GGRNA Home | Help | Advanced search

2019-03-23 04:11:30, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001105521            6488 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens Janus kinase and microtubule interacting protein 3
            (JAKMIP3), mRNA.
ACCESSION   NM_001105521
VERSION     NM_001105521.2  GI:225735565
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6488)
  AUTHORS   Kim DK, Cho MH, Hersh CP, Lomas DA, Miller BE, Kong X, Bakke P,
            Gulsvik A, Agusti A, Wouters E, Celli B, Coxson H, Vestbo J, MacNee
            W, Yates JC, Rennard S, Litonjua A, Qiu W, Beaty TH, Crapo JD,
            Riley JH, Tal-Singer R and Silverman EK.
  CONSRTM   ECLIPSE, ICGN, and COPDGene Investigators
  TITLE     Genome-wide association analysis of blood biomarkers in chronic
            obstructive pulmonary disease
  JOURNAL   Am. J. Respir. Crit. Care Med. 186 (12), 1238-1247 (2012)
   PUBMED   23144326
REFERENCE   2  (bases 1 to 6488)
  AUTHORS   Cruz-Garcia,D., Vazquez-Martinez,R., Peinado,J.R., Anouar,Y.,
            Tonon,M.C., Vaudry,H., Castano,J.P. and Malagon,M.M.
  TITLE     Identification and characterization of two novel (neuro)endocrine
            long coiled-coil proteins
  JOURNAL   FEBS Lett. 581 (17), 3149-3156 (2007)
   PUBMED   17572408
REFERENCE   3  (bases 1 to 6488)
  AUTHORS   Grupe,A., Li,Y., Rowland,C., Nowotny,P., Hinrichs,A.L., Smemo,S.,
            Kauwe,J.S., Maxwell,T.J., Cherny,S., Doil,L., Tacey,K., van
            Luchene,R., Myers,A., Wavrant-De Vrieze,F., Kaleem,M.,
            Hollingworth,P., Jehu,L., Foy,C., Archer,N., Hamilton,G.,
            Holmans,P., Morris,C.M., Catanese,J., Sninsky,J., White,T.J.,
            Powell,J., Hardy,J., O'Donovan,M., Lovestone,S., Jones,L.,
            Morris,J.C., Thal,L., Owen,M., Williams,J. and Goate,A.
  TITLE     A scan of chromosome 10 identifies a novel locus showing strong
            association with late-onset Alzheimer disease
  JOURNAL   Am. J. Hum. Genet. 78 (1), 78-88 (2006)
   PUBMED   16385451
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   4  (bases 1 to 6488)
  AUTHORS   Steindler,C., Li,Z., Algarte,M., Alcover,A., Libri,V., Ragimbeau,J.
            and Pellegrini,S.
  TITLE     Jamip1 (marlin-1) defines a family of proteins interacting with
            janus kinases and microtubules
  JOURNAL   J. Biol. Chem. 279 (41), 43168-43177 (2004)
   PUBMED   15277531
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AL162274.17
            and AL512622.9.
