2024-03-28 17:45:48, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001105207 7372 bp mRNA linear PRI 28-MAY-2013 DEFINITION Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 3, mRNA. ACCESSION NM_001105207 VERSION NM_001105207.2 GI:380503845 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 7372) AUTHORS Wang,Y., Fu,W., Xie,F., Wang,Y., Chu,X., Wang,H., Shen,M., Wang,Y., Wang,Y., Sun,W., Lei,R., Yang,L., Wu,H., Foo,J., Liu,J., Jin,L. and Huang,W. TITLE Common polymorphisms in ITGA2, PON1 and THBS2 are associated with coronary atherosclerosis in a candidate gene association study of the Chinese Han population JOURNAL J. Hum. Genet. 55 (8), 490-494 (2010) PUBMED 20485444 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 2 (bases 1 to 7372) AUTHORS Senyurek,I., Klein,G., Kalbacher,H., Deeg,M. and Schittek,B. TITLE Peptides derived from the human laminin alpha4 and alpha5 chains exhibit antimicrobial activity JOURNAL Peptides 31 (8), 1468-1472 (2010) PUBMED 20433883 REMARK GeneRIF: Data from experiment with peptide fragments suggest laminin alpha4 (and laminin alpha5) may be part of host defense response and may protect tissues from invading pathogens. REFERENCE 3 (bases 1 to 7372) AUTHORS Lugassy,C., Torres-Munoz,J.E., Kleinman,H.K., Ghanem,G., Vernon,S. and Barnhill,R.L. TITLE Overexpression of malignancy-associated laminins and laminin receptors by angiotropic human melanoma cells in a chick chorioallantoic membrane model JOURNAL J. Cutan. Pathol. 36 (12), 1237-1243 (2009) PUBMED 19469865 REMARK GeneRIF: LAMC2, LAMA4, ITGB1, ITGB3, RSPA and MMP2) are overexpressed in angiotropic melanoma cells vs. non-angiotropic melanoma cells from the same tumor REFERENCE 4 (bases 1 to 7372) AUTHORS Sprenger,C.C., Drivdahl,R.H., Woodke,L.B., Eyman,D., Reed,M.J., Carter,W.G. and Plymate,S.R. TITLE Senescence-induced alterations of laminin chain expression modulate tumorigenicity of prostate cancer cells JOURNAL Neoplasia 10 (12), 1350-1361 (2008) PUBMED 19048114 REMARK GeneRIF: LM alpha4 and beta2 have roles in in vitro migration and in vivo tumorigenicity of prostate cancer cells REFERENCE 5 (bases 1 to 7372) AUTHORS Xiao,S., Lux,M.L., Reeves,R., Hudson,T.J. and Fletcher,J.A. TITLE HMGI(Y) activation by chromosome 6p21 rearrangements in multilineage mesenchymal cells from pulmonary hamartoma JOURNAL Am. J. Pathol. 150 (3), 901-910 (1997) PUBMED 9060828 REFERENCE 6 (bases 1 to 7372) AUTHORS Richards,A., Al-Imara,L. and Pope,F.M. TITLE The complete cDNA sequence of laminin alpha 4 and its relationship to the other human laminin alpha chains JOURNAL Eur. J. Biochem. 238 (3), 813-821 (1996) PUBMED 8706685 REFERENCE 7 (bases 1 to 7372) AUTHORS Iivanainen,A., Sainio,K., Sariola,H. and Tryggvason,K. TITLE Primary structure and expression of a novel human laminin alpha 4 chain JOURNAL FEBS Lett. 365 (2-3), 183-188 (1995) PUBMED 7781776 REFERENCE 8 (bases 1 to 7372) AUTHORS Ryan,M.C., Tizard,R., VanDevanter,D.R. and Carter,W.G. TITLE Cloning of the LamA3 gene encoding the alpha 3 chain of the adhesive ligand epiligrin. Expression in wound repair JOURNAL J. Biol. Chem. 269 (36), 22779-22787 (1994) PUBMED 8077230 REFERENCE 9 (bases 1 to 7372) AUTHORS Richards,A.J., al-Imara,L., Carter,N.P., Lloyd,J.C., Leversha,M.A. and Pope,F.M. TITLE Localization of the gene (LAMA4) to chromosome 6q21 and isolation of a partial cDNA encoding a variant laminin A chain JOURNAL Genomics 22 (1), 237-239 (1994) PUBMED 7959779 REFERENCE 10 (bases 1 to 7372) AUTHORS Burgeson,R.E., Chiquet,M., Deutzmann,R., Ekblom,P., Engel,J., Kleinman,H., Martin,G.R., Meneguzzi,G., Paulsson,M., Sanes,J. et al. TITLE A new nomenclature for the laminins JOURNAL Matrix Biol. 14 (3), 209-211 (1994) PUBMED 7921537 