Home |
Help |
Advanced search
2024-04-19 10:09:17, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001102608 8475 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens collagen, type VI, alpha 6 (COL6A6), mRNA.
ACCESSION NM_001102608 XM_067585 XM_940071
VERSION NM_001102608.1 GI:156616289
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 8475)
AUTHORS Sabatelli,P., Gualandi,F., Gara,S.K., Grumati,P., Zamparelli,A.,
Martoni,E., Pellegrini,C., Merlini,L., Ferlini,A., Bonaldo,P.,
Maraldi,N.M., Paulsson,M., Squarzoni,S. and Wagener,R.
TITLE Expression of collagen VI alpha5 and alpha6 chains in human muscle
and in Duchenne muscular dystrophy-related muscle fibrosis
JOURNAL Matrix Biol. 31 (3), 187-196 (2012)
PUBMED 22226732
REMARK GeneRIF: The collagen VI alpha6 chain, but not the alpha5 chain, is
up-regulated in dystrophic muscles.
REFERENCE 2 (bases 1 to 8475)
AUTHORS Groulx,J.F., Gagne,D., Benoit,Y.D., Martel,D., Basora,N. and
Beaulieu,J.F.
TITLE Collagen VI is a basement membrane component that regulates
epithelial cell-fibronectin interactions
JOURNAL Matrix Biol. 30 (3), 195-206 (2011)
PUBMED 21406227
REMARK GeneRIF: collagen VI alpha 6 is an important basal lamina component
involved in the regulation of epithelial cell behavior most notably
as a regulator of epithelial cell-fibronectin interactions
REFERENCE 3 (bases 1 to 8475)
AUTHORS Sabatelli,P., Gara,S.K., Grumati,P., Urciuolo,A., Gualandi,F.,
Curci,R., Squarzoni,S., Zamparelli,A., Martoni,E., Merlini,L.,
Paulsson,M., Bonaldo,P. and Wagener,R.
TITLE Expression of the collagen VI alpha5 and alpha6 chains in normal
human skin and in skin of patients with collagen VI-related
myopathies
JOURNAL J. Invest. Dermatol. 131 (1), 99-107 (2011)
PUBMED 20882040
REMARK GeneRIF: localization of alpha5, and to a lesser extent alpha6, is
restricted to the papillary dermis, where the protein mainly
colocalizes with collagen fibrils; both chains were found around
blood vessels
REFERENCE 4 (bases 1 to 8475)
AUTHORS Fitzgerald,J., Rich,C., Zhou,F.H. and Hansen,U.
TITLE Three novel collagen VI chains, alpha4(VI), alpha5(VI), and
alpha6(VI)
JOURNAL J. Biol. Chem. 283 (29), 20170-20180 (2008)
PUBMED 18400749
REMARK GeneRIF: The discovery of three additional collagen VI chains
doubles the collagen VI family and adds a layer of complexity to
collagen VI assembly and function in the extracellular matrix.
REFERENCE 5 (bases 1 to 8475)
AUTHORS Gara,S.K., Grumati,P., Urciuolo,A., Bonaldo,P., Kobbe,B., Koch,M.,
Paulsson,M. and Wagener,R.
TITLE Three novel collagen VI chains with high homology to the alpha3
chain
JOURNAL J. Biol. Chem. 283 (16), 10658-10670 (2008)
PUBMED 18276594
REFERENCE 6 (bases 1 to 8475)
AUTHORS Muzny,D.M., Scherer,S.E., Kaul,R., Wang,J., Yu,J., Sudbrak,R.,
Buhay,C.J., Chen,R., Cree,A., Ding,Y., Dugan-Rocha,S., Gill,R.,
Gunaratne,P., Harris,R.A., Hawes,A.C., Hernandez,J., Hodgson,A.V.,
Hume,J., Jackson,A., Khan,Z.M., Kovar-Smith,C., Lewis,L.R.,
Lozado,R.J., Metzker,M.L., Milosavljevic,A., Miner,G.R.,
Morgan,M.B., Nazareth,L.V., Scott,G., Sodergren,E., Song,X.Z.,
Steffen,D., Wei,S., Wheeler,D.A., Wright,M.W., Worley,K.C.,
Yuan,Y., Zhang,Z., Adams,C.Q., Ansari-Lari,M.A., Ayele,M.,
Brown,M.J., Chen,G., Chen,Z., Clendenning,J.,
Clerc-Blankenburg,K.P., Chen,R., Chen,Z., Davis,C., Delgado,O.,
Dinh,H.H., Dong,W., Draper,H., Ernst,S., Fu,G.,
Gonzalez-Garay,M.L., Garcia,D.K., Gillett,W., Gu,J., Hao,B.,
Haugen,E., Havlak,P., He,X., Hennig,S., Hu,S., Huang,W.,
Jackson,L.R., Jacob,L.S., Kelly,S.H., Kube,M., Levy,R., Li,Z.,
Liu,B., Liu,J., Liu,W., Lu,J., Maheshwari,M., Nguyen,B.V.,
Okwuonu,G.O., Palmeiri,A., Pasternak,S., Perez,L.M., Phelps,K.A.,
Plopper,F.J., Qiang,B., Raymond,C., Rodriguez,R.,
Saenphimmachak,C., Santibanez,J., Shen,H., Shen,Y., Subramanian,S.,
Tabor,P.E., Verduzco,D., Waldron,L., Wang,J., Wang,J., Wang,Q.,
Williams,G.A., Wong,G.K., Yao,Z., Zhang,J., Zhang,X., Zhao,G.,
Zhou,J., Zhou,Y., Nelson,D., Lehrach,H., Reinhardt,R., Naylor,S.L.,
Yang,H., Olson,M., Weinstock,G. and Gibbs,R.A.
TITLE The DNA sequence, annotation and analysis of human chromosome 3
JOURNAL Nature 440 (7088), 1194-1198 (2006)
PUBMED 16641997
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from AM774225.1,
AM774226.1, AC093006.4, AM774227.1 and AL713792.1.
On or before Aug 31, 2007 this sequence version replaced
gi:113414666, gi:113415243.
