2024-04-20 10:27:56, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001105078 4891 bp mRNA linear PRI 16-JUN-2013 DEFINITION Homo sapiens MDS1 and EVI1 complex locus (MECOM), transcript variant 3, mRNA. ACCESSION NM_001105078 VERSION NM_001105078.3 GI:255683382 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 4891) AUTHORS Senyuk,V., Zhang,Y., Liu,Y., Ming,M., Premanand,K., Zhou,L., Chen,P., Chen,J., Rowley,J.D., Nucifora,G. and Qian,Z. TITLE Critical role of miR-9 in myelopoiesis and EVI1-induced leukemogenesis JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (14), 5594-5599 (2013) PUBMED 23509296 REMARK GeneRIF: EVI1 binds to the promoter of miR-9-3, leading to DNA hypermethylation of the promoter and repression of miR-9. REFERENCE 2 (bases 1 to 4891) AUTHORS Hwang,J.Y., Lee,S.H., Go,M.J., Kim,B.J., Kou,I., Ikegawa,S., Guo,Y., Deng,H.W., Raychaudhuri,S., Kim,Y.J., Oh,J.H., Kim,Y., Moon,S., Kim,D.J., Koo,H., Cha,M.J., Lee,M.H., Yun,J.Y., Yoo,H.S., Kang,Y.A., Cho,E.H., Kim,S.W., Oh,K.W., Kang,M.I., Son,H.Y., Kim,S.Y., Kim,G.S., Han,B.G., Cho,Y.S., Cho,M.C., Lee,J.Y. and Koh,J.M. TITLE Meta-analysis identifies a MECOM gene as a novel predisposing factor of osteoporotic fracture JOURNAL J. Med. Genet. 50 (4), 212-219 (2013) PUBMED 23349225 REFERENCE 3 (bases 1 to 4891) AUTHORS Steinleitner,K., Rampetsreiter,P., Koffel,R., Ramanathan,G., Mannhalter,C., Strobl,H. and Wieser,R. TITLE EVI1 and MDS1/EVI1 expression during primary human hematopoietic progenitor cell differentiation into various myeloid lineages JOURNAL Anticancer Res. 32 (11), 4883-4889 (2012) PUBMED 23155256 REMARK GeneRIF: EVI1 is expressed in human hematopoietic progenitor cells, but is down-regulated during differentiation REFERENCE 4 (bases 1 to 4891) AUTHORS Hancock,D.B., Artigas,M.S., Gharib,S.A., Henry,A., Manichaikul,A., Ramasamy,A., Loth,D.W., Imboden,M., Koch,B., McArdle,W.L., Smith,A.V., Smolonska,J., Sood,A., Tang,W., Wilk,J.B., Zhai,G., Zhao,J.H., Aschard,H., Burkart,K.M., Curjuric,I., Eijgelsheim,M., Elliott,P., Gu,X., Harris,T.B., Janson,C., Homuth,G., Hysi,P.G., Liu,J.Z., Loehr,L.R., Lohman,K., Loos,R.J., Manning,A.K., Marciante,K.D., Obeidat,M., Postma,D.S., Aldrich,M.C., Brusselle,G.G., Chen,T.H., Eiriksdottir,G., Franceschini,N., Heinrich,J., Rotter,J.I., Wijmenga,C., Williams,O.D., Bentley,A.R., Hofman,A., Laurie,C.C., Lumley,T., Morrison,A.C., Joubert,B.R., Rivadeneira,F., Couper,D.J., Kritchevsky,S.B., Liu,Y., Wjst,M., Wain,L.V., Vonk,J.M., Uitterlinden,A.G., Rochat,T., Rich,S.S., Psaty,B.M., O'Connor,G.T., North,K.E., Mirel,D.B., Meibohm,B., Launer,L.J., Khaw,K.T., Hartikainen,A.L., Hammond,C.J., Glaser,S., Marchini,J., Kraft,P., Wareham,N.J., Volzke,H., Stricker,B.H., Spector,T.D., Probst-Hensch,N.M., Jarvis,D., Jarvelin,M.R., Heckbert,S.R., Gudnason,V., Boezen,H.M., Barr,R.G., Cassano,P.A., Strachan,D.P., Fornage,M., Hall,I.P., Dupuis,J., Tobin,M.D. and London,S.J. TITLE Genome-wide joint meta-analysis of SNP and SNP-by-smoking interaction identifies novel loci for pulmonary function JOURNAL PLoS Genet. 