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BP234809.1, BC066552.1, AB210027.1 and Z99289.1. On Mar 16, 2012 this sequence version replaced gi:157419125. Summary: Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the alpha chain isoform laminin, alpha 4. The domain structure of alpha 4 is similar to that of alpha 3, both of which resemble truncated versions of alpha 1 and alpha 2, in that approximately 1,200 residues at the N-terminus (domains IV, V and VI) have been lost. Laminin, alpha 4 contains the C-terminal G domain which distinguishes all alpha chains from the beta and gamma chains. The RNA analysis from adult and fetal tissues revealed developmental regulation of expression, however, the exact function of laminin, alpha 4 is not known. Tissue-specific utilization of alternative polyA-signal has been described in literature. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]. Transcript Variant: This variant (3) uses alternate splice sites in the 5' UTR and 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. Variants 2 and 3 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC066552.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-5 BP234809.1 1-5 6-1885 BC066552.1 2-1881 1886-6171 AB210027.1 1742-6027 6172-7372 Z99289.1 50993-52193 c FEATURES Location/Qualifiers source 1..7372 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="6" /map="6q21" gene 1..7372 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="laminin, alpha 4" /db_xref="GeneID:3910" /db_xref="HGNC:6484" /db_xref="MIM:600133" exon 1..274 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 275..610 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" misc_feature 326..328 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="upstream in-frame stop codon" CDS 416..5866 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="isoform 2 precursor is encoded by transcript variant 3; laminin subunit alpha-4; laminin alpha 4 chain" /codon_start=1 /product="laminin subunit alpha-4 isoform 2 precursor" /protein_id="NP_001098677.2" /db_xref="GI:380503846" /db_xref="CCDS:CCDS34514.1" /db_xref="GeneID:3910" /db_xref="HGNC:6484" /db_xref="MIM:600133" /translation="
MALSSAWRSVLPLWLLWSAACSRAASGDDNAFPFDIEGSSAVGRQDPPETSEPRVALGRLPPAAEKCNAGFFHTLSGECVPCDCNGNSNECLDGSGYCVHCQRNTTGEHCEKCLDGYIGDSIRGAPQFCQPCPCPLPHLANFAESCYRKNGAVRCICNENYAGPNCERCAPGYYGNPLLIGSTCKKCDCSGNSDPNLIFEDCDEVTGQCRNCLRNTTGFKCERCAPGYYGDARIAKNCAVCNCGGGPCDSVTGECLEEGFEPPTGCDKCVWDLTDDLRLAALSIEEGKSGVLSVSSGAAAHRHVNEINATIYLLKTKLSERENQYALRKIQINNAENTMKSLLSDVEELVEKENQASRKGQLVQKESMDTINHASQLVEQAHDMRDKIQEINNKMLYYGEEHELSPKEISEKLVLAQKMLEEIRSRQPFFTQRELVDEEADEAYELLSQAESWQRLHNETRTLFPVVLEQLDDYNAKLSDLQEALDQALNYVRDAEDMNRATAARQRDHEKQQERVREQMEVVNMSLSTSADSLTTPRLTLSELDDIIKNASGIYAEIDGAKSELQVKLSNLSNLSHDLVQEAIDHAQDLQQEANELSRKLHSSDMNGLVQKALDASNVYENIVNYVSEANETAEFALNTTDRIYDAVSGIDTQIIYHKDESENLLNQARELQAKAESSSDEAVADTSRRVGGALARKSALKTRLSDAVKQLQAAERGDAQQRLGQSRLITEEANRTTMEVQQATAPMANNLTNWSQNLQHFDSSAYNTAVNSARDAVRNLTEVVPQLLDQLRTVEQKRPASNVSASIQRIRELIAQTRSVASKIQVSMMFDGQSAVEVHSRTSMDDLKAFTSLSLYMKPPVKRPELTETADQFILYLGSKNAKKEYMGLAIKNDNLVYVYNLGTKDVEIPLDSKPVSSWPAYFSIVKIERVGKHGKVFLTVPSLSSTAEEKFIKKGEFSGDDSLLDLDPEDTVFYVGGVPSNFKLPTSLNLPGFVGCLELATLNNDVISLYNFKHIYNMDPSTSVPCARDKLAFTQSRAASYFFDGSGYAVVRDITRRGKFGQVTRFDIEVRTPADNGLILLMVNGSMFFRLEMRNGYLHVFYDFGFSGGPVHLEDTLKKAQINDAKYHEISIIYHNDKKMILVVDRRHVKSMDNEKMKIPFTDIYIGGAPPEILQSRALRAHLPLDINFRGCMKGFQFQKKDFNLLEQTETLGVGYGCPEDSLISRRAYFNGQSFIASIQKISFFDGFEGGFNFRTLQPNGLLFYYASGSDVFSISLDNGTVIMDVKGIKVQSVDKQYNDGLSHFVISSVSPTRYELIVDKSRVGSKNPTKGKIEQTQASEKKFYFGGSPISAQYANFTGCISNAYFTRVDRDVEVEDFQRYTEKVHTSLYECPIESSPLFLLHKKGKNLSKPKASQNKKGGKSKDAPSWDPVALKLPERNTPRNSHCHLSNSPRAIEHAYQYGGTANSRQEFEHLKGDFGAKSQFSIRLRTRSSHGMIFYVSDQEENDFMTLFLAHGRLVYMFNVGHKKLKIRSQEKYNDGLWHDVIFIRERSSGRLVIDGLRVLEESLPPTEATWKIKGPIYLGGVAPGKAVKNVQINSIYSFSGCLSNLQLNGASITSASQTFSVTPCFEGPMETGTYFSTEGGYVVLDESFNIGLKFEIAFEVRPRSSSGTLVHGHSVNGEYLNVHMKNGQVIVKVNNGIRDFSTSVTPKQSLCDGRWHRITVIRDSNVVQLDVDSEVNHVVGPLNPKPIDHREPVFVGGVPESLLTPRLAPSKPFTGCIRHFVIDGHPVSFSKAALVSGAVSINSCPAA