##Evidence-Data-START##
RNAseq introns :: mixed/partial sample support ERS025081, ERS025083
[ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-2555 AM774225.1 1-2555
2556-3823 AM774226.1 256-1523
3824-3824 AC093006.4 132588-132588
3825-4197 AM774226.1 1525-1897
4198-7556 AM774227.1 197-3555
7557-8475 AL713792.1 3191-4109
FEATURES Location/Qualifiers
source 1..8475
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3q22.1"
gene 1..8475
/gene="COL6A6"
/note="collagen, type VI, alpha 6"
/db_xref="GeneID:131873"
/db_xref="HGNC:27023"
exon 1..95
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
CDS 32..6823
/gene="COL6A6"
/note="Collagen alpha-6(VI) chain"
/codon_start=1
/product="collagen alpha-6(VI) chain precursor"
/protein_id="NP_001096078.1"
/db_xref="GI:156616290"
/db_xref="CCDS:CCDS46911.1"
/db_xref="GeneID:131873"
/db_xref="HGNC:27023"
/translation="
MMLLILFLVIICSHISVNQDSGPEYADVVFLVDSSDRLGSKSFPFVKMFITKMISSLPIEADKYRVALAQYSDKLHSEFHLSTFKGRSPMLNHLRKNFGFIGGSLQIGKALQEAHRTYFSAPANGRDKKQFPPILVVLASSESEDNVEEASKALRKDGVKIISVGVQKASEENLKAMATSQFHFNLRTVRDLSMFSQNMTHIIKDVIKYKEGAVDDIFVEACQGPSMADVVFLLDMSINGSEENFDYLKGFLEESVSALDIKENCMRVGLVAYSNETKVINSLSMGINKSEVLQHIQNLSPRTGKAYTGAAIKKLRKEVFSARNGSRKNQGVPQIAVLVTHRDSEDNVTKAAVNLRREGVTIFTLGIEGASDTQLEKIASHPAEQYVSKLKTFADLAAHNQTFLKKLRNQITHTVSVFSERTETLKSGCVDTEEADIYLLIDGSGSTQATDFHEMKTFLSEVVGMFNIAPHKVRVGAVQYADSWDLEFEINKYSNKQDLGKAIENIRQMGGNTNTGAALNFTLSLLQKAKKQRGNKVPCHLVVLTNGMSKDSILEPANRLREEHIRVYAIGIKEANQTQLREIAGEEKRVYYVHDFDALKDIRNQVVQEICTEEACKEMKADIMFLVDSSGSIGPENFSKMKTFMKNLVSKSQIGPDRVQIGVVQFSDINKEEFQLNRFMSQSDISNAIDQMAHIGQTTLTGSALSFVSQYFSPTKGARPNIRKFLILITDGEAQDIVKEPAVVLRQEGVIIYSVGVFGSNVTQLEEISGRPEMVFYVENFDILQRIEDDLVFGICSPREECKRIEVLDVVFVIDSSGSIDYDEYNIMKDFMIGLVKKADVGKNQVRFGALKYADDPEVLFYLDDFGTKLEVISVLQNDQAMGGSTYTAEALGFSDHMFTEARGSRLNKGVPQVLIVITDGESHDADKLNATAKALRDKGILVLAVGIDGANPVELLAMAGSSDKYFFVETFGGLKGIFSDVTASVCNSSKVDCEIDKVDLVFLMDGSTSIQPNDFKKMKEFLASVVQDFDVSLNRVRIGAAQFSDTYHPEFPLGTFIGEKEISFQIENIKQIFGNTHIGAALREVEHYFRPDMGSRINTGTPQVLLVLTDGQSQDEVAQAAEALRHRGIDIYSVGIGDVDDQQLIQITGTAEKKLTVHNFDELKKVNKRIVRNICTTAGESNCFVDVVVGFDVSTQEKGQTLLEGQPWMETYLQDILRAISSLNGVSCEVGTETQVSVAFQVTNAMEKYSPKFEIYSENILNSLKDITVKGPSLLNANLLDSLWDTFQNKSAARGKVVLLFSDGLDDDVEKLEQKSDELRKEGLNALITVALDGPADSSDLADLPYIEFGKGFEYRTQLSIGMRELGSRLSKQLVNVAERTCCCLFCKCIGGDGTMGDPGPPGKRGPPGFKGSEGYLGEEGIAGERGAPGPVGEQGTKGCYGTKGPKGNRGLNGQEGEVGENGIDGLNGEQGDNGLPGRKGEKGDEGSQGSPGKRGTPGDRGAKGLRGDPGAPGVDSSIEGPTGLKGERGRQGRRGWPGPPGTPGSRRKTAAHGRRGHTGPQGTAGIPGPDGLEGSLGLKGPQGPRGEAGVKGEKGGVGSKGPQGPPGPGGEAGNQGRLGSQGNKGEPGDLGEKGAVGFPGPRGLQGNDGSPGYGSVGRKGAKGQEGFPGESGPKGEIGDPGGPGETGLKGARGKMISAGLPGEMGSPGEPGPPGRKGVKGAKGLASFSTCELIQYVRDRSPGRHGKPECPVHPTELVFALDHSRDVTEQEFERMKEMMAFLVRDIKVRENSCPVGAHIAILSYNSHARHLVRFSDAYKKSQLLREIETIPYERSSASREIGRAMRFISRNVFKRTLPGAHTRKIATFFSSGQSADAHSITTAAMEFGALEIIPVVITFSNVPSVRRAFAIDDTGTFQVIVVPSGADYIPALERLQRCTFCYDVCKPDASCDQARPPPVQSYMDAAFLLDASRNMGSAEFEDIRAFLGALLDHFEITPEPETSVTGDRVALLSHAPPDFLPNTQKSPVRAEFNLTTYRSKRLMKRHVHESVKQLNGDAFIGHALQWTLDNVFLSTPNLRRNKVIFVISAGETSHLDGEILKKESLRAKCQGYALFVFSLGPIWDDKELEDLASHPLDHHLVQLGRIHKPDHSYGVKFVKSFINSIRRAINKYPPINLKIKCNRLNSIDPKQPPRPFRSFVPGPLKATLKEDVLQKAKFFQDKKYLSRVARSGRDDAIQNFMRSTSHTFKNGRMIESAPKQHD
"
sig_peptide 32..88
/gene="COL6A6"
/inference="non-experimental evidence, no additional
details recorded"
/note="Potential; propagated from UniProtKB/Swiss-Prot
(A6NMZ7.2)"
mat_peptide 89..6820
/gene="COL6A6"
/product="Collagen alpha-6(VI) chain"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (A6NMZ7.2)"
misc_feature 89..4204
/gene="COL6A6"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (A6NMZ7.2);
Region: Nonhelical region"
misc_feature 107..607
/gene="COL6A6"
/note="von Willebrand factor (vWF) type A domain;
equivalent to the I-domain of integrins. This domain has
a variety of functions including: intermolecular adhesion,
cell migration, signalling, transcription, and DNA repair.