8 (12), E1003098 (2012) PUBMED 23284291 REFERENCE 5 (bases 1 to 4891) AUTHORS Haas,K., Kundi,M., Sperr,W.R., Esterbauer,H., Ludwig,W.D., Ratei,R., Koller,E., Gruener,H., Sauerland,C., Fonatsch,C., Valent,P. and Wieser,R. TITLE Expression and prognostic significance of different mRNA 5'-end variants of the oncogene EVI1 in 266 patients with de novo AML: EVI1 and MDS1/EVI1 overexpression both predict short remission duration JOURNAL Genes Chromosomes Cancer 47 (4), 288-298 (2008) PUBMED 18181178 REMARK GeneRIF: EVI1 and MDS1/EVI1 overexpression is associated with acute myeloid leukemia REFERENCE 6 (bases 1 to 4891) AUTHORS Aytekin,M., Vinatzer,U., Musteanu,M., Raynaud,S. and Wieser,R. TITLE Regulation of the expression of the oncogene EVI1 through the use of alternative mRNA 5'-ends JOURNAL Gene 356, 160-168 (2005) PUBMED 16014322 REMARK GeneRIF: The general expression patterns of the EVI1 5'-end variants in a panel of 20 human tissues were similar, while pronounced differences were noted in response to all-trans retinoic acid. REFERENCE 7 (bases 1 to 4891) AUTHORS Mochizuki,N., Shimizu,S., Nagasawa,T., Tanaka,H., Taniwaki,M., Yokota,J. and Morishita,K. TITLE A novel gene, MEL1, mapped to 1p36.3 is highly homologous to the MDS1/EVI1 gene and is transcriptionally activated in t(1;3)(p36;q21)-positive leukemia cells JOURNAL Blood 96 (9), 3209-3214 (2000) PUBMED 11050005 REFERENCE 8 (bases 1 to 4891) AUTHORS Nucifora,G., Begy,C.R., Kobayashi,H., Roulston,D., Claxton,D., Pedersen-Bjergaard,J., Parganas,E., Ihle,J.N. and Rowley,J.D. TITLE Consistent intergenic splicing and production of multiple transcripts between AML1 at 21q22 and unrelated genes at 3q26 in (3;21)(q26;q22) translocations JOURNAL Proc. Natl. Acad. Sci. U.S.A. 91 (9), 4004-4008 (1994) PUBMED 8171026 REFERENCE 9 (bases 1 to 4891) AUTHORS Mitani,K., Ogawa,S., Tanaka,T., Miyoshi,H., Kurokawa,M., Mano,H., Yazaki,Y., Ohki,M. and Hirai,H. TITLE Generation of the AML1-EVI-1 fusion gene in the t(3;21)(q26;q22) causes blastic crisis in chronic myelocytic leukemia JOURNAL EMBO J. 13 (3), 504-510 (1994) PUBMED 8313895 REFERENCE 10 (bases 1 to 4891) AUTHORS Morishita,K., Parganas,E., Douglass,E.C. and Ihle,J.N. TITLE Unique expression of the human Evi-1 gene in an endometrial carcinoma cell line: sequence of cDNAs and structure of alternatively spliced transcripts JOURNAL Oncogene 5 (7), 963-971 (1990) PUBMED 2115646 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BX484790.1, AK292865.1, AC078985.14, BX647613.1 and AA043944.1. On Aug 8, 2009 this sequence version replaced gi:157364944. Summary: The protein encoded by this gene is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B, MAPK8, and MAPK9. This gene can undergo translocation with the AML1 gene, resulting in overexpression of this gene and the onset of leukemia. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]. Transcript Variant: This variant (3, also known as EVI1_1b) differs in the 5' UTR, lacks a portion of the 5' coding region, initiates translation at a downstream start codon, and uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, and 7 all encode the same isoform. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK292865.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-73 BX484790.1 2-74 74-1226 AK292865.1 1-1153 1227-1227 AC078985.14 90103-90103 c 1228-2513 AK292865.1 1155-2440 2514-2514 AC078985.14 75775-75775 c 2515-3299 AK292865.1 2442-3226 3300-3300 AC078985.14 62743-62743 c 3301-3628 AK292865.1 3228-3555 3629-4883 BX647613.1 4210-5464 4884-4891 AA043944.1 3-10 c FEATURES Location/Qualifiers source 1..4891 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="3" /map="3q26.2" gene 1..4891 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="MDS1 and EVI1 complex locus" /db_xref="GeneID:2122" /db_xref="HGNC:3498" /db_xref="MIM:165215" exon 