GGRNA Home | Help | Advanced search

2020-10-26 19:02:58, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001128931            1635 bp    mRNA    linear   PRI 13-APR-2013
DEFINITION  Homo sapiens nuclear assembly factor 1 ribonucleoprotein (NAF1),
            transcript variant 2, mRNA.
ACCESSION   NM_001128931
VERSION     NM_001128931.1  GI:193083171
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1635)
  AUTHORS   Kim,H.Y., Cho,S., Yu,J., Sung,S. and Kim,H.
  TITLE     Analysis of copy number variation in 8,842 Korean individuals
            reveals 39 genes associated with hepatic biomarkers AST and ALT
  JOURNAL   BMB Rep 43 (8), 547-553 (2010)
   PUBMED   20797317
  REMARK    GeneRIF: Observational study and genome-wide association study of
            gene-disease association. (HuGE Navigator)
REFERENCE   2  (bases 1 to 1635)
  AUTHORS   Chang,N.C., Nguyen,M., Germain,M. and Shore,G.C.
  TITLE     Antagonism of Beclin 1-dependent autophagy by BCL-2 at the
            endoplasmic reticulum requires NAF-1
  JOURNAL   EMBO J. 29 (3), 606-618 (2010)
   PUBMED   20010695
  REMARK    GeneRIF: NAF-1 is a BCL-2-associated co-factor that targets BCL-2
            for antagonism of the autophagy pathway at the endoplasmic
            reticulum.
REFERENCE   3  (bases 1 to 1635)
  AUTHORS   Medland,S.E., Nyholt,D.R., Painter,J.N., McEvoy,B.P., McRae,A.F.,
            Zhu,G., Gordon,S.D., Ferreira,M.A., Wright,M.J., Henders,A.K.,
            Campbell,M.J., Duffy,D.L., Hansell,N.K., Macgregor,S.,
            Slutske,W.S., Heath,A.C., Montgomery,G.W. and Martin,N.G.
  TITLE     Common variants in the trichohyalin gene are associated with
            straight hair in Europeans
  JOURNAL   Am. J. Hum. Genet. 85 (5), 750-755 (2009)
   PUBMED   19896111
REFERENCE   4  (bases 1 to 1635)
  AUTHORS   Kittur,N., Darzacq,X., Roy,S., Singer,R.H. and Meier,U.T.
  TITLE     Dynamic association and localization of human H/ACA RNP proteins
  JOURNAL   RNA 12 (12), 2057-2062 (2006)
   PUBMED   17135485
REFERENCE   5  (bases 1 to 1635)
  AUTHORS   Hoareau-Aveilla,C., Bonoli,M., Caizergues-Ferrer,M. and Henry,Y.
  TITLE     hNaf1 is required for accumulation of human box H/ACA snoRNPs,
            scaRNPs, and telomerase
  JOURNAL   RNA 12 (5), 832-840 (2006)
   PUBMED   16601202
REFERENCE   6  (bases 1 to 1635)
  AUTHORS   Darzacq,X., Kittur,N., Roy,S., Shav-Tal,Y., Singer,R.H. and
            Meier,U.T.
  TITLE     Stepwise RNP assembly at the site of H/ACA RNA transcription in
            human cells
  JOURNAL   J. Cell Biol. 173 (2), 207-218 (2006)
   PUBMED   16618814
REFERENCE   7  (bases 1 to 1635)
  AUTHORS   Beausoleil,S.A., Jedrychowski,M., Schwartz,D., Elias,J.E.,
            Villen,J., Li,J., Cohn,M.A., Cantley,L.C. and Gygi,S.P.
  TITLE     Large-scale characterization of HeLa cell nuclear phosphoproteins
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 101 (33), 12130-12135 (2004)
   PUBMED   15302935
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BC008207.1 and AK308601.1.
