2024-03-29 17:57:54, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001099405 8450 bp mRNA linear PRI 15-JUL-2013 DEFINITION Homo sapiens sodium channel, voltage-gated, type V, alpha subunit (SCN5A), transcript variant 4, mRNA. ACCESSION NM_001099405 XM_941768 VERSION NM_001099405.1 GI:150417968 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 8450) AUTHORS Crotti,L., Tester,D.J., White,W.M., Bartos,D.C., Insolia,R., Besana,A., Kunic,J.D., Will,M.L., Velasco,E.J., Bair,J.J., Ghidoni,A., Cetin,I., Van Dyke,D.L., Wick,M.J., Brost,B., Delisle,B.P., Facchinetti,F., George,A.L., Schwartz,P.J. and Ackerman,M.J. TITLE Long QT syndrome-associated mutations in intrauterine fetal death JOURNAL JAMA 309 (14), 1473-1482 (2013) PUBMED 23571586 REMARK GeneRIF: 5 intrauterine fetal deaths hosted SCN5A rare nonsynonymous genetic variants that conferred in vitro electrophysiological characteristics consistent with potentially proarrhythmic phenotypes. REFERENCE 2 (bases 1 to 8450) AUTHORS Ritchie MD, Denny JC, Zuvich RL, Crawford DC, Schildcrout JS, Bastarache L, Ramirez AH, Mosley JD, Pulley JM, Basford MA, Bradford Y, Rasmussen LV, Pathak J, Chute CG, Kullo IJ, McCarty CA, Chisholm RL, Kho AN, Carlson CS, Larson EB, Jarvik GP, Sotoodehnia N, Manolio TA, Li R, Masys DR, Haines JL and Roden DM. CONSRTM Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) QRS Group TITLE Genome- and phenome-wide analyses of cardiac conduction identifies markers of arrhythmia risk JOURNAL Circulation 127 (13), 1377-1385 (2013) PUBMED 23463857 REFERENCE 3 (bases 1 to 8450) AUTHORS Hu,R.M., Tan,B.H., Orland,K.M., Valdivia,C.R., Peterson,A., Pu,J. and Makielski,J.C. TITLE Digenic inheritance novel mutations in SCN5a and SNTA1 increase late I(Na) contributing to LQT syndrome JOURNAL Am. J. Physiol. Heart Circ. Physiol. 304 (7), H994-H1001 (2013) PUBMED 23376825 REMARK GeneRIF: Novel mutations in SCN5A and SNTA1 jointly increase the INa current late/peak ratio and time constants of current decay. REFERENCE 4 (bases 1 to 8450) AUTHORS Calloe,K., Refaat,M.M., Grubb,S., Wojciak,J., Campagna,J., Thomsen,N.M., Nussbaum,R.L., Scheinman,M.M. and Schmitt,N. TITLE Characterization and mechanisms of action of novel NaV1.5 channel mutations associated with Brugada syndrome JOURNAL Circ Arrhythm Electrophysiol 6 (1), 177-184 (2013) PUBMED 23424222 REMARK GeneRIF: Na(V)1.5-S1218I and R811H are novel loss-of-function mutations in the SCN5A gene causing Brugada syndrome. REFERENCE 5 (bases 1 to 8450) AUTHORS Vanoye,C.G., Kunic,J.D., Ehring,G.R. and George,A.L. Jr. TITLE Mechanism of sodium channel NaV1.9 potentiation by G-protein signaling JOURNAL J. Gen. Physiol. 141 (2), 193-202 (2013) PUBMED 23359282 REMARK GeneRIF: Our results advance our understanding about the mechanism of Na(V)1.9 potentiation by G-protein signaling during inflammation. REFERENCE 6 (bases 1 to 8450) AUTHORS Olson,T.M. and Keating,M.T. TITLE Mapping a cardiomyopathy locus to chromosome 3p22-p25 JOURNAL J. Clin. Invest. 97 (2), 528-532 (1996) PUBMED 8567977 REFERENCE 7 (bases 1 to 8450) AUTHORS Wang,Q., Shen,J., Li,Z., Timothy,K., Vincent,G.M., Priori,S.G., Schwartz,P.J. and Keating,M.T. TITLE Cardiac sodium channel mutations in patients with long QT syndrome, an inherited cardiac arrhythmia JOURNAL Hum. Mol. Genet. 4 (9), 1603-1607 (1995) PUBMED 8541846 REFERENCE 8 (bases 1 to 8450) AUTHORS George,A.L. Jr., Varkony,T.A., Drabkin,H.A., Han,J., Knops,J.F., Finley,W.H., Brown,G.B., Ward,D.C. and Haas,M. TITLE Assignment of the human heart tetrodotoxin-resistant voltage-gated Na+ channel alpha-subunit gene (SCN5A) to band 3p21 JOURNAL Cytogenet. Cell Genet. 68 (1-2), 67-70 (1995) PUBMED 7956363 REFERENCE 9 (bases 1 to 8450) AUTHORS Jiang,C., Atkinson,D., Towbin,J.A., Splawski,I., Lehmann,M.H., Li,H., Timothy,K., Taggart,R.T., Schwartz,P.J., Vincent,G.M. et al. TITLE Two long QT syndrome loci map to chromosomes 3 and 7 with evidence for further heterogeneity JOURNAL Nat. Genet. 