GGRNA Home | Help | Advanced search

2019-03-26 15:44:24, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001134738            3086 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens B-cell CLL/lymphoma 6 (BCL6), transcript variant 3,
            mRNA.
ACCESSION   NM_001134738
VERSION     NM_001134738.1  GI:197927146
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3086)
  AUTHORS   Horn H, Ziepert M, Becher C, Barth TF, Bernd HW, Feller AC, Klapper
            W, Hummel M, Stein H, Hansmann ML, Schmelter C, Moller P, Cogliatti
            S, Pfreundschuh M, Schmitz N, Trumper L, Siebert R, Loeffler M,
            Rosenwald A and Ott G.
  CONSRTM   German High-Grade Non-Hodgkin Lymphoma Study Group
  TITLE     MYC status in concert with BCL2 and BCL6 expression predicts
            outcome in diffuse large B-cell lymphoma
  JOURNAL   Blood 121 (12), 2253-2263 (2013)
   PUBMED   23335369
  REMARK    GeneRIF: Protein expression patterns of MYC, BCL2 and BCL6, and MYC
            rearrangements were predictive of outcome and provided prognostic
            information independent of the International Prognostic Index (IPI)
            for overall survival and event-free survival.
REFERENCE   2  (bases 1 to 3086)
  AUTHORS   Pillai,R.K., Sathanoori,M., Van Oss,S.B. and Swerdlow,S.H.
  TITLE     Double-hit B-cell lymphomas with BCL6 and MYC translocations are
            aggressive, frequently extranodal lymphomas distinct from BCL2
            double-hit B-cell lymphomas
  JOURNAL   Am. J. Surg. Pathol. 37 (3), 323-332 (2013)
   PUBMED   23348205
  REMARK    GeneRIF: Double-hit BCL6/MYC lymphomas are aggressive, frequently
            involve extranodal sites, and often have a germinal center
            phenotype
REFERENCE   3  (bases 1 to 3086)
  AUTHORS   Tucci,F.A., Broering,R., Johansson,P., Schlaak,J.F. and Kuppers,R.
  TITLE     B cells in chronically hepatitis C virus-infected individuals lack
            a virus-induced mutation signature in the TP53, CTNNB1, and BCL6
            genes
  JOURNAL   J. Virol. 87 (5), 2956-2962 (2013)
   PUBMED   23269799
  REMARK    GeneRIF: study concludes that in chronic HCV carriers, the virus
            does not generally induce mutations in the cancer-related genes
            TP53, CTNNB1, and BCL6 in B cells
REFERENCE   4  (bases 1 to 3086)
  AUTHORS   Basso,K., Schneider,C., Shen,Q., Holmes,A.B., Setty,M., Leslie,C.
            and Dalla-Favera,R.
  TITLE     BCL6 positively regulates AID and germinal center gene expression
            via repression of miR-155
  JOURNAL   J. Exp. Med. 209 (13), 2455-2465 (2012)
   PUBMED   23166356
  REMARK    GeneRIF: Among BCL6 validated targets, miR-155 and miR-361 directly
            modulate AID expression, indicating that via repression of these
            miRNAs, BCL6 up-regulates AID.
REFERENCE   5  (bases 1 to 3086)
  AUTHORS   Hancock,D.B., Artigas,M.S., Gharib,S.A., Henry,A., Manichaikul,A.,
            Ramasamy,A., Loth,D.W., Imboden,M., Koch,B., McArdle,W.L.,
            Smith,A.V., Smolonska,J., Sood,A., Tang,W., Wilk,J.B., Zhai,G.,
            Zhao,J.H., Aschard,H., Burkart,K.M., Curjuric,I., Eijgelsheim,M.,
            Elliott,P., Gu,X., Harris,T.B., Janson,C., Homuth,G., Hysi,P.G.,
            Liu,J.Z., Loehr,L.R., Lohman,K., Loos,R.J., Manning,A.K.,
            Marciante,K.D., Obeidat,M., Postma,D.S., Aldrich,M.C.,
            Brusselle,G.G., Chen,T.H., Eiriksdottir,G., Franceschini,N.,
            Heinrich,J., Rotter,J.I., Wijmenga,C., Williams,O.D., Bentley,A.R.,
            Hofman,A., Laurie,C.C., Lumley,T., Morrison,A.C., Joubert,B.R.,
            Rivadeneira,F., Couper,D.J., Kritchevsky,S.B., Liu,Y., Wjst,M.,
            Wain,L.V., Vonk,J.M., Uitterlinden,A.G., Rochat,T., Rich,S.S.,
            Psaty,B.M., O'Connor,G.T., North,K.E., Mirel,D.B., Meibohm,B.,
            Launer,L.J., Khaw,K.T., Hartikainen,A.L., Hammond,C.J., Glaser,S.,
            Marchini,J., Kraft,P., Wareham,N.J., Volzke,H., Stricker,B.H.,
            Spector,T.D., Probst-Hensch,N.M., Jarvis,D., Jarvelin,M.R.,
            Heckbert,S.R., Gudnason,V., Boezen,H.M., Barr,R.G., Cassano,P.A.,
            Strachan,D.P., Fornage,M., Hall,I.P., Dupuis,J., Tobin,M.D. and
            London,S.J.