1..136 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" variation 126 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="g" /replace="t" /db_xref="dbSNP:1420477" exon 137..271 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 272..374 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" CDS 326..3481 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="isoform b is encoded by transcript variant 3; MDS1 and EVI1 complex locus protein EVI1; MDS1 and EVI1 complex locus protein MDS1; oncogene EVI1; myelodysplasia syndrome-associated protein 1; zinc finger protein Evi1; AML1-EVI-1 fusion protein; ecotropic virus integration site 1 protein homolog" /codon_start=1 /product="MDS1 and EVI1 complex locus protein EVI1 isoform b" /protein_id="NP_001098548.2" /db_xref="GI:157364945" /db_xref="CCDS:CCDS3205.1" /db_xref="GeneID:2122" /db_xref="HGNC:3498" /db_xref="MIM:165215" /translation="
MKSEDYPHETMAPDIHEERQYRCEDCDQLFESKAELADHQKFPCSTPHSAFSMVEEDFQQKLESENDLQEIHTIQECKECDQVFPDLQSLEKHMLSHTEEREYKCDQCPKAFNWKSNLIRHQMSHDSGKHYECENCAKVFTDPSNLQRHIRSQHVGARAHACPECGKTFATSSGLKQHKHIHSSVKPFICEVCHKSYTQFSNLCRHKRMHADCRTQIKCKDCGQMFSTTSSLNKHRRFCEGKNHFAAGGFFGQGISLPGTPAMDKTSMVNMSHANPGLADYFGANRHPAGLTFPTAPGFSFSFPGLFPSGLYHRPPLIPASSPVKGLSSTEQTNKSQSPLMTHPQILPATQDILKALSKHPSVGDNKPVELQPERSSEERPFEKISDQSESSDLDDVSTPSGSDLETTSGSDLESDIESDKEKFKENGKMFKDKVSPLQNLASINNKKEYSNHSIFSPSLEEQTAVSGAVNDSIKAIASIAEKYFGSTGLVGLQDKKVGALPYPSMFPLPFFPAFSQSMYPFPDRDLRSLPLKMEPQSPGEVKKLQKGSSESPFDLTTKRKDEKPLTPVPSKPPVTPATSQDQPLDLSMGSRSRASGTKLTEPRKNHVFGGKKGSNVESRPASDGSLQHARPTPFFMDPIYRVEKRKLTDPLEALKEKYLRPSPGFLFHPQFQLPDQRTWMSAIENMAEKLESFSALKPEASELLQSVPSMFNFRAPPNALPENLLRKGKERYTCRYCGKIFPRSANLTRHLRTHTGEQPYRCKYCDRSFSISSNLQRHVRNIHNKEKPFKCHLCDRCFGQQTNLDRHLKKHENGNMSGTATSSPHSELESTGAILDDKEDAYFTEIRNFIGNSNHGSQSPRNVEERMNGSHFKDEKALVTSQNSDLLDDEEVEDEVLLDEEDEDNDITGKTGKEPVTSNLHEGNPEDDYEETSALEMSCKTSPVRYKEEEYKSGLSALDHIRHFTDSLKMRKMEDNQYSEAELSSFSTSHVPEELKQPLHRKSKSQAYAMMLSLSDKESLHSTSHSSSNVWHSMARAAAESSAIQSISHV
" misc_feature 326..1081 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q03112.2); Region: Interaction with MAPK9, SMAD3 and probably SUV39H1" misc_feature 590..664 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc-finger double domain; Region: zf-H2C2_2; pfam13465" /db_xref="CDD:205643" misc_feature 635..700 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478" /db_xref="CDD:210117" misc_feature 758..838 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc-finger double domain; Region: zf-H2C2_2; pfam13465" /db_xref="CDD:205643" misc_feature 890..955 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478" /db_xref="CDD:210117" misc_feature 977..1042 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478" /db_xref="CDD:210117" misc_feature 1586..1627 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q03112.2); Region: Nuclear localization signal (Potential)" misc_feature 1982..1996 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q03112.2); Region: CTBP-binding motif 1 (By similarity)" misc_feature 2075..2089 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q03112.2); Region: CTBP-binding motif 2 (By similarity)" misc_feature 2525..2590 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478" /db_xref="CDD:210117" misc_feature 2564..2638 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc-finger double domain; Region: zf-H2C2_2; pfam13465" /db_xref="CDD:205643" misc_feature 2648..2722 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc-finger