" sig_peptide 416..496 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="COORDINATES: ab initio prediction:SignalP:4.0" mat_peptide 497..5863 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /product="laminin subunit alpha-4 isoform 2" misc_feature 656..787 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin-type epidermal growth factor-like domain; laminins are the major noncollagenous components of basement membranes that mediate cell adhesion, growth migration, and differentiation; the laminin-type epidermal growth factor-like module occurs in...; Region: EGF_Lam; cd00055" /db_xref="CDD:28937" misc_feature 659..778 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin EGF-like (Domains III and V); Region: Laminin_EGF; pfam00053" /db_xref="CDD:200961" misc_feature order(659..661,665..667,686..688,707..709,716..718, 743..745) /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="EGF-like motif; other site" /db_xref="CDD:28937" misc_feature 827..967 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin EGF-like (Domains III and V); Region: Laminin_EGF; pfam00053" /db_xref="CDD:200961" misc_feature 833..970 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin-type epidermal growth factor-like domain; laminins are the major noncollagenous components of basement membranes that mediate cell adhesion, growth migration, and differentiation; the laminin-type epidermal growth factor-like module occurs in...; Region: EGF_Lam; cd00055" /db_xref="CDD:28937" misc_feature order(851..853,878..880,884..886,911..913) /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="EGF-like motif; other site" /db_xref="CDD:28937" misc_feature 974..1129 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin-type epidermal growth factor-like domain; laminins are the major noncollagenous components of basement membranes that mediate cell adhesion, growth migration, and differentiation; the laminin-type epidermal growth factor-like module occurs in...; Region: EGF_Lam; cd00055" /db_xref="CDD:28937" misc_feature 974..1114 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin EGF-like (Domains III and V); Region: Laminin_EGF; pfam00053" /db_xref="CDD:200961" misc_feature order(974..976,980..982,1019..1021,1040..1042,1049..1051, 1076..1078) /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="EGF-like motif; other site" /db_xref="CDD:28937" misc_feature 1316..2059 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin Domain I; Region: Laminin_I; pfam06008" /db_xref="CDD:191425" misc_feature 1409..1999 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 1682..1699 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 1715..2566 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Uncharacterized archaeal coiled-coil protein [Function unknown]; Region: COG1340" /db_xref="CDD:31531" misc_feature 2417..>2965 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="HlyD family secretion protein; Region: HlyD; pfam00529" /db_xref="CDD:109580" misc_feature 2594..2977 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin Domain II; Region: Laminin_II; pfam06009" /db_xref="CDD:203372" misc_feature 2897..3430 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin G domain; Laminin G-like domains are usually Ca++ mediated receptors that can have binding sites for steroids, beta1 integrins, heparin, sulfatides, fibulin-1, and alpha-dystroglycans. Proteins that contain LamG domains serve a variety of...; Region: LamG; cd00110" /db_xref="CDD:29010" misc_feature 3539..4015 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin G domain; Laminin G-like domains are usually Ca++ mediated receptors that can have binding sites for steroids, beta1 integrins, heparin, sulfatides, fibulin-1, and alpha-dystroglycans. Proteins that contain LamG domains serve a variety of...; Region: LamG; cd00110" /db_xref="CDD:29010" misc_feature 4103..4522 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin G domain; Laminin G-like domains are usually Ca++ mediated receptors that can have binding sites for steroids, beta1 integrins, heparin, sulfatides, fibulin-1, and alpha-dystroglycans. Proteins that contain LamG domains serve a variety of...; Region: LamG; cd00110" /db_xref="CDD:29010" misc_feature 4859..5266 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin G domain; Laminin G-like domains are usually Ca++ mediated receptors that can have binding sites for steroids, beta1 integrins, heparin, sulfatides, fibulin-1, and alpha-dystroglycans. Proteins that contain LamG domains serve a variety of...; Region: LamG; cd00110" /db_xref="CDD:29010" misc_feature 5339..5791 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /note="Laminin G domain; Laminin G-like domains are usually Ca++ mediated receptors that can have binding sites for steroids, beta1 integrins, heparin, sulfatides, fibulin-1, and alpha-dystroglycans. Proteins that contain LamG domains serve a variety of...; Region: LamG; cd00110" /db_xref="CDD:29010" variation 522 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="c" /replace="t" /db_xref="dbSNP:70940809" exon 611..712 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 695 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="a" /replace="g" /db_xref="dbSNP:35349917" exon 713..837 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 838..918 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 919..1133 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 1134..1208 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 1209..1360 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 1361..1471 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 1366 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="a" /replace="c" /db_xref="dbSNP:70940813" exon 1472..1583 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 1584..1751 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 1752..1945 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 1886 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="c" /replace="t" /db_xref="dbSNP:1050348" exon 1946..2062 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 2063..2211 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 2212..2353 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 2354..2450 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 2451..2567 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 2539 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="c" /replace="t" /db_xref="dbSNP:70940810" exon 2568..2747 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 2748..2887 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 2888..3061 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 3049 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="c" /replace="t" /db_xref="dbSNP:35772073" exon 3062..3207 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 3204 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="a" /replace="g" /db_xref="dbSNP:35605307" exon 3208..3370 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 3371..3504 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 3505..3676 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 3677..3808 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 3750 