            On Mar 28, 2009 this sequence version replaced gi:157502224.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            CCDS Note: This CCDS ID represents the protein described in PMID:
            17572408. The full-length exon combination of this transcript is
            based on a combination of mouse (AK220482.1) and human (AK126964.1)
            partial transcripts. It should be noted this transcript is
            predicted to undergo nonsense-mediated mRNA decay (NMD). It is
            likely that the majority of transcripts representing this variant
            will undergo NMD, while some low level of NMD escape may allow for
            the expression of this protein.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025084
                              [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            inferred exon combination :: based on alignments, homology
            NMD candidate             :: translation inferred from conservation
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-135               AL162274.17        138736-138870
            136-633             AL512622.9         4113-4610
            634-849             AL512622.9         20348-20563
            850-969             AL512622.9         22077-22196
            970-1116            AL512622.9         22966-23112
            1117-1248           AL512622.9         24055-24186
            1249-1284           AL512622.9         24290-24325
            1285-1344           AL512622.9         25155-25214
            1345-1473           AL512622.9         27487-27615
            1474-1602           AL512622.9         28956-29084
            1603-1686           AL512622.9         32143-32226
            1687-1749           AL512622.9         32554-32616
            1750-1848           AL512622.9         34988-35086
            1849-1947           AL512622.9         36448-36546
            1948-2001           AL512622.9         37018-37071
            2002-2067           AL512622.9         39994-40059
            2068-2136           AL512622.9         40795-40863
            2137-2214           AL512622.9         40949-41026
            2215-2418           AL512622.9         50245-50448
            2419-2484           AL512622.9         51706-51771
            2485-2557           AL512622.9         54019-54091
            2558-3638           AL512622.9         54989-56069
            3639-4035           AL512622.9         56892-57288
            4036-6488           AL512622.9         69393-71845
FEATURES             Location/Qualifiers
     source          1..6488
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10q26.3"
     gene            1..6488
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /note="Janus kinase and microtubule interacting protein 3"
                     /db_xref="GeneID:282973"
                     /db_xref="HGNC:23523"
                     /db_xref="MIM:611198"
     CDS             1..2535
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /note="neuroendocrine long coiled-coil 2; neuroendocrine
                     long coiled-coil protein 2"
                     /codon_start=1
                     /product="janus kinase and microtubule-interacting protein
                     3"
                     /protein_id="NP_001098991.1"
                     /db_xref="GI:157502225"
                     /db_xref="CCDS:CCDS44494.1"
                     /db_xref="GeneID:282973"
                     /db_xref="HGNC:23523"
                     /db_xref="MIM:611198"
                     /translation="
MSKRGMSSRAKGDKAEALAALQAANEDLRAKLTDIQIELQQEKSKVSKVEREKNQELRQVREHEQHKTAVLLTELKTKLHEEKMKELQAVRETLLRQHEAELLRVIKIKDNENQRLQALLSALRDGGPEKVKTVLLSEAKEEAKKGFEVEKVKMQQEISELKGAKRQVEEALTLVIQADKIKAAEIRSVYHLHQEEITRIKKECEREIRRLMEEIKFKDRAVFVLERELGVQAGHAQRLQLQKEALDEQLSQVREADRHPGSPRRELPHAAGAGDASDHSGSPEQQLDEKDARRFQLKIAELSAIIRKLEDRNALLSEERNELLKRVREAESQYKPLLDKNKRLSRKNEDLSHALRRMENKLKFVTQENIEMRQRAGIIRRPSSLNDLDQSQDEREVDFLKLQIVEQQNLIDELSKTLETAGYVKSVLERDKLLRFRKQRKKMAKLPKPVVVETFFGYDEEASLESDGSSVSYQTDRTDQTPCTPDDDLEEGMAKEETELRFRQLTMEYQALQRAYALLQEQVGGTLDAEREVKTREQLQAEVQRAQARIEDLEKALAEQGQDMKWIEEKQALYRRNQELVEKIKQMETEEARLRHEVQDARDQNELLEFRILELEERERKSPAISFHHTPFVDGKSPLQVYCEAEGVTDIVVAELMKKLDILGDNANLTNEEQVVVIQARTVLTLAEKWLQQIEETEAALQRKMVDLESEKELFSKQKGYLDEELDYRKQALDQANKHILELEAMLYDALQQEAGAKVAELLSEEEREKLKVAVEQWKRQVMSELRERDAQILRERMELLQLAQQRIKELEERIEAQKRQIKELEEKFLFLFLFFSLAFILWS
"
     misc_feature    <1513..1815
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /note="SH3 domain protein; Region: SH3_and_anchor;
                     TIGR04211"
                     /db_xref="CDD:211934"
     exon            1..135
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       9
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372275166"
     variation       16
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77653558"
     variation       33
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377579463"
     variation       51
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373674808"
     variation       56
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200640026"
     variation       60
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10870252"
     variation       86
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375491238"
     variation       108
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11146177"
     exon            136..633
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       152
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371348426"
     variation       180
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375659509"
     variation       182
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199726287"
     variation       195
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201597769"
     variation       196
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377405834"
     variation       206
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370393227"
     variation       271
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374779116"
     variation       278
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367618615"
     variation       283
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370253977"
     variation       320
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199768813"
     variation       333
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371369909"
     variation       344
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373833963"
     variation       355