8 (2), 141-147 (1994) PUBMED 7842012 REFERENCE 10 (bases 1 to 8450) AUTHORS Gellens,M.E., George,A.L. Jr., Chen,L.Q., Chahine,M., Horn,R., Barchi,R.L. and Kallen,R.G. TITLE Primary structure and functional expression of the human cardiac tetrodotoxin-insensitive voltage-dependent sodium channel JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (2), 554-558 (1992) PUBMED 1309946 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BU845010.1, AB158469.2, AY038064.1, AF482988.1, EF629347.1 and AB208866.1. On Jul 5, 2007 this sequence version replaced gi:113430951. Summary: The protein encoded by this gene is an integral membrane protein and tetrodotoxin-resistant voltage-gated sodium channel subunit. This protein is found primarily in cardiac muscle and is responsible for the initial upstroke of the action potential in an electrocardiogram. Defects in this gene are a cause of long QT syndrome type 3 (LQT3), an autosomal dominant cardiac disease. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (4), also known as hB2, uses an alternate, duplicated coding exon, and is missing another in-frame, downstream coding exon compared to transcript variant 1, resulting in a shorter isoform (d) missing an internal segment and differing in a few aa, compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: EF629347.1 [ECO:0000331] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-152 BU845010.1 1-152 153-765 AB158469.2 1-613 766-805 AY038064.1 630-669 806-2110 AB158469.2 654-1958 2111-3247 AY038064.1 1975-3111 3248-3422 AF482988.1 3063-3237 3423-4218 EF629347.1 3271-4066 4219-4986 AB208866.1 2760-3527 4987-6777 AY038064.1 4902-6692 6778-8336 AB208866.1 5319-6877 8337-8450 AB208866.1 6903-7016 FEATURES Location/Qualifiers source 1..8450 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="3" /map="3p21" gene 1..8450 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="sodium channel, voltage-gated, type V, alpha subunit" /db_xref="GeneID:6331" /db_xref="HGNC:10593" /db_xref="MIM:600163" exon 1..142 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 1, numbering commonly used in literature and the LOVD database." variation 130 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45608739" exon 143..467 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" CDS 195..6191 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="isoform d is encoded by transcript variant 4; cardiac tetrodotoxin-insensitive voltage-dependent sodium channel alpha subunit; sodium channel protein type 5 subunit alpha; voltage-gated sodium channel subunit alpha Nav1.5; sodium channel protein cardiac muscle subunit alpha" /codon_start=1 /product="sodium channel protein type 5 subunit alpha isoform d" /protein_id="NP_001092875.1" /db_xref="GI:150417969" /db_xref="CCDS:CCDS46798.1" /db_xref="GeneID:6331" /db_xref="HGNC:10593" /db_xref="MIM:600163" /translation="
MANFLLPRGTSSFRRFTRESLAAIEKRMAEKQARGSTTLQESREGLPEEEAPRPQLDLQASKKLPDLYGNPPQELIGEPLEDLDPFYSTQKTFIVLNKGKTIFRFSATNALYVLSPFHPIRRAAVKILVHSLFNMLIMCTILTNCVFMAQHDPPPWTKYVEYTFTAIYTFESLVKILARGFCLHAFTFLRDPWNWLDFSVIIMAYVSENIKLGNLSALRTFRVLRALKTISVIPGLKTIVGALIQSVKKLADVMVLTVFCLSVFALIGLQLFMGNLRHKCVRNFTALNGTNGSVEADGLVWESLDLYLSDPENYLLKNGTSDVLLCGNSSDAGTCPEGYRCLKAGENPDHGYTSFDSFAWAFLALFRLMTQDCWERLYQQTLRSAGKIYMIFFMLVIFLGSFYLVNLILAVVAMAYEEQNQATIAETEEKEKRFQEAMEMLKKEHEALTIRGVDTVSRSSLEMSPLAPVNSHERRSKRRKRMSSGTEECGEDRLPKSDSEDGPRAMNHLSLTRGLSRTSMKPRSSRGSIFTFRRRDLGSEADFADDENSTAGESESHHTSLLVPWPLRRTSAQGQPSPGTSAPGHALHGKKNSTVDCNGVVSLLGAGDPEATSPGSHLLRPVMLEHPPDTTTPSEEPGGPQMLTSQAPCVDGFEEPGARQRALSAVSVLTSALEELEESRHKCPPCWNRLAQRYLIWECCPLWMSIKQGVKLVVMDPFTDLTITMCIVLNTLFMALEHYNMTSEFEEMLQVGNLVFTGIFTAEMTFKIIALDPYYYFQQGWNIFDSIIVILSLMELGLSRMSNLSVLRSFRLLRVFKLAKSWPTLNTLIKIIGNSVGALGNLTLVLAIIVFIFAVVGMQLFGKNYSELRDSDSGLLPRWHMMDFFHAFLIIFRILCGEWIETMWDCMEVSGQSLCLLVFLLVMVIGNLVVLNLFLALLLSSFSADNLTAPDEDREMNNLQLALARIQRGLRFVKRTTWDFCCGLLRQRPQKPAALAAQGQLPSCIATPYSPPPPETEKVPPTRKETRFEEGEQPGQGTPGDPEPVCVPIAVAESDTDDQEEDEENSLGTEEESSKQQESQPVSGGPEAPPDSRTWSQVSATASSEAEASASQADWRQQWKAEPQAPGCGETPEDSCSEGSTADMTNTAELLEQIPDLGQDVKDPEDCFTEGCVRRCPCCAVDTTQAPGKVWWRLRKTCYHIVEHSWFETFIIFMILLSSGALAFEDIYLEERKTIKVLLEYADKMFTYVFVLEMLLKWVAYGFKKYFTNAWCWLDFLIVDVSLVSLVANTLGFAEMGPIKSLRTLRALRPLRALSRFEGMRVVVNALVGAIPSIMNVLLVCLIFWLIFSIMGVNLFAGKFGRCINQTEGDLPLNYTIVNNKSQCESLNLTGELYWTKVKVNFDNVGAGYLALLQVYEEQPQWEYNLYMYIYFVIFIIFGSFFTLNLFIGVIIDNFNQQKKKLGGQDIFMTEEQKKYYNAMKKLGSKKPQKPIPRPLNKYQGFIFDIVTKQAFDVTIMFLICLNMVTMMVETDDQSPEKINILAKINLLFVAIFTGECIVKLAALRHYYFTNSWNIFDFVVVILSIVGTVLSDIIQKYFFSPTLFRVIRLARIGRILRLIRGAKGIRTLLFALMMSLPALFNIGLLLFLVMFIYSIFGMANFAYVKWEAGIDDMFNFQTFANSMLCLFQITTSAGWDGLLSPILNTGPPYCDPTLPNSNGSRGDCGSPAVGILFFTTYIIISFLIVVNMYIAIILENFSVATEESTEPLSEDDFDMFYEIWEKFDPEATQFIEYSVLSDFADALSEPLRIAKPNQISLINMDLPMVSGDRIHCMDILFAFTKRVLGESGEMDALKIQMEEKFMAANPSKISYEPITTTLRRKHEEVSAMVIQRAFRRHLLQRSLKHASFLFRQQAGSGLSEEDAPEREGLIAYVMSENFSRPLGPPSSSSISSTSFPPSYDSVTRATSDNLQVRGSDYSHSEDLADFPPSPDRDRESIV