In integrins these domains form...; Region: vWA_collagen;
cd01472"
/db_xref="CDD:29245"
misc_feature order(128..130,134..136,140..142,344..346,449..451)
/gene="COL6A6"
/note="metal ion-dependent adhesion site (MIDAS); other
site"
/db_xref="CDD:29245"
misc_feature order(134..142,146..148,344..346)
/gene="COL6A6"
/note="integrin-collagen binding site; other site"
/db_xref="CDD:29245"
misc_feature order(224..226,269..274,305..310,317..322)
/gene="COL6A6"
/note="putative vWF-collagen binding site; other site"
/db_xref="CDD:29245"
misc_feature 713..1210
/gene="COL6A6"
/note="von Willebrand factor (vWF) type A domain;
equivalent to the I-domain of integrins. This domain has
a variety of functions including: intermolecular adhesion,
cell migration, signalling, transcription, and DNA repair.
In integrins these domains form...; Region: vWA_collagen;
cd01472"
/db_xref="CDD:29245"
misc_feature order(734..736,740..742,746..748,947..949,1052..1054)
/gene="COL6A6"
/note="metal ion-dependent adhesion site (MIDAS); other
site"
/db_xref="CDD:29245"
misc_feature order(740..748,752..754,947..949)
/gene="COL6A6"
/note="integrin-collagen binding site; other site"
/db_xref="CDD:29245"
misc_feature order(830..832,875..880,911..916,920..925)
/gene="COL6A6"
/note="putative vWF-collagen binding site; other site"
/db_xref="CDD:29245"
misc_feature 1334..>1828
/gene="COL6A6"
/note="Uncharacterized protein containing a von Willebrand
factor type A (vWA) domain [General function prediction
only]; Region: COG2304"
/db_xref="CDD:32459"
misc_feature 1334..1819
/gene="COL6A6"
/note="von Willebrand factor (vWF) type A domain;
equivalent to the I-domain of integrins. This domain has
a variety of functions including: intermolecular adhesion,
cell migration, signalling, transcription, and DNA repair.
In integrins these domains form...; Region: vWA_collagen;
cd01472"
/db_xref="CDD:29245"
misc_feature order(1355..1357,1361..1363,1367..1369,1568..1570,
1667..1669)
/gene="COL6A6"
/note="metal ion-dependent adhesion site (MIDAS); other
site"
/db_xref="CDD:29245"
misc_feature order(1361..1369,1373..1375,1568..1570)
/gene="COL6A6"
/note="integrin-collagen binding site; other site"
/db_xref="CDD:29245"
misc_feature order(1451..1453,1496..1501,1532..1537,1541..1546)
/gene="COL6A6"
/note="putative vWF-collagen binding site; other site"
/db_xref="CDD:29245"
misc_feature 1892..2383
/gene="COL6A6"
/note="von Willebrand factor (vWF) type A domain;
equivalent to the I-domain of integrins. This domain has
a variety of functions including: intermolecular adhesion,
cell migration, signalling, transcription, and DNA repair.
In integrins these domains form...; Region: vWA_collagen;
cd01472"
/db_xref="CDD:29245"
misc_feature order(1913..1915,1919..1921,1925..1927,2126..2128,
2222..2224)
/gene="COL6A6"
/note="metal ion-dependent adhesion site (MIDAS); other
site"
/db_xref="CDD:29245"
misc_feature order(1919..1927,1931..1933,2126..2128)
/gene="COL6A6"
/note="integrin-collagen binding site; other site"
/db_xref="CDD:29245"
misc_feature order(2009..2011,2054..2059,2090..2095,2099..2104)
/gene="COL6A6"
/note="putative vWF-collagen binding site; other site"
/db_xref="CDD:29245"
misc_feature 2453..2938
/gene="COL6A6"
/note="Von Willebrand factor type A (vWA) domain was
originally found in the blood coagulation protein von
Willebrand factor (vWF). Typically, the vWA domain is made
up of approximately 200 amino acid residues folded into a
classic a/b para-rossmann type of...; Region:
vWFA_subfamily_ECM; cd01450"
/db_xref="CDD:29223"
misc_feature order(2453..2455,2459..2461,2522..2524,2771..2773,
2777..2779,2861..2863,2936..2938)
/gene="COL6A6"
/note="integrin inhibitor binding pocket; other site"
/db_xref="CDD:29223"
misc_feature order(2474..2476,2480..2482,2486..2488,2687..2689,
2789..2791)
/gene="COL6A6"
/note="metal ion-dependent adhesion site (MIDAS); other
site"
/db_xref="CDD:29223"
misc_feature order(2480..2488,2492..2494,2687..2689)
/gene="COL6A6"
/note="integrin-collagen binding site; other site"
/db_xref="CDD:29223"
misc_feature order(2570..2572,2615..2620,2651..2656)
/gene="COL6A6"
/note="putative vWF-collagen binding site; other site"
/db_xref="CDD:29223"
misc_feature order(2597..2602,2606..2608,2699..2701,2708..2710,
2717..2722)
/gene="COL6A6"
/note="glycoprotein Ib (GpIb) binding site [polypeptide
binding]; other site"
/db_xref="CDD:29223"
misc_feature 3026..3523
/gene="COL6A6"
/note="von Willebrand factor (vWF) type A domain;
equivalent to the I-domain of integrins. This domain has
a variety of functions including: intermolecular adhesion,
cell migration, signalling, transcription, and DNA repair.
