgaatttctctgatagagtcttcaaagctgtttctgacatctgtaagacttttaatatcagacaccccgaagaactttctctcttaaagaaacccagagatccaacaaagaaaaaaaagaagaagctagatgaccagtctgaagatgaggcacttgaattagaggggcctcttatcactcctggatcaggaagtatatattcaagcccaggactgtatagtaaaacaatgacccccacttatgatgctcatgatggaagccccttgtcaccaacttctgcttggtttggtgacagtgctttgtcagaaggcaatcctggtatacttgctgtcagtcaaccaatcacgtcaccagaaatcttggcaaaaatgttcaagcctcaagctcttcttgataaagcaaaaatcaaccaaggatggcttgattcctcaagatctctcatggaacaagatgtgaaggaaaatgaggccttgctgctccgattcaagtattacagcttttttgatttgaatccaaagtatgatgcaatcagaatcaatcagctttacgagcaggccaaatgggccattctcctggaagagattgaatgcacagaagaagaaatgatgatgtttgcagccctgcagtatcatatcaataagctgtcaatcatgacatcagagaatcatttgaacaacagtgacaaagaagttgatgaagttgatgctgccctttcagacctggagattactctggaagggggtaaaacgtcaacaattttgggtgacattacttccattcctgaacttgctgactacattaaagttttcaagccaaaaaagctgactctgaaaggttacaaacaatattggtgcaccttcaaagacacatccatttcttgttataagagcaaagaagaatccagtggcacaccagctcatcagatgaacctcaggggatgtgaagttaccccagatgtaaacatttcaggccaaaaatttaacattaaactcctgattccagttgcagaaggcatgaatgaaatctggcttcgttgtgacaatgaaaaacagtatgcacactggatggcagcctgcagattagcctccaaaggcaagaccatggcggacagttcttacaacttagaagttcagaatattctttcctttctgaagatgcagcatttaaacccagatcctcagttaataccagagcagatcacgactgatataactcctgaatgtttggtgtctccccgctatctaaaaaagtataagaacaagcagccaggctatataagagatttgataacagcgagaatcttggaggcccatcagaatgtagctcagatgagtctaattgaagccaagatgagatttattcaagcttggcagtcactacctgaatttggcatcactcacttcattgcaaggttccaagggggcaaaaaagaagaacttattggaattgcatacaacagactgattcggatggatgccagcactggagatgcaattaaaacatggcgtttcagcaacatgaaacagtggaatgtcaactgggaaatcaaaatggtaaactcataacaatgttacttgaatatagtccttctctgatacaaattagtacattaagaataaaaaggcctataaattctga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:10979 -> Molecular function: GO:0005547 [phosphatidylinositol-3,4,5-trisphosphate binding] evidence: IDA GeneID:10979 -> Biological process: GO:0007160 [cell-matrix adhesion] evidence: IMP GeneID:10979 -> Biological process: GO:0007160 [cell-matrix adhesion] evidence: ISS GeneID:10979 -> Biological process: GO:0007179 [transforming growth factor beta receptor signaling pathway] evidence: IMP GeneID:10979 -> Biological process: GO:0007229 [integrin-mediated signaling pathway] evidence: IMP GeneID:10979 -> Biological process: GO:0008360 [regulation of cell shape] evidence: IEA GeneID:10979 -> Biological process: GO:0016055 [Wnt receptor signaling pathway] evidence: IMP GeneID:10979 -> Biological process: GO:0030036 [actin cytoskeleton organization] evidence: NAS GeneID:10979 -> Biological process: GO:0033622 [integrin activation] evidence: IMP GeneID:10979 -> Biological process: GO:0034329 [cell junction assembly] evidence: TAS GeneID:10979 -> Biological process: GO:0034446 [substrate adhesion-dependent cell spreading] evidence: ISS GeneID:10979 -> Biological process: GO:0048041 [focal adhesion assembly] evidence: ISS GeneID:10979 -> Biological process: GO:0072657 [protein localization to membrane] evidence: ISS GeneID:10979 -> Cellular component: GO:0001725 [stress fiber] evidence: IEA GeneID:10979 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:10979 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA GeneID:10979 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:10979 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:10979 -> Cellular component: GO:0005925 [focal adhesion] evidence: IDA GeneID:10979 -> Cellular component: GO:0005938 [cell cortex] evidence: IEA GeneID:10979 -> Cellular component: GO:0009986 [cell surface] evidence: IEA GeneID:10979 -> Cellular component: GO:0031234 [extrinsic to internal side of plasma membrane] evidence: IDA GeneID:10979 -> Cellular component: GO:0031258 [lamellipodium membrane] evidence: IEA GeneID:10979 -> Cellular component: GO:0031674 [I band] evidence: IEA GeneID:10979 -> Cellular component: GO:0031941 [filamentous actin] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.