" misc_feature 573..644 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 669..>1067 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Ion transport protein; Region: Ion_trans; pfam00520" /db_xref="CDD:201279" misc_feature 669..728 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 843..902 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 951..1022 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature <1200..1430 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Ion transport protein; Region: Ion_trans; pfam00520" /db_xref="CDD:201279" misc_feature 1362..1439 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 1575..2198 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Domain of unknown function (DUF3451); Region: DUF3451; pfam11933" /db_xref="CDD:204785" misc_feature 1731..1733 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /experiment="experimental evidence, no additional details recorded" /note="Dimethylated arginine, alternate; Omega-N-methylarginine, alternate; propagated from UniProtKB/Swiss-Prot (Q14524.2); methylation site" misc_feature 1770..1772 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /experiment="experimental evidence, no additional details recorded" /note="Dimethylated arginine, alternate; Omega-N-methylarginine, alternate; propagated from UniProtKB/Swiss-Prot (Q14524.2); methylation site" misc_feature 2232..2234 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /experiment="experimental evidence, no additional details recorded" /note="Dimethylated arginine, alternate; Omega-N-methylarginine, alternate; propagated from UniProtKB/Swiss-Prot (Q14524.2); methylation site" misc_feature 2328..2402 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 2436..2507 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 2451..2972 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Ion transport protein; Region: Ion_trans; pfam00520" /db_xref="CDD:201279" misc_feature 2532..2591 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 2610..2669 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 2718..2780 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 2934..3011 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 3051..>3212 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Sodium ion transport-associated; Region: Na_trans_assoc; pfam06512" /db_xref="CDD:203469" misc_feature <3579..3839 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Sodium ion transport-associated; Region: Na_trans_assoc; pfam06512" /db_xref="CDD:203469" misc_feature 3795..3866 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 3906..3983 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 3915..4547 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Ion transport protein; Region: Ion_trans; pfam00520" /db_xref="CDD:201279" misc_feature 4002..4067 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 4080..4145 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 4203..4271 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 4470..4550 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 4710..4781 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 4815..4886 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 4827..5453 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Ion transport protein; Region: Ion_trans; pfam00520" /db_xref="CDD:201279" misc_feature <4833..5474 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /note="Polycystin cation channel; Region: PKD_channel; pfam08016" /db_xref="CDD:203839" misc_feature 4905..4976 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 5007..5072 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 5118..5186 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 