In integrins these domains form...; Region: vWA_collagen;
cd01472"
/db_xref="CDD:29245"
misc_feature order(3047..3049,3053..3055,3059..3061,3260..3262,
3362..3364)
/gene="COL6A6"
/note="metal ion-dependent adhesion site (MIDAS); other
site"
/db_xref="CDD:29245"
misc_feature order(3053..3061,3065..3067,3260..3262)
/gene="COL6A6"
/note="integrin-collagen binding site; other site"
/db_xref="CDD:29245"
misc_feature order(3143..3145,3188..3193,3224..3229,3233..3238)
/gene="COL6A6"
/note="putative vWF-collagen binding site; other site"
/db_xref="CDD:29245"
misc_feature 3647..4066
/gene="COL6A6"
/note="Von Willebrand factor type A (vWA) domain was
originally found in the blood coagulation protein von
Willebrand factor (vWF). Typically, the vWA domain is made
up of approximately 200 amino acid residues folded into a
classic a/b para-rossmann type of...; Region: vWFA;
cl00057"
/db_xref="CDD:206808"
misc_feature order(3857..3859,3941..3943)
/gene="COL6A6"
/note="metal ion-dependent adhesion site (MIDAS); other
site"
/db_xref="CDD:29222"
misc_feature 4205..5206
/gene="COL6A6"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (A6NMZ7.2);
Region: Triple-helical region"
misc_feature 4286..4465
/gene="COL6A6"
/note="Collagen triple helix repeat (20 copies); Region:
Collagen; pfam01391"
/db_xref="CDD:189968"
misc_feature 4403..4576
/gene="COL6A6"
/note="Collagen triple helix repeat (20 copies); Region:
Collagen; pfam01391"
/db_xref="CDD:189968"
misc_feature 4538..>4792
/gene="COL6A6"
/note="Collagen triple helix repeat (20 copies); Region:
Collagen; pfam01391"
/db_xref="CDD:189968"
misc_feature 4553..4561
/gene="COL6A6"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (A6NMZ7.2);
Region: Cell attachment site (Potential)"
misc_feature 4721..4993
/gene="COL6A6"
/note="Collagen triple helix repeat (20 copies); Region:
Collagen; pfam01391"
/db_xref="CDD:189968"
misc_feature 4937..5113
/gene="COL6A6"
/note="Collagen triple helix repeat (20 copies); Region:
Collagen; pfam01391"
/db_xref="CDD:189968"
misc_feature 5207..6820
/gene="COL6A6"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (A6NMZ7.2);
Region: Nonhelical region"
misc_feature 5297..5740
/gene="COL6A6"
/note="Von Willebrand factor type A (vWA) domain was
originally found in the blood coagulation protein von
Willebrand factor (vWF). Typically, the vWA domain is made
up of approximately 200 amino acid residues folded into a
classic a/b para-rossmann type of...; Region:
vWFA_subfamily_ECM; cd01450"
/db_xref="CDD:29223"
misc_feature order(5297..5299,5303..5305,5366..5368,5627..5629,
5633..5635,5717..5719)
/gene="COL6A6"
/note="integrin inhibitor binding pocket; other site"
/db_xref="CDD:29223"
misc_feature order(5318..5320,5324..5326,5330..5332,5546..5548,
5645..5647)
/gene="COL6A6"
/note="metal ion-dependent adhesion site (MIDAS); other
site"
/db_xref="CDD:29223"
misc_feature order(5324..5332,5336..5338,5546..5548)
/gene="COL6A6"
/note="integrin-collagen binding site; other site"
/db_xref="CDD:29223"
misc_feature order(5426..5428,5471..5476,5507..5512)
/gene="COL6A6"
/note="putative vWF-collagen binding site; other site"
/db_xref="CDD:29223"
misc_feature order(5453..5458,5462..5464,5561..5563,5570..5572,
5582..5587)
/gene="COL6A6"
/note="glycoprotein Ib (GpIb) binding site [polypeptide
binding]; other site"
/db_xref="CDD:29223"
misc_feature 5921..6457
/gene="COL6A6"
/note="Von Willebrand factor type A (vWA) domain was
originally found in the blood coagulation protein von
Willebrand factor (vWF). Typically, the vWA domain is made
up of approximately 200 amino acid residues folded into a
classic a/b para-rossmann type of...; Region:
vWFA_subfamily_ECM; cd01450"
/db_xref="CDD:29223"
misc_feature order(5921..5923,5927..5929,5990..5992,6281..6283,
6287..6289,6377..6379,6455..6457)
/gene="COL6A6"
/note="integrin inhibitor binding pocket; other site"
/db_xref="CDD:29223"
misc_feature order(5942..5944,5948..5950,5954..5956,6206..6208,
6299..6301)
/gene="COL6A6"
/note="metal ion-dependent adhesion site (MIDAS); other
site"
/db_xref="CDD:29223"
misc_feature order(5948..5956,5960..5962,6206..6208)
/gene="COL6A6"
/note="integrin-collagen binding site; other site"
/db_xref="CDD:29223"
misc_feature order(6056..6058,6131..6136,6167..6172)
/gene="COL6A6"
/note="putative vWF-collagen binding site; other site"
/db_xref="CDD:29223"
misc_feature order(6113..6118,6122..6124,6218..6220,6227..6229,
6239..6244)
/gene="COL6A6"
/note="glycoprotein Ib (GpIb) binding site [polypeptide
binding]; other site"
/db_xref="CDD:29223"
variation 52
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:201535806"
variation 55
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:370873490"
variation 60
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376511556"
variation 72
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:369546804"
variation 94
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:76315272"
exon 96..692
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 117
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376080453"
variation 140
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201898554"
variation 189
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:188822314"
variation 197
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:191760470"
variation 224
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200502168"
variation 274
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:141403454"
variation 294
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369788872"
variation 296
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:201577074"
variation 350
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:370744388"
variation 374
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:374596678"
variation 390
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:376462458"
variation 398
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:371005676"
variation 412
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:200045160"
variation 466
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:367572161"
variation 482
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201056076"
variation 494
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:375255284"
variation 495
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:113780724"
variation 499
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:199855682"
variation 515
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:377003663"
variation 528
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:78862326"
variation 536
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:372156592"
variation 541
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:368978984"
variation 567
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:114511272"
variation 568
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200880668"
variation 590
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200264014"
variation 591
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:185319822"
variation 635
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:376108254"
variation 651
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:371520731"
variation 652
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373400548"
variation 672
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:377089245"
variation 685
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:141494444"
variation 687
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:190071598"
variation 688
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:375368589"
exon 693..1313
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 710
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200513386"
variation 715
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:74824913"
variation 716
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:150958194"
variation 725
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:374680410"
variation 728
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:369236266"
variation 762
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372706527"
variation 764
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:202020243"
variation 769
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:375253608"
variation 771
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:187765736"
variation 802
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376805905"
variation 816..817
/gene="COL6A6"
/replace=""
/replace="g"
/db_xref="dbSNP:35896732"
variation 837
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:368625242"
variation 840
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:374002251"
variation 865
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:376920399"
variation 874
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:371407472"
variation 918
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:139500727"
variation 935
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:377324179"
variation 998
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201280240"
variation 999
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:190980449"
variation 1011
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:182466724"
variation 1020
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:375249726"
variation 1024
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:368683744"
variation 1039
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200753152"
variation 1046
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:370740268"
variation 1055
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:375636488"
variation 1056
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:368728937"
variation 1064
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:4613427"