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368574779"
     variation       365
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372347107"
     variation       370
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375429968"
     variation       378
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368486466"
     variation       390
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371619151"
     variation       393
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376174504"
     variation       399
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200538281"
     variation       400
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372132098"
     variation       458
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373128130"
     variation       478
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376695053"
     variation       489
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369892382"
     variation       502
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374511964"
     variation       513
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376645431"
     variation       518
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371280434"
     variation       526
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146722402"
     variation       528
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377151206"
     variation       573
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370533477"
     variation       618
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373724588"
     exon            634..849
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       644
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372381756"
     variation       670
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138207963"
     variation       683
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181241201"
     variation       700
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367972899"
     variation       745
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372194857"
     variation       760
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200612398"
     variation       768
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368816768"
     variation       779
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374372503"
     variation       825
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376769665"
     exon            850..969
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       850
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77020739"
     variation       852
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201465517"
     variation       866
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375632294"
     variation       900
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116138939"
     variation       908
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199927405"
     variation       912
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373775904"
     variation       935
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202023395"
     variation       939
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2814182"
     variation       951
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368539160"
     variation       957
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201097707"
     exon            970..1116
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       970
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371753886"
     variation       977
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200001447"
     variation       979
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141077930"
     variation       981
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370087466"
     variation       999
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372427816"
     variation       1045
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199529006"
     variation       1069
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369595261"
     variation       1111
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372734785"
     exon            1117..1248
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       1138
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371392395"
     variation       1139
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199828277"
     variation       1191
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201158135"
     variation       1195
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371025401"
     variation       1211
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201149274"
     variation       1236
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75996870"
     exon            1249..1284
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       1251
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200925629"
     variation       1255
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202061912"
     variation       1260
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372888170"
     exon            1285..1344
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       1309
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372342663"
     variation       1310
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375069186"
     variation       1327
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368366945"
     variation       1340
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372013380"
     exon            1345..1473
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       1346
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367725920"
     variation       1353
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370890037"
     variation       1374
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374584141"
     variation       1375
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368231959"
     variation       1377
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181496069"
     variation       1398
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376570759"
     variation       1401
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2818387"
     variation       1433
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372190425"
     variation       1434
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376411265"
     variation       1458
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368810795"
     variation       1459