5382..5456 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); transmembrane region" misc_feature 6060..6071 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14524.2); Region: Interaction with NEDD4, NEDD4L and WWP2" exon 468..586 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" STS 468..586 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="GDB:624564" /db_xref="UniSTS:158350" variation 548 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45533640" exon 587..676 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" exon 677..805 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" variation 680 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45489099" exon 806..897 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" variation 842 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45475402" exon 898..1128 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 7, numbering commonly used in literature and the LOVD database." variation 938 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45453395" variation 995 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45587735" variation 1034 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:72549413" exon 1129..1192 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 8, numbering commonly used in literature and the LOVD database." exon 1193..1334 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 9, numbering commonly used in literature and the LOVD database." variation 1211 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:17215493" variation 1259 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45570333" exon 1335..1532 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 10, numbering commonly used in literature and the LOVD database." variation 1430 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45565936" exon 1533..1712 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 11, numbering commonly used in literature and the LOVD database." variation 1541 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="c" /db_xref="dbSNP:45477694" exon 1713..2084 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 12, numbering commonly used in literature and the LOVD database." variation 1781 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45624133" variation 1875 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45522138" variation 1896 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45600438" exon 2085..2217 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 13, numbering commonly used in literature and the LOVD database." exon 2218..2456 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 14, numbering commonly used in literature and the LOVD database." variation 2366 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="t" /db_xref="dbSNP:45583237" exon 2457..2630 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 15, numbering commonly used in literature and the LOVD database." exon 2631..2981 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 16, numbering commonly used in literature and the LOVD database." STS 2961..3833 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="Scn5a" /db_xref="UniSTS:516644" exon 2982..3422 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 17, numbering commonly used in literature and the LOVD database." variation 3315 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45491996" variation 3362 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="c" /db_xref="dbSNP:45480800" exon 3423..3584 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 18, numbering commonly used in literature and the LOVD database." exon 3585..3705 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 19, numbering commonly used in literature and the LOVD database." exon 3706..3860 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 20, numbering commonly used in literature and the LOVD database." variation 3758 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="g" /replace="t" /db_xref="dbSNP:17221875" exon 3861..4034 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 21, numbering commonly used in literature and the LOVD database." exon 4035..4157 