variation 1072
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:372078727"
variation 1073
/gene="COL6A6"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:75757226"
variation 1106
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:202178957"
variation 1107
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:199516958"
variation 1139
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:9830253"
variation 1144
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:186747246"
variation 1145
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:375204239"
variation 1210
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:202062422"
variation 1211
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372038797"
variation 1254
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:199714543"
variation 1294
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369911831"
variation 1302
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200576820"
exon 1314..1874
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 1354
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:373909064"
variation 1356
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:376463408"
variation 1384
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:370634287"
variation 1400
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:374279156"
variation 1413
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:11921769"
variation 1430
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:199669411"
variation 1432
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:371128941"
variation 1451
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201682544"
variation 1454
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:114818609"
variation 1460
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:367786873"
variation 1504
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:371268873"
variation 1510
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:374174918"
variation 1561..1562
/gene="COL6A6"
/replace=""
/replace="g"
/db_xref="dbSNP:36113896"
variation 1577
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:189434004"
variation 1579
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:368134547"
variation 1580
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:371953457"
variation 1596
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:375571886"
variation 1602
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200975034"
variation 1648
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:112472535"
variation 1651
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:143108657"
variation 1667
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:181863743"
variation 1672
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:368961411"
variation 1697
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:59021909"
variation 1702
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:376855447"
variation 1710
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:369313731"
variation 1727
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200391208"
variation 1728
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:368418680"
variation 1741
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373317743"
variation 1742
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:376839638"
variation 1764
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:370679693"
variation 1807
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:148120219"
variation 1808
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:140980196"
variation 1835
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:145020873"
exon 1875..2432
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 1898
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:201858664"
variation 1964
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:201624963"
variation 1971
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200001966"
variation 1996
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:181292608"
variation 2032
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:142295956"
variation 2058
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:368590638"
variation 2062
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:200424705"
variation 2080
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:61730501"
variation 2081
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:199872103"
variation 2117
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:202197374"
variation 2121
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:201412929"
variation 2123
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:200864731"
variation 2154
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:200073173"
variation 2176
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:186411715"
variation 2182
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:72992282"
variation 2183
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373191962"
variation 2221
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:370031148"
variation 2258
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200242417"
variation 2268
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:371129727"
variation 2277
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373883247"
variation 2332
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:376333031"
variation 2347
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:61730502"
variation 2363
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:201380592"
variation 2379
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:374095055"
variation 2423
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201087058"
variation 2427
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:373377669"
variation 2429
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:368046381"
exon 2433..3008
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 2443
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:149727307"
variation 2458
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:59562634"
variation 2485
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:202242825"
variation 2492
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:79427998"
variation 2496
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:371842831"
variation 2503
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:201487305"
variation 2574
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:369240244"
variation 2634
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:372719031"
variation 2652
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200368776"
variation 2659
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:375258523"
variation 2661
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:200252403"
variation 2679
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373503888"
variation 2736
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:377477478"
variation 2747
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200963433"
variation 2762
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:371003490"
variation 2764
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201367338"
variation 2774
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373357114"
variation 2778
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:61730505"
variation 2784
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:370780139"
variation 2820
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:375254172"
variation 2826
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:377667400"
variation 2827
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:371104933"
variation 2828
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:374179121"
variation 2840
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:111457392"
variation 2841
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372152442"
variation 2872
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200728313"
variation 2873
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:78155084"
variation 2878
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373758970"
variation 2879
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372104402"
variation 2891
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:184500867"
variation 2894
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:201493927"
variation 2903
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:145053761"
exon 3009..3578
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 3080
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:199660739"
variation 3144
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372502446"
variation 3150
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:375474560"
variation 3157
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:370614847"
variation 3167
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:370108251"
variation 3169
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:374419905"
variation 3180
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:368734825"
variation 3188
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200655125"
variation 3191
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:200083214"
variation 3204
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:184293546"
variation 3207
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:189967525"
variation 3210
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:147135198"
variation 3255
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:149093613"
variation 3268
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:375175502"
variation 3274
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:376651026"