  TITLE     Genome-wide joint meta-analysis of SNP and SNP-by-smoking
            interaction identifies novel loci for pulmonary function
  JOURNAL   PLoS Genet. 8 (12), E1003098 (2012)
   PUBMED   23284291
REFERENCE   6  (bases 1 to 3086)
  AUTHORS   Flenghi,L., Ye,B.H., Fizzotti,M., Bigerna,B., Cattoretti,G.,
            Venturi,S., Pacini,R., Pileri,S., Lo Coco,F., Pescarmona,E. et al.
  TITLE     A specific monoclonal antibody (PG-B6) detects expression of the
            BCL-6 protein in germinal center B cells
  JOURNAL   Am. J. Pathol. 147 (2), 405-411 (1995)
   PUBMED   7639334
REFERENCE   7  (bases 1 to 3086)
  AUTHORS   Cattoretti,G., Chang,C.C., Cechova,K., Zhang,J., Ye,B.H.,
            Falini,B., Louie,D.C., Offit,K., Chaganti,R.S. and Dalla-Favera,R.
  TITLE     BCL-6 protein is expressed in germinal-center B cells
  JOURNAL   Blood 86 (1), 45-53 (1995)
   PUBMED   7795255
REFERENCE   8  (bases 1 to 3086)
  AUTHORS   Onizuka,T., Moriyama,M., Yamochi,T., Kuroda,T., Kazama,A.,
            Kanazawa,N., Sato,K., Kato,T., Ota,H. and Mori,S.
  TITLE     BCL-6 gene product, a 92- to 98-kD nuclear phosphoprotein, is
            highly expressed in germinal center B cells and their neoplastic
            counterparts
  JOURNAL   Blood 86 (1), 28-37 (1995)
   PUBMED   7795234
REFERENCE   9  (bases 1 to 3086)
  AUTHORS   Lichter,P., Bray,P., Ried,T., Dawid,I.B. and Ward,D.C.
  TITLE     Clustering of C2-H2 zinc finger motif sequences within telomeric
            and fragile site regions of human chromosomes
  JOURNAL   Genomics 13 (4), 999-1007 (1992)
   PUBMED   1505991
REFERENCE   10 (bases 1 to 3086)
  AUTHORS   Bray,P., Lichter,P., Thiesen,H.J., Ward,D.C. and Dawid,I.B.
  TITLE     Characterization and mapping of human genes encoding zinc finger
            proteins
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 88 (21), 9563-9567 (1991)
   PUBMED   1946370
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from Z21943.1, EU883531.1,
            BC150184.1, BC146796.1 and AW337942.1.
            
            Summary: The protein encoded by this gene is a zinc finger
            transcription factor and contains an N-terminal POZ domain. This
            protein acts as a sequence-specific repressor of transcription, and
            has been shown to modulate the transcription of START-dependent
            IL-4 responses of B cells. This protein can interact with a variety
            of POZ-containing proteins that function as transcription
            corepressors. This gene is found to be frequently translocated and
            hypermutated in diffuse large-cell lymphoma (DLCL), and may be
            involved in the pathogenesis of DLCL. Alternatively spliced
            transcript variants encoding different protein isoforms have been
            found for this gene. [provided by RefSeq, Sep 2008].