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374337157"
     exon            1474..1602
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       1477
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11592585"
     variation       1482
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375629642"
     variation       1490
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370199633"
     variation       1496
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374475319"
     variation       1504
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376915260"
     variation       1507
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374251347"
     variation       1518
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368508647"
     variation       1527
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371865720"
     variation       1548
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373788324"
     variation       1573
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368099428"
     variation       1577
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145834847"
     variation       1578
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149002950"
     variation       1584
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376487051"
     exon            1603..1686
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       1604
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200950786"
     variation       1606
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373222736"
     variation       1624
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184195749"
     variation       1636
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375900771"
     variation       1637
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370911193"
     variation       1643
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374576124"
     variation       1644
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190702116"
     variation       1646
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200136856"
     exon            1687..1749
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       1691
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143832937"
     exon            1750..1848
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       1757
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368625157"
     variation       1766
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138739966"
     variation       1767
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79567248"
     variation       1775
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377157993"
     variation       1778
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368038825"
     variation       1783
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371971797"
     variation       1788
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2818384"
     exon            1849..1947
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       1869
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146467979"
     variation       1870
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139137842"
     variation       1896
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143153948"
     variation       1902
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369054799"
     variation       1903
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201739314"
     variation       1929
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150346687"
     variation       1935
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199817578"
     variation       1946
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373056876"
     exon            1948..2001
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       1961
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117391524"
     variation       1962
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144158110"
     variation       1968
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373116868"
     variation       1976
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376306525"
     variation       1983
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146017132"
     variation       1996
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377482724"
     variation       1999
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199769239"
     exon            2002..2067
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       2004
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145337969"
     variation       2012
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139790761"
     variation       2029
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368527879"
     variation       2046
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141532592"
     variation       2050
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146195956"
     variation       2057
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201747630"
     variation       2061
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371410240"
     exon            2068..2136
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       2083
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139189013"
     variation       2092
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188032292"
     variation       2096
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142581576"
     variation       2097
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151294338"
     variation       2099
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368190407"
     variation       2100
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139369880"
     variation       2124
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372068371"
     variation       2129
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150051450"
     variation       2132
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376023011"
     exon            2137..2214
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       2158
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145409897"
     variation       2209
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199888194"
     exon            2215..2418
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       2302
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142668761"
     variation       2303
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146353018"
     variation       2304
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372743812"