            
            Transcript Variant: This variant (2) uses an alternate exon in the
            3' terminus, compared to variant 1, which results in a protein
            (isoform B) with a shorter and distinct C-terminus, compared to
            isoform A.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK308601.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-31                BC008207.1         1-31
            32-1635             AK308601.1         1-1604
FEATURES             Location/Qualifiers
     source          1..1635
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4q32.2"
     gene            1..1635
                     /gene="NAF1"
                     /note="nuclear assembly factor 1 ribonucleoprotein"
                     /db_xref="GeneID:92345"
                     /db_xref="HGNC:25126"
     exon            1..559
                     /gene="NAF1"
                     /inference="alignment:Splign:1.39.8"
     variation       23
                     /gene="NAF1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3822304"
     variation       120
                     /gene="NAF1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:936562"
     misc_feature    165..167
                     /gene="NAF1"
                     /note="upstream in-frame stop codon"
     CDS             195..1364
                     /gene="NAF1"
                     /note="isoform b is encoded by transcript variant 2; h/ACA
                     ribonucleoprotein complex non-core subunit NAF1; nuclear
                     assembly factor 1 homolog"
                     /codon_start=1
                     /product="H/ACA ribonucleoprotein complex non-core subunit
                     NAF1 isoform b"
                     /protein_id="NP_001122403.1"
                     /db_xref="GI:193083172"
                     /db_xref="CCDS:CCDS47159.1"
                     /db_xref="GeneID:92345"
                     /db_xref="HGNC:25126"
                     /translation="
MEVVEAAAAQLETLKFNGTDFGVGEGPAAPSPGSAPVPGTQPPLQSFEGSPDAGQTVEVKPAGEQPLQPVLNAVAAGTPAPQPQPPAESPACGDCVTSPGAAEPARAPDSLETSDSDSDSDSETDSDSSSSSSSSSSSSSSSSSSCISLPPVLSDGDDDLQIEKENKNFPLKTKDELLLNELPSVEELTIILPEDIELKPLGMVSSIIEQLVIIESMTNLPPVNEETVIFKSDRQAAGKIFEIFGPVAHPFYVLRFNSSDHIESKGIKIKETMYFAPSMKDFTQYIFTEKLKQDKGSDASWKNDQEPPPEALDFSDDEKEKEAKQRKKSQIQGRKKLKSEFNEPGTGISHRYCGLGSRPLQSSESHKLFGFQMHIKVTFTCYFSLLSMQ
"
     misc_feature    720..1184
                     /gene="NAF1"
                     /note="Gar1/Naf1 RNA binding region; Region: Gar1;
                     pfam04410"
                     /db_xref="CDD:190975"
     variation       460
                     /gene="NAF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35063973"
     variation       497
                     /gene="NAF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35410130"
     exon            560..734
                     /gene="NAF1"
                     /inference="alignment:Splign:1.39.8"
     variation       633
                     /gene="NAF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34283388"
     exon            735..828
                     /gene="NAF1"
                     /inference="alignment:Splign:1.39.8"
     exon            829..911
                     /gene="NAF1"
                     /inference="alignment:Splign:1.39.8"
     exon            912..1072
                     /gene="NAF1"
                     /inference="alignment:Splign:1.39.8"
     exon            1073..1124
                     /gene="NAF1"
                     /inference="alignment:Splign:1.39.8"
     exon            1125..1227
                     /gene="NAF1"
                     /inference="alignment:Splign:1.39.8"
     exon            1228..1635
                     /gene="NAF1"
                     /inference="alignment:Splign:1.39.8"
ORIGIN      
cggaaagcgttgctgcgtaaatggcgggggcgtgtcttttggctcctccgcgtgtagttacctgagaaacgcgggaagttgggcccaggcagtgttgctgcggttgcctaagttgtttttctatttctggagagagccgtgagcttgtccaggggccccaatcctgaggccgacccggtttctggcgcggtgcgatggaggtagtggaggccgccgccgctcagctggaaactctgaaattcaatggcaccgactttggagttggggaaggtccggcggctccgtctccgggctctgcccctgtgccagggacacagccgccgctacagtcgtttgaggggtccccggacgctgggcagaccgtggaggttaagcctgccggggagcagcctctgcagcccgttctgaacgccgtcgcggccgggaccccggcgccgcagccacagccaccggctgaatcgccggcctgcggagactgcgtcacctccccaggagccgcagagcctgcgcgggcgccggactccttggagacctcggactcggattcggactcggacagtgaaacagattcagatagttcaagttcatcgtcttcctcttcatcttcctcatcgtcgtcttcttcctcttgtatatcacttcctccagtgctgtcagatggagatgatgatttacaaattgagaaggaaaataagaattttcctcttaaaacaaaagatgaattacttcttaatgaactgccttctgttgaagaactcactattattctgcctgaagatattgagttaaagcctcttgggatggtttcaagtattattgaacaactagtaataattgaatctatgactaacctacctccagttaatgaggagactgtaatttttaaaagtgatcgacaagcagcaggaaagatattcgagatatttggacctgttgcacatccattttatgtgttacggtttaattcttcagatcacattgagagtaaaggtattaaaataaaggagactatgtattttgctccatcaatgaaagatttcactcaatatatattcacagaaaaactaaaacaggataagggatcagatgcatcatggaagaatgatcaggaaccaccaccagaggccttagattttagtgatgatgaaaaagagaaggaagccaaacagaggaaaaaatctcagattcaaggccggaaaaaactcaaatctgaatttaatgagcctggtacaggtatatctcacagatattgtggcctcggatccagaccattgcagtcaagtgagtcacacaaactttttggtttccaaatgcatataaaagttacgtttacatgctactttagtttattaagtatgcaatagcattgtgtctaaaaaaaccaatgtgcatatctcaattggagaatactttactgttcaaaaaataataatgaccctttgagcctgcagtgagttacagtcttttagctgttggaaggtctggactcaagtgctgttggccgctgactaatcagggtagttgttgctaaaagtggcagtttctcctaatagatagcagtgaagtgtgctacattaattggctcttcctttcaccaaagatttctgtgtagcatgtgatgctacttgatagcat
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:92345 -> Molecular function: GO:0003723 [RNA binding] evidence: IDA
            GeneID:92345 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:92345 -> Biological process: GO:0001522 [pseudouridine synthesis] evidence: IEA
            GeneID:92345 -> Biological process: GO:0006364 [rRNA processing] evidence: IEA
            GeneID:92345 -> Biological process: GO:0042254 [ribosome biogenesis] evidence: IDA
            GeneID:92345 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
            GeneID:92345 -> Cellular component: GO:0005732 [small nucleolar ribonucleoprotein complex] evidence: IDA
            GeneID:92345 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:92345 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
            GeneID:92345 -> Cellular component: GO:0030054 [cell junction] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.