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="c" /replace="g" /db_xref="dbSNP:1050349" exon 3809..3951 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 3952..4090 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 4091..4228 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 4229..4362 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 4337 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="a" /replace="g" /db_xref="dbSNP:70940811" exon 4363..4527 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 4459 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="c" /replace="t" /db_xref="dbSNP:34753919" exon 4528..4681 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 4567 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="c" /replace="t" /db_xref="dbSNP:35042032" exon 4682..4869 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 4870..5059 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 4952 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="a" /replace="g" /db_xref="dbSNP:34256052" exon 5060..5215 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 5110 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="c" /replace="t" /db_xref="dbSNP:35679345" exon 5216..5375 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 5376..5506 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 5507..5600 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" variation 5554 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="a" /replace="t" /db_xref="dbSNP:1050353" exon 5601..5720 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" exon 5721..7372 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /inference="alignment:Splign:1.39.8" STS 5836..5946 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /standard_name="D6S1133E" /db_xref="UniSTS:35049" variation 5837 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="a" /replace="g" /db_xref="dbSNP:3734292" variation 5913 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="a" /replace="g" /db_xref="dbSNP:11495" STS 5988..6114 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /standard_name="RH18133" /db_xref="UniSTS:76207" variation 6083 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /replace="a" /replace="t" /db_xref="dbSNP:1050447" polyA_signal 6148..6153 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" polyA_site 6174 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" STS 7205..7304 /gene="LAMA4" /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1" /standard_name="A006N46" /db_xref="UniSTS:28608" ORIGIN
gaatattcttctggagcccttggaggggctccaaactgagaggggagggaagaccgcagggaaaggcggacctcagtgtctgaaaagccagcttagagtgggagggcctgggagtagaaggtaaaaagggagtggtgagaatgaatgtgagaaggaagccaggacagcgcagtccccagtcccgaacggccagggagaggaggtggcctagcgctggcggggctcaccccaatccgtctgccttttgatgccgtactgtaagctccgtccatctctgctggttgcgcagccacctcgggatactgcacacggagaggagggaaaataagcgaggcaccgccgcaccacgcgggagacctacggagacccacagcgcccgagccctggaagagcactactggatgtcagcggagaaatggctttgagctcagcctggcgctcggttctgcctctgtggctcctctggagcgctgcctgctcccgcgccgcgtccggggacgacaacgcttttccttttgacattgaagggagctcagcggttggcaggcaagacccgcctgagacgagcgaaccccgcgtggctctgggacgcctgccgcctgcggccgagaaatgcaatgctggattctttcacaccctgtcgggagaatgtgtgccctgcgactgtaatggcaattccaacgagtgtttggacggctcaggatactgtgtgcactgccagcggaacacaacaggagagcactgtgaaaagtgtctggatggttatatcggagattccatcaggggagcaccccaattctgccagccgtgcccctgtcccctgccccacttggccaattttgcagaatcctgctataggaaaaatggagctgttcggtgcatttgtaacgaaaattatgctggacctaactgtgaaagatgtgctcccggttactatggaaaccccttactcattggaagcacctgtaagaaatgtgactgcagtggaaattcagatcccaacctgatctttgaagattgtgatgaagtcactggccagtgtaggaattgcttacgcaacaccaccggattcaagtgtgaacgttgcgctcctggctactatggggacgccaggatagccaagaactgtgcagtgtgcaactgcgggggaggcccatgtgacagtgtaaccggagaatgcttggaagaaggttttgaaccccctacaggctgtgataagtgcgtctgggacctgactgatgacctgcggttagcagcgctctccatcgaggaaggcaaatccggggtgctgagcgtatcctctggggccgccgctcataggcacgtgaatgaaatcaacgccaccatctacctcctcaaaacaaaattgtcagaaagagaaaaccaatacgccctaagaaagatacaaatcaacaatgctgagaacacgatgaaaagccttctgtctgacgtagaggaattagttgaaaaggaaaatcaagcctccagaaaaggacaacttgttcagaaggaaagcatggacaccattaaccacgcaagtcagctggtagagcaagcccatgatatgagggataaaatccaagagatcaacaacaagatgctctattatggggaagagcatgaacttagccccaaggaaatctctgagaagctggtgttggcccagaagatgcttgaagagattagaagccgtcaaccatttttcacccaacgggagctcgtggatgaggaggcagatgaggcttacgaactactgagccaggctgagagctggcagcggctgcacaatgagacccgcactctgtttcctgtcgtcctggagcagctggatgactacaatgctaagttgtcagatctccaggaagcacttgaccaggcccttaactatgtcagggatgccgaagacatgaacagggccacagcagccaggcagcgggaccatgagaaacaacaggaaagagtgagggaacaaatggaagtggtgaacatgtctctgagcacatctgcggactctctgacaacacctcgtctaactctttcagaacttgatgatataataaagaatgcgtcagggatttatgcagaaatagatggagccaaaagtgaactacaagtaaaactatctaacctaagtaacctcagccatgatttagtccaagaagctattgaccatgcacaggaccttcaacaagaagctaatgaattgagcaggaagttgcacagttcagatatgaacgggctggtacagaaggctttggatgcatcaaatgtctatgaaaatattgttaattatgttagtgaagccaatgaaacagcagaatttgctttgaacaccactgaccgaatttatgatgcggtgagtgggattgatactcaaatcatttaccataaagatgaaagtgagaacctcctcaatcaagccagagaactgcaagcaaaggcagagtctagcagtgatgaagcagtggctgacactagcaggcgtgtgggtggagccctagcaaggaaaagtgcccttaaaaccagactcagtgatgccgttaagcaactacaagcagcagagagaggggatgcccagcagcgcctggggcagtctagactgatcaccgaggaagccaacaggacgacgatggaggtgcagcaggccactgcccccatggccaacaatctaaccaactggtcacagaatcttcaacattttgactcttctgcttacaacactgcagtgaactctgctagggatgcagtaagaaatctgaccgaggttgtccctcagctcctggatcagcttcgtacggttgagcagaagcgacctgcaagcaacgtttctgccagcatccagaggatccgagagctcattgctcagaccagaagtgttgccagcaagatccaagtctccatgatgtttgatggccagtcagctgtggaagtgcactcgagaaccagtatggatgacttaaaggccttcacgtctctgagcctgtacatgaaaccccctgtgaagcggccggaactgaccgagactgcagatcagtttatcctgtacctcggaagcaaaaacgccaaaaaagagtatatgggtcttgcaatcaaaaatgataatctggtatacgtctataatttgggaactaaagatgtggagattcccctggactccaagcccgtcagttcctggcctgcttacttcagcattgtcaagattgaaagggtgggaaaacatggaaaggtgtttttaacagtcccgagtctaagtagcacagcagaggaaaagttcattaaaaagggggaattttcgggagatgactctctgctggacctggaccctgaggacacagtgttttatgttggtggagtgccttccaacttcaagctccctaccagcttaaacctgcctggctttgttggctgcctggaactggccactttgaataatgatgtgatcagcttgtacaactttaagcacatctataatatggacccctccacatcagtgccatgtgcccgagataagctggccttcactcagagtcgggctgccagttacttcttcgatggctccggttatgccgtggtgagagacatcacaaggagagggaaatttggtcaggtgactcgctttgacatagaagttcgaacaccagctgacaacggccttattctcctgatggtcaatggaagtatgtttttcagactggaaatgcgcaatggttacctacatgtgttctatgattttggattcagcggtggccctgtgcatcttgaagatacgttaaagaaagctcaaattaatgatgcaaaataccatgagatctcaatcatttaccacaatgataagaaaatgatcttggtagttgacagaaggcatgtcaagagcatggataatgaaaagatgaaaataccttttacagatatatacattggaggagctcctccagaaatcttacaatccagggccctcagagcacaccttcccctagatatcaacttcagaggatgcatgaagggcttccagttccaaaagaaggacttcaatttactggagcagacagaaaccctgggagttggttatggatgcccagaagactcacttatatctcgcagagcatatttcaatggacagagcttcattgcttcaattcagaaaatatctttctttgatggctttgaaggaggttttaatttccgaacattacaaccaaatgggttactattctattatgcttcagggtcagacgtgttctccatctcactggataatggtactgtcatcatggatgtaaagggaatcaaagttcagtcagtagataagcagtacaatgatgggctgtcccacttcgtcattagctctgtctcacccacaagatatgaactgatagtagataaaagcagagttgggagtaagaatcctaccaaagggaaaatagaacagacacaagcaagtgaaaagaagttttacttcggtggctcaccaatcagtgctcagtatgctaatttcactggctgcataagtaatgcctactttaccagggtggatagagatgtggaggttgaagatttccaacggtatactgaaaaggtccacacttctctttatgagtgtcccattgagtcttcaccattgtttctcctccataaaaaaggaaaaaatttatccaagcctaaagcaagtcagaataaaaagggagggaaaagtaaagatgcaccttcatgggatcctgttgctctgaaactcccagagcggaatactccaagaaactctcattgccacctttccaacagccctagagcaatagagcacgcctatcaatatggaggaacagccaacagccgccaagagtttgaacacttaaaaggagattttggtgccaaatctcagttttccattcgtctgagaactcgttcctcccatggcatgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttggcccatggccgcttggtttacatgtttaatgttggtcacaaaaaactgaagattagaagccaggagaaatacaatgatggcctgtggcatgatgtgatatttattcgagaaaggagcagtggccgactggtaattgatggtctccgagtcctagaagaaagtcttcctcctactgaagctacctggaaaatcaagggtcccatttatttgggaggtgtggctcctggaaaggctgtgaaaaatgttcagattaactccatctacagttttagtggctgtctcagcaatctccagctcaatggggcctccatcacctctgcttctcagacattcagtgtgaccccttgctttgaaggccccatggaaacaggaacttacttttcaacagaaggaggatacgtggttctagatgaatctttcaatattggattgaagtttgaaattgcatttgaagtccgtcccagaagcagttccggaaccctggtccacggccacagtgtcaatggggagtacctaaatgttcacatgaaaaatggacaggtcatagtgaaagtcaataatggcatcagagatttttccacctcagttacacccaagcagagtctctgtgatggcagatggcacagaattacagttattagagattctaatgtggttcagttggatgtggactctgaagtgaaccatgtggttggacccctgaatccaaaaccaattgatcacagggagcctgtgtttgttggaggtgttccagaatctctactgacaccacgcttggcccccagcaaacccttcacaggctgcatacgccactttgtgattgatggacacccagtgagcttcagtaaagcagccctggtcagcggcgccgtaagcatcaactcctgtccagcagcctgacatgacagagcacagctgcccaaatacaaagttctttagagcactgaaagaaacacaaagccagccaggaggaacagtaactcttccttcgggtggaagctttcatcgagttgaacaggacttaaacgaatcatcagggaccggatatttcttatttctcatttggattcttaaccttgaatccaaagtgtctgcaatggacaacaattgaaggagtggcaaacttacttgtattgagagcacacgcaattcctactggtgaaattactgtttctgtttctaataaaatagaagggattccaaataaacacttgcacacatttttgaagtgcggctagattctcagattcacctttcttccagggaagataactttcaatctatataaaaatctctgtcctaaaactacctttctttattttgaagagacttactaacttacatataatctaaattagatgatagatttgtttttagcccttttgtttggtctatcagtataagaagaatattttaggtttatagctgaagttatcaaggtttaataaagtaaatttctaacagaatactagaaaaatgcagtataatttaattttttctaaataagaaacacaggaaatcaactactttttccccttccttatctccttaaaagaaaaataaaattgtacatgagaggaggcttctgtaggttattattaccattattgtgtgttctatgggaatcattgaggatatcacagcaaaaacagtaggacaaaatcataaaattcaatttaagagtacacaagtccttttattaaaagtttgctcctagcctgggcaacataatgagatcccatctctgcaaaaaaatttgtacatgggcatacacctgtagtcccagctacttgggaggctgagacgggaggatcgcttaagctcaggagttcaaggctgcagtgagctatgactgctgactgtacctgcactccagcctgggcaacagagtgagatcctgtctcaaaaacaaagtgtgctctccacatacctgcaacacaactagtcttatttctaaaatgttataatcttttttccaagtagctacattaatatagtctagaaaaaaatggacttgaatagctggtagaatattaaaatatagaaatgaaataaaagaattatatctaaaaacctcaactcagaagacagaaaaagagaaaataggccctgatatcaacagaattaacaatacataaaaggagtaacttttgaggggagaggatataaaatattttgaggaattaccaaggggaataaaacaatgttaccttgaaatgattatatatatattacatattggtatatatgtccatacctacctatatcccctgctacccttctgtctgaaatatacaaataatgataatgttgaagatatcgataaacatagctaatgtctgttcatagaggacttactaagtgccagccaccatgataagctaaagttaattattttatttgttc
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:3910 -> Molecular function: GO:0005102 [receptor binding] evidence: IEA GeneID:3910 -> Molecular function: GO:0005201 [extracellular matrix structural constituent] evidence: TAS GeneID:3910 -> Biological process: GO:0001568 [blood vessel development] evidence: IEA GeneID:3910 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA GeneID:3910 -> Biological process: GO:0030155 [regulation of cell adhesion] evidence: IEA GeneID:3910 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS GeneID:3910 -> Biological process: GO:0030334 [regulation of cell migration] evidence: IEA GeneID:3910 -> Biological process: GO:0045995 [regulation of embryonic development] evidence: IEA GeneID:3910 -> Biological process: GO:0050873 [brown fat cell differentiation] evidence: IEA GeneID:3910 -> Cellular component: GO:0005604 [basement membrane] evidence: IDA GeneID:3910 -> Cellular component: GO:0005605 [basal lamina] evidence: TAS GeneID:3910 -> Cellular component: GO:0005606 [laminin-1 complex] evidence: IEA GeneID:3910 -> Cellular component: GO:0031012 [extracellular matrix] evidence: ISS GeneID:3910 -> Cellular component: GO:0070062 [extracellular vesicular exosome] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.