variation 3307
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:374018129"
variation 3311
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:374532794"
variation 3376
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200954449"
variation 3379
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:371274885"
variation 3382
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:368029464"
variation 3397
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373642231"
variation 3417
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200904266"
variation 3432
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:371571902"
variation 3433
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376519670"
variation 3434
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369579926"
variation 3441
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200274210"
variation 3475
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:377209857"
variation 3479
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:148700491"
variation 3480
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:373338931"
variation 3481
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:181277569"
variation 3514
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:369477543"
variation 3525
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372843729"
variation 3536
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:377413102"
variation 3545
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:199892156"
variation 3553
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:112608083"
exon 3579..3922
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 3586
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:372436892"
variation 3587
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:201919126"
variation 3629
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:368538229"
variation 3636
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:199933702"
variation 3644
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:111455079"
variation 3686
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:372595353"
variation 3687
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:141159632"
variation 3726
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:368991418"
variation 3736
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:373427912"
variation 3744
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:375219376"
variation 3796
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:369127867"
variation 3824
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:6439249"
variation 3839
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:376118495"
variation 3861
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369160167"
variation 3888
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:182994973"
variation 3890
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200030810"
variation 3914
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200960657"
exon 3923..4001
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
exon 4002..4156
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4010
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:138732186"
variation 4015
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:187018971"
variation 4046
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:141266374"
variation 4057
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:368040530"
variation 4061
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:375780218"
variation 4062
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369249026"
variation 4067
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:191454120"
variation 4139
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:371511195"
variation 4145
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:78118817"
exon 4157..4249
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4161
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:181841656"
variation 4174
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369458948"
variation 4175
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:374015009"
variation 4180
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:376992084"
variation 4197
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:370001663"
variation 4207
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:201668795"
variation 4222
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200740383"
exon 4250..4303
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4284
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:370754137"
variation 4300
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:375056319"
variation 4301
/gene="COL6A6"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:201907492"
exon 4304..4375
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4305
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369345663"
variation 4317
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:73868925"
variation 4331
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:140872639"
exon 4376..4402
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
exon 4403..4447
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4429
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:115656707"
exon 4448..4501
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4449
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:368065855"
variation 4469
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:140413590"
variation 4473
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:371964580"
exon 4502..4564
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4527
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:368456402"
variation 4546
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:202216308"
variation 4547
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:201285773"
variation 4553
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:369804734"
variation 4564
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200323352"
exon 4565..4630
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4579
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:138764111"
variation 4613
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:373020656"
variation 4619
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:377422894"
variation 4628
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:149354340"
exon 4631..4684
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4632
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369136687"
variation 4633
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373136353"
variation 4641
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:368227266"
variation 4644
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:376123767"
variation 4651
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:112135798"
variation 4657
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373427238"
variation 4658
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:376262924"
exon 4685..4720
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4711
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:368262440"
exon 4721..4783
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
exon 4784..4846
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4799
/gene="COL6A6"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:71333673"
variation 4800
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200858352"
variation 4839
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369254879"
exon 4847..4909
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4848
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369462562"
variation 4850
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:200246665"
variation 4862
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369809525"
variation 4871
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:201892096"
variation 4886
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200578758"
variation 4887
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:370794032"
variation 4889
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:148526586"
variation 4900
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200101291"
exon 4910..4972
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4962
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:139324337"
variation 4969
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:74893697"
exon 4973..5023
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 4995
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:141836516"
variation 5005
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:371710564"
variation 5006
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:117951912"
variation 5009
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201937452"
exon 5024..5059
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 5048
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:181242587"
exon 5060..5122
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 5067
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:199664718"
variation 5110
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:185385775"
exon 5123..5185
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 5131
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:182797175"
variation 5154
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:61629992"
variation 5172
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:367724495"
variation 5180
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376592854"
exon 5186..5221
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 5190
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373233541"
exon 5222..5258