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 22, numbering commonly used in literature and the LOVD database." exon 4158..4439 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 23, numbering commonly used in literature and the LOVD database." exon 4440..4577 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 25, numbering commonly used in literature and the LOVD database." exon 4578..4682 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 26, numbering commonly used in literature and the LOVD database." exon 4683..4953 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 27, numbering commonly used in literature and the LOVD database." STS 4761..5153 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="Scn3a" /db_xref="UniSTS:516640" exon 4954..8450 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /inference="alignment:Splign:1.39.8" /note="alternate designation 28, numbering commonly used in literature and the LOVD database." variation 4964 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45437099" variation 5388 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="c" /db_xref="dbSNP:45606037" variation 5597 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:1805126" STS 6053..6409 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="GDB:555574" /db_xref="UniSTS:157686" variation 6319 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45601739" STS 6397..6575 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="D3S4190" /db_xref="UniSTS:43452" STS 6442..6739 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="GDB:624573" /db_xref="UniSTS:158352" variation 6573 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45459402" variation 6743 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45615435" variation 6786 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:4073687" variation 6850 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45446194" variation 6868 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45458203" variation 7013 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45600839" variation 7213 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45548632" variation 7395 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45502198" variation 7627 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45589543" variation 7759 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="g" /db_xref="dbSNP:45503498" variation 7800 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="" /replace="c" /db_xref="dbSNP:45589940" variation 7812 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45512996" variation 7815 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45441103" STS 7865..8405 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /standard_name="SCN5A_3457" /db_xref="UniSTS:471751" variation 7934 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45474195" variation 7991 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="t" /db_xref="dbSNP:45615238" variation 8011 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="c" /replace="g" /db_xref="dbSNP:45610536" variation 8075 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45624736" variation 8198 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="g" /db_xref="dbSNP:45593136" variation 8326 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="a" /replace="c" /db_xref="dbSNP:45502793" variation 8336..8337 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" /replace="" /replace="gagaagagagtaggaaaaaggaggg" /db_xref="dbSNP:45592631" polyA_signal 8405..8410 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" polyA_site 8450 /gene="SCN5A" /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1" ORIGIN
agacggcggcggcgcccgtaggatgcagggatcgctcccccggggccgctgagcctgcgcccagtgccccgagccccgcgccgagccgagtccgcgccaagcagcagccgcccaccccggggcccggccgggggaccagcagcttccccacaggcaacgtgaggagagcctgtgcccagaagcaggatgagaagatggcaaacttcctattacctcggggcaccagcagcttccgcaggttcacacgggagtccctggcagccatcgagaagcgcatggcagagaagcaagcccgcggctcaaccaccttgcaggagagccgagaggggctgcccgaggaggaggctccccggccccagctggacctgcaggcctccaaaaagctgccagatctctatggcaatccaccccaagagctcatcggagagcccctggaggacctggaccccttctatagcacccaaaagactttcatcgtactgaataaaggcaagaccatcttccggttcagtgccaccaacgccttgtatgtcctcagtcccttccaccccatccggagagcggctgtgaagattctggttcactcgctcttcaacatgctcatcatgtgcaccatcctcaccaactgcgtgttcatggcccagcacgaccctccaccctggaccaagtatgtcgagtacaccttcaccgccatttacacctttgagtctctggtcaagattctggctcgaggcttctgcctgcacgcgttcactttccttcgggacccatggaactggctggactttagtgtgattatcatggcgtatgtatcagaaaatataaaactaggcaatttgtcggctcttcgaactttcagagtcctgagagctctaaaaactatttcagttatcccagggctgaagaccatcgtgggggccctgatccagtctgtgaagaagctggctgatgtgatggtcctcacagtcttctgcctcagcgtctttgccctcatcggcctgcagctcttcatgggcaacctaaggcacaagtgcgtgcgcaacttcacagcgctcaacggcaccaacggctccgtggaggccgacggcttggtctgggaatccctggacctttacctcagtgatccagaaaattacctgctcaagaacggcacctctgatgtgttactgtgtgggaacagctctgacgctgggacatgtccggagggctaccggtgcctaaaggcaggcgagaaccccgaccacggctacaccagcttcgattcctttgcctgggcctttcttgcactcttccgcctgatgacgcaggactgctgggagcgcctctatcagcagaccctcaggtccgcagggaagatctacatgatcttcttcatgcttgtcatcttcctggggtccttctacctggtgaacctgatcctggccgtggtcgcaatggcctatgaggagcaaaaccaagccaccatcgctgagaccgaggagaaggaaaagcgcttccaggaggccatggaaatgctcaagaaagaacacgaggccctcaccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggccccagtaaacagccatgagagaagaagcaagaggagaaaacggatgtcttcaggaactgaggagtgtggggaggacaggctccccaagtctgactcagaagatggtcccagagcaatgaatcatctcagcctcacccgtggcctcagcaggacttctatgaagccacgttccagccgcgggagcattttcacctttcgcaggcgagacctgggttctgaagcagattttgcagatgatgaaaacagcacagcgggggagagcgagagccaccacacatcactgctggtgccctggcccctgcgccggaccagtgcccagggacagcccagtcccggaacctcggctcctggccacgccctccatggcaaaaagaacagcactgtggactgcaatggggtggtctcattactgggggcaggcgacccagaggccacatccccaggaagccacctcctccgccctgtgatgctagagcacccgccagacacgaccacgccatcggaggagccaggcgggccccagatgctgacctcccaggctccgtgtgtagatggcttcgaggagccaggagcacggcagcgggccctcagcgcagtcagcgtcctcaccagcgcactggaagagttagaggagtctcgccacaagtgtccaccatgctggaaccgtctcgcccagcgctacctgatctgggagtgctgcccgctgtggatgtccatcaagcagggagtgaagttggtggtcatggacccgtttactgacctcaccatcactatgtgcatcgtactcaacacactcttcatggcgctggagcactacaacatgacaagtgaattcgaggagatgctgcaggtcggaaacctggtcttcacagggattttcacagcagagatgaccttcaagatcattgccctcgacccctactactacttccaacagggctggaacatcttcgacagcatcatcgtcatccttagcctcatggagctgggcctgtcccgcatgagcaacttgtcggtgctgcgctccttccgcctgctgcgggtcttcaagctggccaaatcatggcccaccctgaacacactcatcaagatcatcgggaactcagtgggggcactggggaacctgacactggtgctagccatcatcgtgttcatctttgctgtggtgggcatgcagctctttggcaagaactactcggagctgagggacagcgactcaggcctgctgcctcgctggcacatgatggacttctttcatgccttcctcatcatcttccgcatcctctgtggagagtggatcgagaccatgtgggactgcatggaggtgtcggggcagtcattatgcctgctggtcttcttgcttgttatggtcattggcaaccttgtggtcctgaatctcttcctggccttgctgctcagctccttcagtgcagacaacctcacagcccctgatgaggacagagagatgaacaacctccagctggccctggcccgcatccagaggggcctgcgctttgtcaagcggaccacctgggatttctgctgtggtctcctgcggcagcggcctcagaagcccgcagcccttgccgcccagggccagctgcccagctgcattgccaccccctactccccgccacccccagagacggagaaggtgcctcccacccgcaaggaaacacggtttgaggaaggcgagcaaccaggccagggcacccccggggatccagagcccgtgtgtgtgcccatcgctgtggccgagtcagacacagatgaccaagaagaagatgaggagaacagcctgggcacggaggaggagtccagcaagcagcaggaatcccagcctgtgtccggtggcccagaggcccctccggattccaggacctggagccaggtgtcagcgactgcctcctctgaggccgaggccagtgcatctcaggccgactggcggcagcagtggaaagcggaaccccaggccccagggtgcggtgagaccccagaggacagttgctccgagggcagcacagcagacatgaccaacaccgctgagctcctggagcagatccctgacctcggccaggatgtcaaggacccagaggactgcttcactgaaggctgtgtccggcgctgtccctgctgtgcggtggacaccacacaggccccagggaaggtctggtggcggttgcgcaagacctgctaccacatcgtggagcacagctggttcgagacattcatcatcttcatgatcctactcagcagtggagcgctggccttcgaggacatctacctagaggagcggaagaccatcaaggttctgcttgagtatgccgacaagatgttcacatatgtcttcgtgctggagatgctgctcaagtgggtggcctacggcttcaagaagtacttcaccaatgcctggtgctggctcgacttcctcatcgtagacgtctctctggtcagcctggtggccaacaccctgggctttgccgagatgggccccatcaagtcactgcggacgctgcgtgcactccgtcctctgagagctctgtcacgatttgagggcatgagggtggtggtcaatgccctggtgggcgccatcccgtccatcatgaacgtcctcctcgtctgcctcatcttctggctcatcttcagcatcatgggcgtgaacctctttgcggggaagtttgggaggtgcatcaaccagacagagggagacttgcctttgaactacaccatcgtgaacaacaagagccagtgtgagtccttgaacttgaccggagaattgtactggaccaaggtgaaagtcaactttgacaacgtgggggccgggtacctggcccttctgcaggtgtatgaagagcagcctcagtgggaatacaacctctacatgtacatctattttgtcattttcatcatctttgggtctttcttcaccctgaacctctttattggtgtcatcattgacaacttcaaccaacagaagaaaaagttagggggccaggacatcttcatgacagaggagcagaagaagtactacaatgccatgaagaagctgggctccaagaagccccagaagcccatcccacggcccctgaacaagtaccagggcttcatattcgacattgtgaccaagcaggcctttgacgtcaccatcatgtttctgatctgcttgaatatggtgaccatgatggtggagacagatgaccaaagtcctgagaaaatcaacatcttggccaagatcaacctgctctttgtggccatcttcacaggcgagtgtattgtcaagctggctgccctgcgccactactacttcaccaacagctggaatatcttcgacttcgtggttgtcatcctctccatcgtgggcactgtgctctcggacatcatccagaagtacttcttctccccgacgctcttccgagtcatccgcctggcccgaataggccgcatcctcagactgatccgaggggccaaggggatccgcacgctgctctttgccctcatgatgtccctgcctgccctcttcaacatcgggctgctgctcttcctcgtcatgttcatctactccatctttggcatggccaacttcgcttatgtcaagtgggaggctggcatcgacgacatgttcaacttccagaccttcgccaacagcatgctgtgcctcttccagatcaccacgtcggccggctgggatggcctcctcagccccatcctcaacactgggccgccctactgcgaccccactctgcccaacagcaatggctctcggggggactgcgggagcccagccgtgggcatcctcttcttcaccacctacatcatcatctccttcctcatcgtggtcaacatgtacattgccatcatcctggagaacttcagcgtggccacggaggagagcaccgagcccctgagtgaggacgacttcgatatgttctatgagatctgggagaaatttgacccagaggccactcagtttattgagtattcggtcctgtctgactttgccgatgccctgtctgagccactccgtatcgccaagcccaaccagataagcctcatcaacatggacctgcccatggtgagtggggaccgcatccattgcatggacattctctttgccttcaccaaaagggtcctgggggagtctggggagatggacgccctgaagatccagatggaggagaagttcatggcagccaacccatccaagatctcctacgagcccatcaccaccacactccggcgcaagcacgaagaggtgtcggccatggttatccagagagccttccgcaggcacctgctgcaacgctctttgaagcatgcctccttcctcttccgtcagcaggcgggcagcggcctctccgaagaggatgcccctgagcgagagggcctcatcgcctacgtgatgagtgagaacttctcccgaccccttggcccaccctccagctcctccatctcctccacttccttcccaccctcctatgacagtgtcactagagccaccagcgataacctccaggtgcgggggtctgactacagccacagtgaagatctcgccgacttccccccttctccggacagggaccgtgagtccatcgtgtgagcctcggcctggctggccaggacacactgaaaagcagcctttttcaccatggcaaacctaaatgcagtcagtcacaaaccagcctggggccttcctggctttgggagtaagaaatgggcctcagccccgcggatcaaccaggcagagttctgtggcgccgcgtggacagccggagcagttggcctgtgcttggaggcctcagatagacctgtgacctggtctggtcaggcaatgccctgcggctctggaaagcaacttcatcccagctgctgaggcgaaatataaaactgagactgtatatgttgtgaatgggctttcataaatttattatatttgatatttttttacttgagcaaagaactaaggatttttccatggacatgggcagcaattcacgctgtctcttcttaaccctgaacaagagtgtctatggagcagccggaagtctgttctcaaagcagaagtggaatccagtgtggctcccacaggtcttcactgcccaggggtcgaatggggtccccctcccacttgacctgagatgctgggagggctgaacccccactcacacaagcacacacacacagtcctcacacacggaggccagacacaggccgtgggacccaggctcccagcctaagggagacaggcctttccctgccggccccccaaggatggggttcttgtccacggggctcactctggccccctattgtctccaaggtcccattttccccctgtgttttcacgcaggtcatattgtcagtcctacaaaaataaaaggcttccagaggagagtggcctgggtcccagggctggccctaggcactgatagttgccttttcttcccctcctgtaagagtattaacaaaaccaaaggacacaagggtgcaagccccattcacggcctggcatgcagcttgtccttgctcctggaacctggcaggccctgcccagccagccatcggaagagagggctgagccatgggggtttggggctaagaagttcaccagccctgagccatggcggcccctcagcctgcctgaagagaggaaactggcgatctcccagggctctctggaccatacgcggaggagttttctgtgtggtctccagctcctctccagacacagagacatgggagtggggagcggagcttggccctgcgccctgtgcagggaaagggatggtcaggcccagttctcgtgcccttagaggggaatgaaccatggcacctttgagagagggggcactgtggtcaggcccagcctctctggctcagcccgggatcctgatggcacccacacagaggacctctttggggcaagatccaggtggtcccataggtcttgtgaaaaggctttttcagggaaaaatattttactagtccaatcacccccaggacctcttcagctgctgacaatcctatttagcatatgcaaatcttttaacatagagaactgtcaccctgaggtaacagggtcaactggcgaagcctgagcaggcaggggcttggctgccccattccagctctcccatggagcccctccaccgggcgcatgcctcccaggccacctcagtctcacctgccggctctgggctggctgctcctaacctacctcgccgagctgtcggagggctggacatttgtggcagtgctgaagggggcattgccggcgagtaaagtattatgtttcttcttgtcaccccagttcccttggtggcaaccccagacccaacccatgcccctgacagatctagttctcttctcctgtgttccctttgagtccagtgtgggacacggtttaactgtcccagcgacatttctccaagtggaaatcctatttttgtagatctccatgctttgctctcaaggcttggagaggtatgtgcccctcctgggtgctcaccgcctgctacacaggcaggaatgcggttgggaggcaggtcgggctgccagcccagctggccggaaggagactgtggtttttgtgtgtgtggacagcccgggagctttgagacaggtgcctggggctggctgcagacggtgtggttgggggtgggaggtgagctagacccaacccttagcttttagcctggctgtcacctttttaatttccagaactgcacaatgaccagcaggagggaaggacagacatcaagtgccagatgttgtctgaactaatcgagcacttctcaccaaacttcatgtataaataaaatacatatttttaaaacaaaccaataaatggcttacatga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:6331 -> Molecular function: GO:0005248 [voltage-gated sodium channel activity] evidence: IDA GeneID:6331 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:6331 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IPI GeneID:6331 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI GeneID:6331 -> Molecular function: GO:0030506 [ankyrin binding] evidence: IDA GeneID:6331 -> Molecular function: GO:0044325 [ion channel binding] evidence: IPI GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IDA GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IMP GeneID:6331 -> Molecular function: GO:0097110 [scaffold protein binding] evidence: IPI GeneID:6331 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP GeneID:6331 -> Biological process: GO:0003231 [cardiac ventricle development] evidence: ISS GeneID:6331 -> Biological process: GO:0003360 [brainstem development] evidence: ISS GeneID:6331 -> Biological process: GO:0006814 [sodium ion transport] evidence: IDA GeneID:6331 -> Biological process: GO:0010765 [positive regulation of sodium ion transport] evidence: IDA GeneID:6331 -> Biological process: GO:0014894 [response to denervation involved in regulation of muscle adaptation] evidence: ISS GeneID:6331 -> Biological process: GO:0021537 [telencephalon development] evidence: ISS GeneID:6331 -> Biological process: GO:0021549 [cerebellum development] evidence: ISS GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IDA GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IMP GeneID:6331 -> Biological process: GO:0042475 [odontogenesis of dentin-containing tooth] evidence: ISS GeneID:6331 -> Biological process: GO:0045760 [positive regulation of action potential] evidence: ISS GeneID:6331 -> Biological process: GO:0050679 [positive regulation of epithelial cell proliferation] evidence: ISS GeneID:6331 -> Biological process: GO:0051899 [membrane depolarization] evidence: IDA GeneID:6331 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP GeneID:6331 -> Biological process: GO:0060307 [regulation of ventricular cardiac muscle cell membrane repolarization] evidence: IMP GeneID:6331 -> Biological process: GO:0060371 [regulation of atrial cardiac muscle cell membrane depolarization] evidence: IMP GeneID:6331 -> Biological process: GO:0060372 [regulation of atrial cardiac muscle cell membrane repolarization] evidence: IMP GeneID:6331 -> Biological process: GO:0060373 [regulation of ventricular cardiac muscle cell membrane depolarization] evidence: IMP GeneID:6331 -> Biological process: GO:0071277 [cellular response to calcium ion] evidence: IDA GeneID:6331 -> Biological process: GO:0086002 [regulation of cardiac muscle cell action potential involved in contraction] evidence: IMP GeneID:6331 -> Biological process: GO:0086004 [regulation of cardiac muscle cell contraction] evidence: IMP GeneID:6331 -> Biological process: GO:0086005 [regulation of ventricular cardiac muscle cell action potential] evidence: IMP GeneID:6331 -> Biological process: GO:0086010 [membrane depolarization involved in regulation of action potential] evidence: IDA GeneID:6331 -> Biological process: GO:0086012 [membrane depolarization involved in regulation of cardiac muscle cell action potential] evidence: IMP GeneID:6331 -> Biological process: GO:0086046 [membrane depolarization involved in regulation of SA node cell action potential] evidence: ISS GeneID:6331 -> Biological process: GO:0086067 [AV node cell to bundle of His cell communication] evidence: IMP GeneID:6331 -> Biological process: GO:0086069 [bundle of His cell to Purkinje myocyte communication] evidence: IMP GeneID:6331 -> Biological process: GO:0086070 [SA node cell to atrial cardiac muscle cell communication] evidence: IMP GeneID:6331 -> Biological process: GO:0086091 [regulation of heart rate by cardiac conduction] evidence: IMP GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IC GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IDA GeneID:6331 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IDA GeneID:6331 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA GeneID:6331 -> Cellular component: GO:0005901 [caveola] evidence: TAS GeneID:6331 -> Cellular component: GO:0009986 [cell surface] evidence: IDA GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: IDA GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: ISS GeneID:6331 -> Cellular component: GO:0016021 [integral to membrane] evidence: IDA GeneID:6331 -> Cellular component: GO:0030315 [T-tubule] evidence: IDA GeneID:6331 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.