     variation       2305
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147886594"
     variation       2311
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370317405"
     variation       2313
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:189739205"
     variation       2322
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141629523"
     variation       2339
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376017609"
     variation       2346
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143722443"
     variation       2347
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371020710"
     variation       2360
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148025571"
     variation       2361
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141738763"
     variation       2366
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150154129"
     variation       2370
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138755886"
     variation       2388
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201405116"
     variation       2389
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200657240"
     variation       2410
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199693255"
     variation       2416
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141891193"
     exon            2419..2484
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       2472
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141466303"
     variation       2476
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374347826"
     exon            2485..2557
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       2494
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375251456"
     variation       2532
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369101480"
     variation       2539
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372871079"
     exon            2558..3638
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       2618
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142883148"
     variation       2765
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115578057"
     variation       2783
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4880338"
     variation       2827
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114837050"
     variation       2832
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144977297"
     variation       2891..2893
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="tct"
                     /db_xref="dbSNP:375716306"
     variation       2911
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186016621"
     variation       2912
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192051153"
     variation       2945
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:113223606"
     variation       3019
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138837481"
     variation       3077
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369360901"
     variation       3084
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2814172"
     variation       3132
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41290011"
     variation       3162
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375261455"
     variation       3205
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184033982"
     variation       3287..3302
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="ctgggagcaccgcggg"
                     /db_xref="dbSNP:370991788"
     variation       3298
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2814173"
     variation       3302
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:74161735"
     variation       3349
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150893691"
     variation       3364
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186941667"
     variation       3442
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78181174"
     variation       3476..3492
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="ggccatggaccccggcg"
                     /db_xref="dbSNP:138460396"
     variation       3476
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="ggccatggaccccggcg"
                     /db_xref="dbSNP:66921746"
     variation       3479..3495
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="catggaccccggcgggc"
                     /db_xref="dbSNP:371319427"
     variation       3479
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="catggaccccggcgggc"
                     /db_xref="dbSNP:11275135"
     variation       3489
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78628385"
     variation       3492
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78386799"
     variation       3495
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="ccatggaccccggcgggc"
                     /db_xref="dbSNP:76496700"
     variation       3569
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374325158"
     variation       3611
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2637649"
     variation       3619
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190679179"
     exon            3639..4035
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       3640
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377659713"
     variation       3653
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377765045"
     variation       3704
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116014913"
     variation       3706
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7096307"
     variation       3728
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12267479"
     variation       3744
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:114707888"
     variation       3798
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116719518"
     variation       3827
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:58555607"
     variation       3911
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370182984"
     variation       3914
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7922837"
     variation       3915
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79485798"
     variation       4013
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187257380"
     exon            4036..6488
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /inference="alignment:Splign:1.39.8"
     variation       4094..4095
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:144050726"