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 5245
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:181707887"
variation 5246
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:370896099"
variation 5247
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:16830494"
variation 5252
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:367687833"
variation 5253
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:370927133"
exon 5259..5270
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
exon 5271..5764
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 5294
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:199999908"
variation 5297
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:376141510"
variation 5299
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:371118138"
variation 5327
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201942949"
variation 5336
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373361883"
variation 5427
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:7614116"
variation 5431
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:370172197"
variation 5440
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:374137008"
variation 5451
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376509040"
variation 5452
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:201478325"
variation 5453
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:370537932"
variation 5456
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:143290812"
variation 5482
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:151263569"
variation 5487
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372978340"
variation 5528
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:199922994"
variation 5556
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:377296907"
variation 5573
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200406299"
variation 5622
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:371413939"
variation 5630
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:140524388"
variation 5659
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:7636656"
variation 5675
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:201022773"
variation 5695
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:145622340"
variation 5708
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:187321461"
variation 5720
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369519269"
variation 5742
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373556758"
variation 5753
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376975822"
exon 5765..5861
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 5770
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:112353036"
variation 5782
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:199877578"
variation 5793
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201430021"
variation 5805
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200922054"
variation 5806
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200683208"
variation 5809
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372666117"
variation 5818
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:375712957"
variation 5822
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373783054"
variation 5840
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:367633692"
variation 5841
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:371764510"
exon 5862..6533
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 5910
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201787847"
variation 5941
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:200262875"
variation 5950
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200097884"
variation 5951
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:371924042"
variation 5981
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:76623493"
variation 6002
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:370009976"
variation 6014
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373854074"
variation 6034
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:376336362"
variation 6047
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200450058"
variation 6048
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:373046640"
variation 6056
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:374436074"
variation 6091
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201325545"
variation 6095
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373185359"
variation 6099
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:182190352"
variation 6105
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:371177795"
variation 6108
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:201802012"
variation 6111
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:199779143"
variation 6122
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:188388728"
variation 6126
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:192669670"
variation 6143
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:370170338"
variation 6147
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373589286"
variation 6151
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:150062981"
variation 6154
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:371978860"
variation 6155
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:375639767"
variation 6156
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:368469507"
variation 6216
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372431409"
variation 6220
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:377256652"
variation 6226
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:147734388"
variation 6228
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:369766314"
variation 6268
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373347732"
variation 6284
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:376433481"
variation 6312
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:183838224"
variation 6323
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:369335538"
variation 6329
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373290006"
variation 6351
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:114298837"
variation 6371
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:201546062"
variation 6400
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373027231"
variation 6419
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200429976"
variation 6438
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:370939904"
variation 6479
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:373765411"
variation 6485
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201076895"
variation 6493
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200270964"
variation 6497
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:374719989"
variation 6511
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:55934146"
variation 6513
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:367938359"
variation 6523
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:188181514"
variation 6533
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:193270756"
exon 6534..6627
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 6548
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376652036"
variation 6611
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:199781639"
variation 6613
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:369816064"
variation 6620
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:372976180"
variation 6624
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:202169366"
exon 6628..8470
/gene="COL6A6"
/inference="alignment:Splign:1.39.8"
variation 6628
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:72996300"
variation 6664
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:373687031"
variation 6692
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376137272"
variation 6719
/gene="COL6A6"
/replace="g"
/replace="t"
/db_xref="dbSNP:57569308"
variation 6792
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:368146199"
variation 6822
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:201567655"
variation 6834
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:185935634"
variation 7011
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:140244355"
variation 7012
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:143973268"
variation 7019
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:151016988"
variation 7131
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:140873108"
variation 7137
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:150151192"
variation 7264
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:190394698"
variation 7268
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:17748727"
variation 7310
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:17748751"
variation 7426
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:183572400"
variation 7429
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:11710068"
variation 7538
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:188904449"
variation 7563
/gene="COL6A6"
/replace="a"
/replace="c"
/db_xref="dbSNP:73200204"
variation 7798
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:375521775"
variation 7900
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:3732503"
variation 7908
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:182743731"
variation 7967
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:186609729"
variation 8016
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:372067217"
variation 8073
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:111606327"
variation 8090
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:114543135"
variation 8199
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:191811209"
variation 8227
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:372141833"
variation 8229
/gene="COL6A6"
/replace="c"
/replace="g"
/db_xref="dbSNP:375592023"
variation 8294
/gene="COL6A6"
/replace="a"
/replace="t"
/db_xref="dbSNP:182545347"
variation 8317
/gene="COL6A6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200090123"
variation 8331
/gene="COL6A6"
/replace="a"
/replace="g"
/db_xref="dbSNP:8969"
ORIGIN
atttgaagttgaagatttttcaggtcataatatgatgttgctaattttgttcctcgtgataatttgttcccatatttctgtgaaccaagattccggccctgagtatgcagatgttgtgtttttggtggacagctctgatcgcctgggatccaagtccttcccatttgtgaaaatgttcatcaccaaaatgatcagcagtctccccatagaggccgacaaataccgtgtggccctggcccagtacagtgataaacttcacagtgaattccacctgagcaccttcaaaggcaggagccccatgctgaaccacctaaggaagaactttggattcattggcgggtccctgcagataggaaaggctcttcaggaggctcacaggacttatttctctgcacccgcaaatgggagagacaagaaacagtttcccccaattctagtggtcctggcttcatctgagtctgaggataatgtggaagaggcatcaaaggccctgcggaaagacggagtgaaaatcatctctgtaggggtgcagaaagcttctgaggaaaacctgaaggccatggccacgtctcagtttcatttcaaccttcggacagtcagagacctcagcatgttttcccaaaacatgacacacatcatcaaggatgtaataaagtacaaggagggagcagttgatgacatctttgtagaagcttgccaaggcccttctatggccgatgttgtgttcctattggatatgtcaatcaatggaagtgaggagaactttgactatcttaaaggattcttggaagaaagtgtatctgcccttgacataaaggaaaattgcatgagggttggccttgtggcctatagcaatgagacaaaagtgataaattcactgagcatgggcataaataagtcagaggttctccagcatatacagaacctttctccccgaactgggaaggcctatactggagctgccatcaaaaagctcaggaaggaagtttttagtgcacggaatggcagtcggaagaatcagggggtgccccagattgccgtgctggtgacccaccgagattcagaagacaacgtgacaaaagcagctgttaacctccgacgggagggtgtgaccatcttcaccctgggcatagagggcgccagcgacacccagttggaaaagatagcatcccaccctgctgagcagtatgtctccaaactgaagaccttcgctgacctggctgctcacaaccagacatttctgaagaagctgcggaaccaaataacacacacagtctctgtcttttcagagaggactgaaacgctcaaatctggttgtgtggacactgaggaagcagacatctatctgcttatcgatggctcagggagcacccaggccacagatttccatgaaatgaagacgttcctgtcagaggtggtagggatgttcaacattgctccccataaggtgcgggttggggccgttcagtatgctgacagctgggacttggaatttgagatcaataaatactccaacaagcaggatttgggaaaggccattgagaatatcaggcagatgggtgggaatacaaacacaggcgcagcactgaatttcacactgagtctgttgcaaaaagcaaagaagcagcgaggaaacaaagttccatgccaccttgttgtcctgacaaatggcatgtccaaggatagcatcttggagcctgcaaacagactgagagaagagcacatccgagtttatgctatcgggatcaaggaggccaaccaaacacagctgagagaaattgcaggagaggaaaagagagtgtattacgtgcatgactttgatgcattgaaagacataagaaaccaagttgttcaagaaatctgtactgaagaagcttgcaaagagatgaaagctgacatcatgtttctggtggacagttctggaagtataggacctgaaaacttcagcaaaatgaaaacatttatgaaaaacctggtgagcaagtctcagattggaccagatcgggtgcaaattggtgtagtccagttcagcgacatcaataaggaagagtttcagctcaacagattcatgtcccaaagcgacatttcaaatgcaatagaccaaatggctcacattggacaaaccaccctgactggtagtgccctgagctttgtgtctcagtacttcagccccaccaagggcgcccggcccaacatcagaaagtttctcatcctcatcacggatggtgaagctcaggacatagtaaaggaaccagcagtagtgcttcggcaagaaggtgtaatcatctattctgtgggagtgtttggctccaatgtcacccagcttgaggagatcagtgggaggcccgagatggttttttatgttgagaattttgacattctgcagcgcattgaagatgatcttgtttttggaatatgcagcccccgtgaagaatgcaagcggattgaagttttagacgttgtgtttgtcattgatagctctggcagtattgactatgatgagtataatatcatgaaggattttatgattggcttagtgaaaaaagctgatgtgggcaagaatcaggtccggtttggggctctgaagtatgctgatgacccagaggtgctgttttatctggatgactttggcacaaaactggaggtaatttcagtgctccagaatgaccaagccatgggtggcagtacttatactgctgaggcactgggcttctcagaccacatgttcactgaagcccggggcagccgcctgaacaagggggtcccccaagtcctcattgtgatcaccgatggggaatcccatgatgctgataaactcaatgccacggcaaaggccttgcgggacaaaggcattcttgtcctggctgtggggattgatggtgccaatcccgtggagctgttagccatggcaggatcaagcgacaagtacttcttcgtggagacttttggaggtctgaagggaatattttcagatgtgacagccagtgtctgcaactcttcaaaagtagattgtgaaattgacaaagtagatcttgttttccttatggatggttcaactagcattcagccaaatgacttcaagaaaatgaaggaatttctggcatctgttgttcaagactttgatgtcagcctcaacagagtgcgaataggagcggcccagtttagcgatacctatcacccggagtttccactgggaactttcataggtgaaaaagagatatcatttcagattgaaaacatcaagcagatctttggaaacacacacatcggtgctgcactcagggaggtggaacattacttcaggccagacatgggcagcaggataaatacaggtaccccacaggtgctgctggtccttacagatggccagtcccaagacgaggtggcccaggccgcggaagccctgagacacagaggtatcgacatctactccgtgggcattggggatgtggatgaccagcagctcattcagatcaccgggactgcagagaaaaaactgacagtgcacaacttcgatgaactgaagaaggtcaataaaaggatcgttcgcaacatctgtaccacagcgggtgaaagcaactgtttcgtggatgttgtggtgggatttgatgtctcaactcaggagaaagggcagactttgcttgaaggtcagccttggatggaaacctaccttcaagacatcttacgtgccatcagctccctcaatggagtaagctgtgaggtgggcacagagactcaggtcagtgtggcttttcaagtgaccaatgccatggaaaaatattctcccaagtttgagatctacagtgaaaacatactgaatagcttgaaggatataacagttaaaggaccatctcttctcaatgcaaacctcttggattctctatgggatacatttcagaataaatcagctgctcgaggaaaggtggtccttttattttcagatggattggatgatgatgttgagaaacttgaacaaaaatctgatgaacttagaaaagaaggcctgaatgccctcataactgttgctctggatggacctgctgattcaagtgacttggctgatcttccctatattgaatttgggaaaggatttgagtacaggacacagctctctattggcatgagagaacttggaagccggctgtcaaagcagctggtcaatgttgctgaaaggacatgctgctgtttgttctgcaagtgcattggaggagatggcacaatgggagatcctggaccaccagggaaaaggggacctccaggttttaaaggcagtgaaggctacctgggagaggagggaatcgctggagaaagaggagcccctggaccagtgggagagcaaggtactaagggatgctatggcaccaaaggtcctaagggaaacagaggactaaatggacaggagggagaagttggggaaaatggaattgacggattaaacggagaacagggtgataatggtcttcctggaagaaaaggagaaaagggagatgagggatctcagggaagcccagggaagagagggactcctggtgaccgtggagcaaagggcctgcgaggggatcccggagctcctggagttgacagtagcatagaaggacccacaggcttgaaaggagaacgtggaagacaaggcagaagaggctggccaggcccccccgggacaccaggctccagaagaaagacagcagctcatggcagaaggggacatacaggcccacagggaacagcaggcatcccaggaccagatggacttgaaggctccctgggacttaagggccctcagggcccaagaggagaggctggtgtgaaaggagaaaaaggaggtgtgggaagtaaaggtccccaggggcctccaggacccggaggagaggcagggaatcaaggccgtttgggaagccaaggaaataaaggagaacctggagatctgggagaaaaaggagctgttggctttcctggtcctcgtggcttgcagggcaatgatggcagtccaggttatggtagtgtcggacgcaagggagcaaagggacaagaaggattccctggagaaagtggacctaagggtgagattggggaccctggtggtccaggagagactgggctgaagggagctagaggcaaaatgatatctgctgggcttccaggagagatgggatcccctggggaaccaggacctcctggacgtaagggtgtgaaaggagccaaaggcttggcttcattttctacatgtgagctcattcagtatgtgcgagaccgcagtcctggcaggcatggaaaaccggaatgcccagtgcacccaaccgagttggtgtttgccctggaccactcccgggatgtcactgagcaggaatttgagcggatgaaggagatgatggctttcctggtgagagacattaaggtccgggagaacagctgccccgtgggagcgcacatcgccatcctctcctataactcccacgccaggcaccttgtgcgcttctcagacgcctacaagaagagtcaacttctcagagaaattgaaactattccttatgagagatcctctgccagcagggagattggcagagcaatgcggtttatttccaggaatgtcttcaagcggacgcttccgggggcacacacgagaaaaatcgccacatttttcagcagcggtcagtccgcggatgcccactccatcaccacggctgccatggagttcggcgcgcttgaaatcattcccgtggtgatcactttcagcaacgtgccctcggtcaggcgcgcatttgcgattgacgacactggcacatttcaagtaatagtggttccctccggggccgactacataccagcattagagagactccagcggtgcactttctgctatgatgtgtgcaagccagatgcttcttgtgaccaagccagaccaccccctgtgcagtcttacatggatgctgctttccttctggatgcctcccggaacatgggaagtgctgaatttgaagacataagagccttccttggagcactattagatcactttgaaatcaccccagagccggagacttctgtcactggagaccgggtggccctattgagccatgctccccccgacttcctacccaacactcagaagagtccagttagagctgagttcaatcttaccacctacagaagtaagcgcctcatgaagaggcatgtgcacgagtcagttaaacaactaaatggagatgcttttattggtcatgccttacagtggactctggacaatgtatttttaagtacacccaatctgagaagaaacaaagtcatatttgtgatatctgctggggaaaccagccacttagatggggaaatcttaaagaaggaatccttgcgagccaaatgtcagggatatgccttatttgtgttttcccttggccctatttgggatgacaaggaactggaggatctcgccagccaccctttggatcaccacctggtccagcttggccgaattcataaacctgaccacagttatggtgtgaagtttgtgaagtcctttataaactcaatcaggcgtgcaatcaacaaatatccaccaataaacttaaaaataaagtgcaacagacttaactctatagatccaaagcagcccccacgaccattccgaagctttgttcctggaccacttaaagctaccctcaaagaagatgtattacagaaggcaaaattctttcaagataaaaaatatctttcaagagtagcaagaagtggcagagatgatgctattcaaaattttatgagaagcacctcccatacctttaagaatggaaggatgatagaaagtgctcccaaacaacatgattaaaaaaatgcttgaacaacttagccttaggaagcatggtaagactctggacttaaatagtaactaaatctgctgccagaactcaagcaacagtttgtaggttatcaggtgacttgaccccctgcattcattggtattaagatatatcttgttcatttatttgaccactcctgacaattccagcactctacgactgatatgtcgaagaactgtttcattagaagacagaagaatgaaagaagtgttttgaaaagtctaatggagatataatttgaaggtaaaatttatatgatgtatgcatatgtgtacatgggtcaatgttaattcttttatctctgtccagttcattttctgcaaacccatcctcctttcctaatttagtaatgtctaatgctcatctatttagtcaaagttattttttaatgttttaagctactccaaaatttatcctagaaatggatgctgtttatatgtcgtatttttttaaaacgtgaccttctattccacttaaacacaccactgtgggagttgtttgcttggactgatgagaagagggtaattttctccatctctaaatcctcctgaactcactgaaaaactcattaattcccgcagaacataaattattgcttttgagctggaagttttctcttcattaggaagcttactgccattttgatggagcttgaagcccccattttgatggacttctagtctgtctttcctgttatggtcatttattaattttcactaatccatatattctttagacaaggagagtcaagaaactacttgtcatagatgaagctctgagttacttttacccatcaggtagctgtttagtcaataataaacagcaccaaaacaggattagcagagctcttaaaaacagccttaaatacacactgagtttagaaaaatgtaagaaaatcattgttttaatctacaaattcatatgcagttgcagagatgcaaaagagatcagagtaagttaaagtaggaaaggttttataaaagtattgatggctgtgtcctcatctgcatttttgtttttatgatagggctgatattttcaacaacgaaacacccaatgttcagaccttacctcagtctaagagctggctccacagttggtagcaatggccctgttaggcagactgtccccctctttgggaatggaaagaagccctgcctggatgcatggagcagatggatactgacaccaaggacattcagattttctttcctatacctattttcataaaatttggaaagaaaaactatctgcagtatttttttaaaacgacttctgctattcttacttagagaaatccagtgatagcacctcatgtcttcagaggagcaagaagttcaaggagttaaatgtcacattcatactcaggtaatagagaagaataaaacacatcaggtttgcttcatctatcctaagtggtgcttaggggttcagaaaaaatgtttcaagtacaggaaattaatgagcaatatttacaatgtattttaataaaagggatttttctagttaactctgagttaagcacgaactcctttcttttgttaattgttggaaataccattaagatgtatttgtctgtttttctgcattggcaagtaaagaacataaaacaaataaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:131873 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA
GeneID:131873 -> Biological process: GO:0022617 [extracellular matrix disassembly] evidence: TAS
GeneID:131873 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
GeneID:131873 -> Biological process: GO:0030574 [collagen catabolic process] evidence: TAS
GeneID:131873 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
GeneID:131873 -> Cellular component: GO:0005581 [collagen] evidence: IEA
GeneID:131873 -> Cellular component: GO:0031012 [extracellular matrix] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.