double domain; Region: zf-H2C2_2; pfam13465" /db_xref="CDD:205643" misc_feature 2903..2905 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q03112.2); phosphorylation site" exon 375..591 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 592..739 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" variation 645 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="a" /replace="g" /db_xref="dbSNP:34896995" STS 688..1895 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /standard_name="Evi1" /db_xref="UniSTS:256974" STS 688..1154 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /standard_name="Evi1" /db_xref="UniSTS:256973" exon 740..893 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 894..2250 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" variation 1036 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="a" /replace="g" /db_xref="dbSNP:35594969" variation 1079 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="g" /replace="t" /db_xref="dbSNP:199968662" STS 1339..2285 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /standard_name="Evi1" /db_xref="UniSTS:506889" variation 1958 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="c" /replace="t" /db_xref="dbSNP:2276719" exon 2251..2338 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 2339..2365 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 2366..2532 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" variation 2435 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="a" /replace="c" /db_xref="dbSNP:36043407" exon 2533..2610 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 2611..2780 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" variation 2702 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="c" /replace="t" /db_xref="dbSNP:34224062" exon 2781..2925 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 2926..3162 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 3163..3346 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 3347..4891 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" STS 3365..3584 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /standard_name="SHGC-77524" /db_xref="UniSTS:47700" STS 3882..4169 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /standard_name="SGC38138" /db_xref="UniSTS:74058" variation 4069 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="c" /replace="t" /db_xref="dbSNP:1048601" variation 4683 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="g" /replace="t" /db_xref="dbSNP:1048604" polyA_signal 4863..4868 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" polyA_site 4891 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" ORIGIN
agccttctttcctcctcgcccgcagtctcgcggagccctgctgcttatctacgttgctaagccgggcgatttccttgttcctcctgcgaaacggtgcggtctggacacgtctccggggtgggtcgtccggccttcgatcttagacgaattttacaatgtgaagttctgcatagatgccagtcaaccagatgttggaagctggctcaagtacattagattcgctggctgttatgatcagcacaaccttgttgcatgccagataaatgatcagatattctatagagtagttgcagacattgcgccgggagaggagcttctgctgttcatgaagagcgaagactatccccatgaaactatggcgccggatatccacgaagaacggcaatatcgctgcgaagactgtgaccagctctttgaatctaaggctgaactagcagatcaccaaaagtttccatgcagtactcctcactcagcattttcaatggttgaagaggactttcagcaaaaactcgaaagcgagaatgatctccaagagatacacacgatccaggagtgtaaggaatgtgaccaagtttttcctgatttgcaaagcctggagaaacacatgctgtcacatactgaagagagggaatacaagtgtgatcagtgtcccaaggcatttaactggaagtccaatttaattcgccaccagatgtcacatgacagtggaaagcactatgaatgtgaaaactgtgccaaggttttcacggaccctagcaaccttcagcggcacattcgctctcagcatgtcggtgcccgggcccatgcatgcccggagtgtggcaaaacgtttgccacttcgtcgggcctcaaacaacacaagcacatccacagcagtgtgaagccctttatctgtgaggtctgccataaatcctatactcagttttcaaacctttgccgtcataagcgcatgcatgctgattgcagaacccaaatcaagtgcaaagactgtggacaaatgttcagcactacgtcttccttaaataaacacaggaggttttgtgagggcaagaaccattttgcggcaggtggattttttggccaaggcatttcacttcctggaaccccagctatggataaaacgtccatggttaatatgagtcatgccaacccgggccttgctgactattttggcgccaataggcatcctgctggtcttacctttccaacagctcctggattttcttttagcttccctggtctgtttccttccggcttgtaccacaggcctcctttgatacctgctagttctcctgttaaaggactatcaagtactgaacagacaaacaaaagtcaaagtcccctcatgacacatcctcagatactgccagctacacaggatattttgaaggcactatctaaacacccatctgtaggggacaataagccagtggagctccagcccgagaggtcctctgaagagaggccctttgagaaaatcagtgaccagtcagagagtagtgaccttgatgatgtcagtacaccaagtggcagtgacctggaaacaacctcgggctctgatctggaaagtgacattgaaagtgataaagagaaatttaaagaaaatggtaaaatgttcaaagacaaagtaagccctcttcagaatctggcttcaataaataataagaaagaatacagcaatcattccattttctcaccatctttagaggagcagactgcggtgtcaggagctgtgaatgattctataaaggctattgcttctattgctgaaaaatactttggttcaacaggactggtggggctgcaagacaaaaaagttggagctttaccttacccttccatgtttcccctcccattttttccagcattctctcaatcaatgtacccatttcctgatagagacttgagatcgttacctttgaaaatggaaccccaatcaccaggtgaagtaaagaaactgcagaagggcagctctgagtccccctttgatctcaccactaagcgaaaggatgagaagcccttgactccagtcccctccaagcctccagtgacacctgccacaagccaagaccagcccctggatctaagtatgggcagtaggagtagagccagtgggacaaagctgactgagcctcgaaaaaaccacgtgtttgggggaaaaaaaggaagcaacgtcgaatcaagacctgcttcagatggttccttgcagcatgcaagacccactcctttctttatggaccctatttacagagtagagaaaagaaaactaactgacccacttgaagctttaaaagagaaatacttgaggccttctccaggattcttgtttcacccacaattccaactgcctgatcagagaacttggatgtcagctattgaaaacatggcagaaaagctagagagcttcagtgccctgaaacctgaggccagtgagctcttacagtcagtgccctctatgttcaacttcagggcgcctcccaatgccctgccagagaaccttctgcggaagggaaaggagcgctatacctgcagatactgtggcaagatttttccaaggtctgcaaacctaacacggcacttgagaacccacacaggagagcagccttacagatgcaaatactgtgacagatcatttagcatatcttctaacttgcaaaggcatgttcgcaacatccacaataaagagaagccatttaagtgtcacttatgtgataggtgttttggtcaacaaaccaatttagacagacacctaaagaaacatgagaatgggaacatgtccggtacagcaacatcgtcgcctcattctgaactggaaagtacaggtgcgattctggatgacaaagaagatgcttacttcacagaaattcgaaatttcattgggaacagcaaccatggcagccaatctcccaggaatgtggaggagagaatgaatggcagtcattttaaagatgaaaaggctttggtgaccagtcaaaattcagacttgctggatgatgaagaagttgaagatgaggtgttgttagatgaggaggatgaagacaatgatattactggaaaaacaggaaaggaaccagtgacaagtaatttacatgaaggaaaccctgaggatgactatgaagaaaccagtgccctggagatgagttgcaagacatccccagtgaggtataaagaggaagaatataaaagtggactttctgctctagatcatataaggcacttcacagatagcctcaaaatgaggaaaatggaagataatcaatattctgaagctgagctgtcttcttttagtacttcccatgtgccagaggaacttaagcagccgttacacagaaagtccaaatcgcaggcatatgctatgatgctgtcactgtctgacaaggagtccctccattctacatcccacagttcttccaacgtgtggcacagtatggccagggctgcggcggaatccagtgctatccagtccataagccacgtatgacgttatcaaggttgaccagagtgggaccaagtccaacagtagcatggctctttcatataggactatttacaagactgctgagcagaatgccttataaacctgcagggtcactcatctaaagtctagtgaccttaaactgaatgatttaaaaaagaaaagaaagaaaaaagaaactatttattctcgatattttgttttgcacagcaaaggcagctgctgacttctggaagatcaatcaatgcgacttaaagtgattcagtgaaaacaaaaaacttggtgggctgaaggcatcttccagtttaccccaccttagggtatgggtgggtgagaagggcagttgagatggcagcattgatatgaatgaacactccatagaaactgaattctcttttgtacaagatcacctgacatgattgggaacagttgcttttaattacagatttaatttttttcttcgttaaagttttatgtaatttaaccctttgaagacagaagtagttggatgaaatgcacagtcaattattatagaaactgataacagggagtacttgttcccccttttgccttcttaagtacattgtttaaaactagggaaaaagggtatgtgtatattgtaaactatggatgttaacactcaaagaggttaagtcagtgaagtaacctattcatcaccagtaccgctgtaccactaataaattgtttgccaaatccttgtaataacatcttaattttagacaatcatgtcactgtttttaatgtttatttttttgtgtgtgttgcgtgtatcatgtatttatttgttggcaaactattgtttgttgattaaaatagcactgttccagtcagccactactttatgacgtctgaggcacacccctttccgaatttcaaggaccaaggtgacccgacctgtgtatgagagtgccaaatggtgtttggcttttcttaacattcctttttgtttgtttgttttgttttccttcttaatgaactaaatacgaatagatgcaacttagtttttgtaatactgaaatcgattcaattgtataaacgattataatttctttcatggaagcatgattcttctgattaaaaactgtactccatattttatgctggttgtctgcaagcttgtgcgatgttatgttcatgttaatcctatttgtaaaatgaagtgttcccaaccttatgttaaaagagagaagtaaataacagactgtattcagttattttgccctttattgaggaaccagatttgttttctttttgtttgtaatctcattttgaaataatcagcaagttgaggtactttcttcaaatgctttgtacaatataaactgttatgcctttcagtgcattactatgggaggagcaactaaaaaataaagacttacaaaaaggagtattttt
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:2122 -> Molecular function: GO:0003677 [DNA binding] evidence: ISS GeneID:2122 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IDA GeneID:2122 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS GeneID:2122 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:2122 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IDA GeneID:2122 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA GeneID:2122 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA GeneID:2122 -> Biological process: GO:0001780 [neutrophil homeostasis] evidence: IEA GeneID:2122 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:2122 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: TAS GeneID:2122 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:2122 -> Biological process: GO:0006954 [inflammatory response] evidence: IEA GeneID:2122 -> Biological process: GO:0009605 [response to external stimulus] evidence: IEA GeneID:2122 -> Biological process: GO:0009617 [response to bacterium] evidence: IEA GeneID:2122 -> Biological process: GO:0009791 [post-embryonic development] evidence: IEA GeneID:2122 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA GeneID:2122 -> Biological process: GO:0030512 [negative regulation of transforming growth factor beta receptor signaling pathway] evidence: IDA GeneID:2122 -> Biological process: GO:0030900 [forebrain development] evidence: IEA GeneID:2122 -> Biological process: GO:0035115 [embryonic forelimb morphogenesis] evidence: IEA GeneID:2122 -> Biological process: GO:0035116 [embryonic hindlimb morphogenesis] evidence: IEA GeneID:2122 -> Biological process: GO:0042127 [regulation of cell proliferation] evidence: IEA GeneID:2122 -> Biological process: GO:0043069 [negative regulation of programmed cell death] evidence: IMP GeneID:2122 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IDA GeneID:2122 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IDA GeneID:2122 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA GeneID:2122 -> Biological process: GO:0046329 [negative regulation of JNK cascade] evidence: IMP GeneID:2122 -> Biological process: GO:0051726 [regulation of cell cycle] evidence: IDA GeneID:2122 -> Biological process: GO:0060039 [pericardium development] evidence: IEA GeneID:2122 -> Biological process: GO:0071425 [hematopoietic stem cell proliferation] evidence: ISS GeneID:2122 -> Biological process: GO:0072001 [renal system development] evidence: IEA GeneID:2122 -> Cellular component: GO:0000118 [histone deacetylase complex] evidence: IDA GeneID:2122 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:2122 -> Cellular component: GO:0016607 [nuclear speck] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.