            
            Transcript Variant: This variant (3) lacks a coding exon, as
            compared to variant 1. The reading frame is not affected and the
            resulting isoform (2) lacks an internal segment, as compared to
            isoform 2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: EU139066.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-49                Z21943.1           36-84
            50-1087             EU883531.1         1-1038
            1088-1589           BC150184.1         1120-1621
            1590-2002           EU883531.1         1541-1953
            2003-3079           BC146796.1         2233-3309
            3080-3086           AW337942.1         1-7                 c
FEATURES             Location/Qualifiers
     source          1..3086
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3q27"
     gene            1..3086
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /note="B-cell CLL/lymphoma 6"
                     /db_xref="GeneID:604"
                     /db_xref="HGNC:1001"
                     /db_xref="MIM:109565"
     exon            1..39
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    5..7
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /note="upstream in-frame stop codon"
     exon            40..210
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /inference="alignment:Splign:1.39.8"
     CDS             50..2002
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /note="isoform 2 is encoded by transcript variant 3;
                     lymphoma-associated zinc finger gene on chromosome 3; zinc
                     finger protein 51; cys-his2 zinc finger transcription
                     factor; zinc finger transcription factor BCL6S; B-cell
                     lymphoma 6 protein transcript; zinc finger and BTB
                     domain-containing protein 27; BCL-5; BCL-6; protein LAZ-3;
                     B-cell lymphoma 5 protein"
                     /codon_start=1
                     /product="B-cell lymphoma 6 protein isoform 2"
                     /protein_id="NP_001128210.1"
                     /db_xref="GI:197927147"
                     /db_xref="CCDS:CCDS46975.1"
                     /db_xref="GeneID:604"
                     /db_xref="HGNC:1001"
                     /db_xref="MIM:109565"
                     /translation="
MASPADSCIQFTRHASDVLLNLNRLRSRDILTDVVIVVSREQFRAHKTVLMACSGLFYSIFTDQLKCNLSVINLDPEINPEGFCILLDFMYTSRLNLREGNIMAVMATAMYLQMEHVVDTCRKFIKASEAEMVSAIKPPREEFLNSRMLMPQDIMAYRGREVVENNLPLRSAPGCESRAFAPSLYSGLSTPPASYSMYSHLPVSSLLFSDEEFRDVRMPVANPFPKERALPCDSARPVPGEYSRPTLEVSPNVCHSNIYSPKETIPEEARSDMHYSVAEGLKPAAPSARNAPYFPCDKASKEEERPSSEDEIALHFEPPNAPLNRKGLVSPQSPQKSDCQPNSPTESCSSKNACILQASGSPPAKSPTDPKACNWKKYKFIVLNSLNQNAKPEGPEQAELGRLSPRAYTAPPACQPPMEPENLDLQSPTKLSASGEDSTIPQASRLNNIVNRSMTGSPRSSSESHSPLYMHPPKCTSCGSQSPQHAEMCLHTAGPTFPEEMGETQSEYSDSSCGEKPYRCNICGAQFNRPANLKTHTRIHSGEKPYKCETCGARFVQVAHLRAHVLIHTGEKPYPCEICGTRFRHLQTLKSHLRIHTGEKPYHCEKCNLHFRHKSQLRLHLRQKHGAITNTKVQYRVSATDLPPELPKAC
"
     misc_feature    113..427
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /note="BTB/POZ domain; Region: BTB; pfam00651"
                     /db_xref="CDD:201372"
     misc_feature    1604..1669
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478"
                     /db_xref="CDD:210117"
     misc_feature    1643..1720
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    1727..1804
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    1814..1888
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     variation       131
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11545363"
     exon            211..432
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /inference="alignment:Splign:1.39.8"
     variation       363
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200844445"
     exon            433..1404
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /inference="alignment:Splign:1.39.8"
     variation       567
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11545364"
     STS             676..1057
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /standard_name="PMC309637P2"
                     /db_xref="UniSTS:272596"
     variation       676
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:33922911"
     variation       784
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2228258"
     variation       804
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34463990"
     variation       1210