     variation       4095..4096
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:370410117"
     variation       4120
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112725163"
     variation       4256
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181264463"
     variation       4258
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3750698"
     variation       4275
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185229428"
     variation       4276
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75850592"
     variation       4281
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114625099"
     variation       4294
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371218029"
     variation       4321
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189750382"
     variation       4332..4343
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="gcagccagctgt"
                     /db_xref="dbSNP:200463059"
     variation       4400
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2637648"
     variation       4407
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2814164"
     variation       4436
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372053750"
     variation       4456
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138379291"
     variation       4482
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182054290"
     variation       4485
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372183308"
     variation       4493
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149598440"
     variation       4506
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369531825"
     variation       4553
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144230968"
     variation       4725
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41290013"
     variation       4760
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2637653"
     variation       4786
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148704177"
     variation       4789
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142276426"
     variation       4802
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186360145"
     variation       4809
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372884945"
     variation       4902
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146384321"
     variation       4904
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:80152314"
     variation       5036
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116423112"
     variation       5062
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115791651"
     variation       5083
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191851875"
     variation       5183..5185
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="taa"
                     /db_xref="dbSNP:3833728"
     variation       5184
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199712470"
     variation       5185..5187
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="ata"
                     /db_xref="dbSNP:201752064"
     variation       5206
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2637656"
     variation       5207
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183806512"
     variation       5333
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114670776"
     variation       5357
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115540219"
     variation       5375
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75831819"
     variation       5467
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2814163"
     variation       5474
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77657207"
     variation       5510..5512
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="ctc"
                     /db_xref="dbSNP:141098989"
     variation       5595
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3814604"
     variation       5662
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4587659"
     variation       5674
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:4366411"
     variation       5682
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:7475690"
     variation       5774..5775
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:199849737"
     variation       5838
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188297574"
     variation       5857
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146617919"
     variation       5893
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139510849"
     variation       5956
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193010074"
     variation       5970
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182660847"
     variation       5998
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377095137"
     variation       6053
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201379181"
     variation       6069
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373982769"
     variation       6101
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369096822"
     STS             6134..6336
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /standard_name="WI-21586"
                     /db_xref="UniSTS:62234"
     STS             6226..6354
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /standard_name="RH11288"
                     /db_xref="UniSTS:15006"
     variation       6230
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72858970"
     variation       6235
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149705422"
     variation       6251
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375954847"
     variation       6254
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199643930"
     STS             6259..6381
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /standard_name="A009F48"
                     /db_xref="UniSTS:80526"
     STS             6259..6381
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /standard_name="G32518"
                     /db_xref="UniSTS:117103"
     variation       6289
                     /gene="JAKMIP3"
                     /gene_synonym="bA140A10.5; C10orf14; C10orf39; Jamip3;
                     NECC2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372999470"
ORIGIN      
atgtccaagaggggcatgagcagccgggccaagggggacaaggcagaggccctcgcggcgctgcaggcggccaacgaggatcttcgagccaagctcacagacatccagatcgagctgcagcaggagaagagcaaggtcagcaaagtggaacgcgagaagaaccaggagctgcggcaggtgcgcgagcatgagcagcataagaccgcggtcttgctcacggagctcaagacaaagctgcacgaggagaagatgaaggagctacaggctgtgcgtgagacgctgctgcggcagcatgaggctgagctgctcagggtcatcaagatcaaggacaacgagaaccagcggctgcaggcactgctcagtgccctgcgtgatggcggccccgaaaaggtcaagaccgtgctgctgtccgaggccaaggaggaggccaagaaggggttcgaggtggagaaggtcaagatgcagcaggagatctccgagctcaagggcgccaaaaggcaggtggaggaggcgctgacgctggtgatccaagcggacaagatcaaggccgcagagatccgcagcgtgtaccacctgcaccaggaggagatcacccgcatcaagaaggagtgcgagcgggagatccgcaggctgatggaggagataaaatttaaagacagagcagtcttcgtgctggagagagagttaggggttcaagccgggcatgctcagagactgcagctccaaaaagaggctctagatgagcagctgtcccaggtccgagaggccgaccggcacccgggcagccccagacgggaacttcctcatgcagctggtgcaggagacgcttcagaccactcgggaagccctgaacagcagttggatgaaaaagatgcccggcgcttccagcttaaaatcgcggagttaagtgcgattatccgcaaactggaggaccgcaatgcattgctgtcggaagagaggaatgagctgttgaagcgcgtaagagaagctgagagtcagtacaagcctctgctggataaaaacaagcgcctcagtcggaagaacgaggatttgtctcatgctttacgccgaatggaaaacaagttaaaatttgtcacccaggagaacatagaaatgagacagagagctggaatcatacggagacccagttccttgaatgaccttgatcaaagtcaggatgagagagaagtcgatttcttgaagcttcagattgtggagcagcaaaacctcatagatgaactgtctaagacccttgagaccgccggctacgtgaagagcgtgttagagcgggacaagctgttaagattccggaagcaaagaaagaaaatggcaaaacttcccaagccggtggttgtggagaccttctttggatacgacgaagaggcttccctggaatccgacggctcctccgtctcttaccaaacagacaggacggaccagaccccgtgcaccccggacgatgacttggaggagggcatggccaaggaggagacggagctgaggttccggcagctgaccatggagtaccaggccctgcagcgtgcctacgctttgttgcaggagcaggttggagggacgctggacgcagagcgagaagttaagacccgtgagcagctacaagccgaagtgcagagggcacaggcgcggatagaggacctggagaaggccctggcggagcaggggcaggatatgaagtggattgaagagaagcaggcactgtaccggagaaatcaagagcttgtggaaaagatcaaacaaatggagacggaagaggctcggctcagacacgaggtgcaggacgccagagaccaaaacgagctgctggagttcaggatcctggagcttgaggagagggagaggaagtcacccgccatcagcttccaccacacgcccttcgtggacgggaagagccccctccaggtgtactgcgaggccgaaggtgtgacggacattgtggttgcggagctgatgaagaagctggacatcctgggcgataacgccaacctgaccaatgaggagcaggtggttgtcatacaagccaggacagtcctgaccttggccgaaaagtggctccagcagattgaggagacagaggcggcgctgcagcggaagatggtggatctggagagcgagaaggagctgttcagtaagcagaagggctacctggacgaggagctggactaccggaaacaggccttggaccaggccaacaagcacatcctggagctggaagccatgctgtatgatgccctgcagcaggaggccggggctaaggtggctgagctgctgtcagaggaggagcgcgagaagctcaaggtggccgtggagcagtggaagcgccaggtcatgagtgagctgcgcgagcgggacgcccagatcctgcgggagcgcatggagctgctgcagctggctcagcagagaattaaagagttagaagaaagaatagaagctcagaagagacaaataaaggaactggaggaaaagtttctatttttgttcttatttttctccttagctttcattctctggtcatagtccgtcttggcaccctgacgtgccccacattgaatcggacccttttcctccagtgggaccagaaagcagggacaaaatgggacgtcgcgtctccatcctgaagacccagggagatttggtctctgcacgcccgtcccgtggaggaagagtgagaaggggcagtgtgtggggcgtggagctgccgtccacgtgggatgtgccagaactagaactggctctgccgacttctcgggggcttctccgggacgggcctggccttggctgctggaccctgggtcccttctcccggacggcagcccccatcccatttccagggatgtgtagcattccctgccaagcaggggtgagaactgcttctgtgcagaagcaccagccgcgggtcccctcctctctcttggttctcacagtagctgccactggtgtctggaggaagattttcagaaacaacagaggcttggcctgatgacaagatgaaagctggacggtgaccttcattcaggggaacctggaggctccctgggatggtcctgggagggctccccgacgcctcaggggcccctccgatgctgcaatatgttgctggggtcctgagcacccgctggccaacagaccccacatccaccctcgttcatcatcatctctgtggggacagacaagagccgtggccgccgcgggccgcgtggtgccatcaaccctctgcctccctactcaacctgagacaggaaggccaagatcccgcccaagccgccagctgggagcaccgcgggactgagccaaggaaggcgtggggagcgtggtgacaggaggtgggacgagggggcggagctggctggaacacggatgccagaggctgcctccatagtgaatctccagaagtcacagaggccctgggcacccagagccacccagcctggaagcccctgcacgggccagccctgcaggccatggaccccggcgggcaccgaagcctcaccccaagcctttgcacacaaggagcagcccaggtggggatggcgggcgcaagaagggaaccgcggggacggcctttcccctcccgccctgtgtggggacgctgcacgagccgtggaccaagaggctgacaggaggggtccgcagcgaggaggaggtgcgaagggggcggcggctccgtcttgcaggtcccctggggcgcgttcttcaggtgcgtggtggacgaggcggcgtcctcgcggggtcgggacctgggtacccagcagcatctggctcctgcatccaccaagggcgcccaggcacagcctcaggccagaaggttcgctgcagaggttcattctagaaggagcgggagaccagcagtcccagccctgtccaaggacgcccgctgcttggcacacgagggcgccgcaggcccaccatccctcaggacatggctgccgagtccccagagacttctggtcccacagcaagagctggagctccaagcataacatctctaactgtgcggcaaggacagcgcagccagagagaggaagcagtgcattggtgaaggcaacgttaggtgtgatttccattcctgctgggagacccgggacgcagcccgggagcttcgtccagcctgtggatggagcctgactggctgcagatggaacttctgtgtcctcccaccctaggtgggctaaggttctgctctcagagctgaattgacaggaggtgtgtgtgtgtgctcacttgtgtgcacaagcatgcgtttatgcatgttttcacgcaaccagaagagccattcgtgggatttagccatttcgaggcacctagaagttgaggcagccagctgtgcagccaggtgtgactgttactggcagcattgtataaaagacacgactcagctgccgtagggaggactgggttgtctggaagtattaggctcattttatatttgtgtcagaagaaatgtctgactttggggcagatgacacggtggctgcggaccaggcatggctccctaggttgaaatcagggaaaagctaatagtatcagacagatatgctttttctttggtggctgcaggatttttgctggaaaatgcactattaatcagcacttgtccaagaaagacccatccatttctgttgtcattcaagccacagttcctgatttactcggcaagatactgggccagttcagtgtctctagctgagcctgacctcggggtttgcgtctcgagtctgaaatcctgtttagtcctctgtgcatagttttgtctcattttaacgactgcatcttcttggcacatttattatactcacaactgaatggcacacaatagccttgtgttaataaaagctaccgtggcgctgtgggtgaaccgctgggttgaagtccgatggactctacgatgcaggcatccagaaatatgttgtaactctacctggctccctgccagcctggcctcctcctctgggagagctcctggcatggtcccaatgtgtacctgcatgggaacaacagctgcatgggccagctgtttcggatctaaagatgtgcagtgaaactcacattcccagattcacatccctcatgtttatttgggtcatcatggtttagcatgttgtatatatgtctggagcacttcatacacctctatccaccacagacactcttaatcacagttctgtaataataataaggcaaactatacggcaaagagaagcatgtaaatatgtaccaaatccttatgaagttgtaattgtttatatgtaaaaagtatgtatataggaacgggagaaggtgcaaggaatgtgctgaataacatccaaactgcatcgcgtctctgccccattcctgaaagcacacatctagttggagcgtcagttcctctccttagatatcattgttttcactcgtctatcataggcaccttctttacatctgattacaatacccagcatttcagaactgggtttttgcccccaaaaaggtaaatatgagcatttatcactgactcctcctggtccagtgagcagcagcagaattcaagtatttaaaaataaggtgcatttctaaattgcaggctataccttcttttccaaaccaatgggctagagtgaatttcctccaagtacttgggctgtcttactgctagctcttctaacaggggaagtctgtatgaatgcatcaccccctaataaggcaagaggaaggaccctgaaatgttgccagaaatgtactgttacatcaacatttacattatattaacatcatcacactctgtgttcaacacacagaacaacatagatactttagtttgtctaaagtaaaaatccacataaatagcagattcctttgttgacaccagtgtgttgtttaccttgtgcccatggtccagattttgagctggagaaggactatggctgttccttaaagtctctgcccttgcagaatctgtagccttcaggataccccgagtgccttacagggcttgtgaacaccgatactagaagtcaaaaagaagagagtgcccaagtgtgggtttggaggcactgacgcattcgccaactcaccgtcatcccatccttgaaaccctgagagagagtgtgtgttttatcacagtaatggaattcagtttagcctcaggaaactcatattgtgaatataggtatcaaatcatatatttgtttactgtatattttttaaaaagctttattgtaaatttatgcaaaaactaaccgggcctgttttcttacggcggcatgccaggtagtgtgtgtattctcccaggcactcccttcatagtcaccctctaaccacgtgacattccgttccatgctaagcagtattcacaggcctaaaataggtttgtatggtgatctacaagattttacaaatatttttgtattgtgattcctatgatatataccagagaattttttactcgtttgtaaattattgtacagttttaataaaaaatgttttaaatctta
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:282973 -> Molecular function: GO:0008017 [microtubule binding] evidence: IEA
            GeneID:282973 -> Molecular function: GO:0019900 [kinase binding] evidence: IEA
            GeneID:282973 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.