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056932"
     variation       1227
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1056933"
     exon            1405..1589
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /inference="alignment:Splign:1.39.8"
     variation       1465
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201059480"
     variation       1526
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2229362"
     exon            1590..1720
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /inference="alignment:Splign:1.39.8"
     STS             1686..1788
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /standard_name="BCL6"
                     /db_xref="UniSTS:505525"
     exon            1721..1858
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /inference="alignment:Splign:1.39.8"
     exon            1859..3083
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /inference="alignment:Splign:1.39.8"
     variation       1907
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056936"
     variation       2152
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3733019"
     STS             2759..3037
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /standard_name="SHGC-77610"
                     /db_xref="UniSTS:82745"
     STS             2821..2966
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /standard_name="SHGC-64334"
                     /db_xref="UniSTS:34563"
     STS             2843..3049
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /standard_name="STS-W46183"
                     /db_xref="UniSTS:74552"
     STS             2854..3021
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
                     /standard_name="RH70520"
                     /db_xref="UniSTS:64302"
     polyA_signal    3058..3063
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
     polyA_site      3083
                     /gene="BCL6"
                     /gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
ORIGIN      
gttttgagcaaaattttggactgtgaagcaaggcattggtgaagacaaaatggcctcgccggctgacagctgtatccagttcacccgccatgccagtgatgttcttctcaaccttaatcgtctccggagtcgagacatcttgactgatgttgtcattgttgtgagccgtgagcagtttagagcccataaaacggtcctcatggcctgcagtggcctgttctatagcatctttacagaccagttgaaatgcaaccttagtgtgatcaatctagatcctgagatcaaccctgagggattctgcatcctcctggacttcatgtacacatctcggctcaatttgcgggagggcaacatcatggctgtgatggccacggctatgtacctgcagatggagcatgttgtggacacttgccggaagtttattaaggccagtgaagcagagatggtttctgccatcaagcctcctcgtgaagagttcctcaacagccggatgctgatgccccaagacatcatggcctatcggggtcgtgaggtggtggagaacaacctgccactgaggagcgcccctgggtgtgagagcagagcctttgcccccagcctgtacagtggcctgtccacaccgccagcctcttattccatgtacagccacctccctgtcagcagcctcctcttctccgatgaggagtttcgggatgtccggatgcctgtggccaaccccttccccaaggagcgggcactcccatgtgatagtgccaggccagtccctggtgagtacagccggccgactttggaggtgtcccccaatgtgtgccacagcaatatctattcacccaaggaaacaatcccagaagaggcacgaagtgatatgcactacagtgtggctgagggcctcaaacctgctgccccctcagcccgaaatgccccctacttcccttgtgacaaggccagcaaagaagaagagagaccctcctcggaagatgagattgccctgcatttcgagccccccaatgcacccctgaaccggaagggtctggttagtccacagagcccccagaaatctgactgccagcccaactcgcccacagagtcctgcagcagtaagaatgcctgcatcctccaggcttctggctcccctccagccaagagccccactgaccccaaagcctgcaactggaagaaatacaagttcatcgtgctcaacagcctcaaccagaatgccaaaccagaggggcctgagcaggctgagctgggccgcctttccccacgagcctacacggccccacctgcctgccagccacccatggagcctgagaaccttgacctccagtccccaaccaagctgagtgccagcggggaggactccaccatcccacaagccagccggctcaataacatcgttaacaggtccatgacgggctctccccgcagcagcagcgagagccactcaccactctacatgcaccccccgaagtgcacgtcctgcggctctcagtccccacagcatgcagagatgtgcctccacaccgctggccccacgttccctgaggagatgggagagacccagtctgagtactcagattctagctgtggtgagaaaccctatcgttgcaacatctgtggggcccagttcaaccggccagccaacctgaaaacccacactcgaattcactctggagagaagccctacaaatgcgaaacctgcggagccagatttgtacaggtggcccacctccgtgcccatgtgcttatccacactggtgagaagccctatccctgtgaaatctgtggcacccgtttccggcaccttcagactctgaagagccacctgcgaatccacacaggagagaaaccttaccattgtgagaagtgtaacctgcatttccgtcacaaaagccagctgcgacttcacttgcgccagaagcatggcgccatcaccaacaccaaggtgcaataccgcgtgtcagccactgacctgcctccggagctccccaaagcctgctgaagcatggagtgttgatgctttcgtctccagccccttctcagaatctacccaaaggatactgtaacactttacaatgttcatcccatgatgtagtgcctctttcatccactagtgcaaatcatagctgggggttgggggtggtgggggtcggggcctgggggactgggagccgcagcagctccccctcccccactgccataaaacattaagaaaatcatattgcttcttctcctatgtgtaaggtgaaccatgtcagcaaaaagcaaaatcattttatatgtcaaagcaggggagtatgcaaaagttctgacttgactttagtctgcaaaatgaggaatgtatatgttttgtgggaacagatgtttcttttgtatgtaaatgtgcattcttttaaaagacaagacttcagtatgttgtcaaagagagggctttaatttttttaaccaaaggtgaaggaatatatggcagagttgtaaatatataaatatatatatatataaaataaatatatataaacctaaaaaagatatattaaaaatataaaactgcgttaaaggctcgattttgtatctgcaggcagacacggatctgagaatctttattgagaaagagcacttaagagaatattttaagtattgcatctgtataagtaagaaaatattttgtctaaaatgcctcagtgtatttgtatttttttgcaagtgaaggtttacaatttacaaagtgtgtattaaaaaaaacaaaaagaacaaaaaaatctgcagaaggaaaaatgtgtaattttgttctagttttcagtttgtatatacccgtacaacgtgtcctcacggtgccttttttcacggaagttttcaatgatgggcgagcgtgcaccatccctttttgaagtgtaggcagacacagggacttgaagttgttactaactaaactctctttgggaatgtttgtctcatcccattctgcgtcatgcttgtgttataactactccggagacagggtttggctgtgtctaaactgcattaccgcgttgtaaaatatagctgtacaaatataagaataaaatgttgaaaagtcaaactggaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:604 -> Molecular function: GO:0003682 [chromatin binding] evidence: IDA
            GeneID:604 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IMP
            GeneID:604 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:604 -> Molecular function: GO:0031490 [chromatin DNA binding] evidence: IEA
            GeneID:604 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IDA
            GeneID:604 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:604 -> Biological process: GO:0000060 [protein import into nucleus, translocation] evidence: IGI
            GeneID:604 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:604 -> Biological process: GO:0000902 [cell morphogenesis] evidence: IEA
            GeneID:604 -> Biological process: GO:0001953 [negative regulation of cell-matrix adhesion] evidence: IEA
            GeneID:604 -> Biological process: GO:0002467 [germinal center formation] evidence: IEA
            GeneID:604 -> Biological process: GO:0002634 [regulation of germinal center formation] evidence: NAS
            GeneID:604 -> Biological process: GO:0002829 [negative regulation of type 2 immune response] evidence: IEA
            GeneID:604 -> Biological process: GO:0002903 [negative regulation of B cell apoptotic process] evidence: NAS
            GeneID:604 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:604 -> Biological process: GO:0006974 [response to DNA damage stimulus] evidence: IDA
            GeneID:604 -> Biological process: GO:0007266 [Rho protein signal transduction] evidence: IEA
            GeneID:604 -> Biological process: GO:0007283 [spermatogenesis] evidence: IEA
            GeneID:604 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IEA
            GeneID:604 -> Biological process: GO:0030036 [actin cytoskeleton organization] evidence: IEA
            GeneID:604 -> Biological process: GO:0030183 [B cell differentiation] evidence: IEA
            GeneID:604 -> Biological process: GO:0030308 [negative regulation of cell growth] evidence: IDA
            GeneID:604 -> Biological process: GO:0030890 [positive regulation of B cell proliferation] evidence: IEA
            GeneID:604 -> Biological process: GO:0032319 [regulation of Rho GTPase activity] evidence: IEA
            GeneID:604 -> Biological process: GO:0032764 [negative regulation of mast cell cytokine production] evidence: IEA
            GeneID:604 -> Biological process: GO:0035024 [negative regulation of Rho protein signal transduction] evidence: IEA
            GeneID:604 -> Biological process: GO:0042092 [type 2 immune response] evidence: IEA
            GeneID:604 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IDA
            GeneID:604 -> Biological process: GO:0043380 [regulation of memory T cell differentiation] evidence: IEA
            GeneID:604 -> Biological process: GO:0045629 [negative regulation of T-helper 2 cell differentiation] evidence: IEA
            GeneID:604 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IMP
            GeneID:604 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: NAS
            GeneID:604 -> Biological process: GO:0048294 [negative regulation of isotype switching to IgE isotypes] evidence: IEA
            GeneID:604 -> Biological process: GO:0048821 [erythrocyte development] evidence: IEA
            GeneID:604 -> Biological process: GO:0050727 [regulation of inflammatory response] evidence: IEA
            GeneID:604 -> Biological process: GO:0050776 [regulation of immune response] evidence: NAS
            GeneID:604 -> Biological process: GO:0051272 [positive regulation of cellular component movement] evidence: IEA
            GeneID:604 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:604 -> Cellular component: GO:0005657 [replication fork] evidence: IDA
            GeneID:604 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.