Home |
Help |
Advanced search
2024-04-20 00:10:33, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001099404 8504 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens sodium channel, voltage-gated, type V, alpha subunit
(SCN5A), transcript variant 3, mRNA.
ACCESSION NM_001099404
VERSION NM_001099404.1 GI:150417966
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 8504)
AUTHORS Crotti,L., Tester,D.J., White,W.M., Bartos,D.C., Insolia,R.,
Besana,A., Kunic,J.D., Will,M.L., Velasco,E.J., Bair,J.J.,
Ghidoni,A., Cetin,I., Van Dyke,D.L., Wick,M.J., Brost,B.,
Delisle,B.P., Facchinetti,F., George,A.L., Schwartz,P.J. and
Ackerman,M.J.
TITLE Long QT syndrome-associated mutations in intrauterine fetal death
JOURNAL JAMA 309 (14), 1473-1482 (2013)
PUBMED 23571586
REMARK GeneRIF: 5 intrauterine fetal deaths hosted SCN5A rare
nonsynonymous genetic variants that conferred in vitro
electrophysiological characteristics consistent with potentially
proarrhythmic phenotypes.
REFERENCE 2 (bases 1 to 8504)
AUTHORS Ritchie MD, Denny JC, Zuvich RL, Crawford DC, Schildcrout JS,
Bastarache L, Ramirez AH, Mosley JD, Pulley JM, Basford MA,
Bradford Y, Rasmussen LV, Pathak J, Chute CG, Kullo IJ, McCarty CA,
Chisholm RL, Kho AN, Carlson CS, Larson EB, Jarvik GP, Sotoodehnia
N, Manolio TA, Li R, Masys DR, Haines JL and Roden DM.
CONSRTM Cohorts for Heart and Aging Research in Genomic Epidemiology
(CHARGE) QRS Group
TITLE Genome- and phenome-wide analyses of cardiac conduction identifies
markers of arrhythmia risk
JOURNAL Circulation 127 (13), 1377-1385 (2013)
PUBMED 23463857
REFERENCE 3 (bases 1 to 8504)
AUTHORS Hu,R.M., Tan,B.H., Orland,K.M., Valdivia,C.R., Peterson,A., Pu,J.
and Makielski,J.C.
TITLE Digenic inheritance novel mutations in SCN5a and SNTA1 increase
late I(Na) contributing to LQT syndrome
JOURNAL Am. J. Physiol. Heart Circ. Physiol. 304 (7), H994-H1001 (2013)
PUBMED 23376825
REMARK GeneRIF: Novel mutations in SCN5A and SNTA1 jointly increase the
INa current late/peak ratio and time constants of current decay.
REFERENCE 4 (bases 1 to 8504)
AUTHORS Calloe,K., Refaat,M.M., Grubb,S., Wojciak,J., Campagna,J.,
Thomsen,N.M., Nussbaum,R.L., Scheinman,M.M. and Schmitt,N.
TITLE Characterization and mechanisms of action of novel NaV1.5 channel
mutations associated with Brugada syndrome
JOURNAL Circ Arrhythm Electrophysiol 6 (1), 177-184 (2013)
PUBMED 23424222
REMARK GeneRIF: Na(V)1.5-S1218I and R811H are novel loss-of-function
mutations in the SCN5A gene causing Brugada syndrome.
REFERENCE 5 (bases 1 to 8504)
AUTHORS Vanoye,C.G., Kunic,J.D., Ehring,G.R. and George,A.L. Jr.
TITLE Mechanism of sodium channel NaV1.9 potentiation by G-protein
signaling
JOURNAL J. Gen. Physiol. 141 (2), 193-202 (2013)
PUBMED 23359282
REMARK GeneRIF: Our results advance our understanding about the mechanism
of Na(V)1.9 potentiation by G-protein signaling during
inflammation.
REFERENCE 6 (bases 1 to 8504)
AUTHORS Olson,T.M. and Keating,M.T.
TITLE Mapping a cardiomyopathy locus to chromosome 3p22-p25
JOURNAL J. Clin. Invest. 97 (2), 528-532 (1996)
PUBMED 8567977
REFERENCE 7 (bases 1 to 8504)
AUTHORS Wang,Q., Shen,J., Li,Z., Timothy,K., Vincent,G.M., Priori,S.G.,
Schwartz,P.J. and Keating,M.T.
TITLE Cardiac sodium channel mutations in patients with long QT syndrome,
an inherited cardiac arrhythmia
JOURNAL Hum. Mol. Genet. 4 (9), 1603-1607 (1995)
PUBMED 8541846
REFERENCE 8 (bases 1 to 8504)
AUTHORS George,A.L. Jr., Varkony,T.A., Drabkin,H.A., Han,J., Knops,J.F.,
Finley,W.H., Brown,G.B., Ward,D.C. and Haas,M.
TITLE Assignment of the human heart tetrodotoxin-resistant voltage-gated
Na+ channel alpha-subunit gene (SCN5A) to band 3p21
JOURNAL Cytogenet. Cell Genet. 68 (1-2), 67-70 (1995)
PUBMED 7956363
REFERENCE 9 (bases 1 to 8504)
AUTHORS Jiang,C., Atkinson,D., Towbin,J.A., Splawski,I., Lehmann,M.H.,
Li,H., Timothy,K., Taggart,R.T., Schwartz,P.J., Vincent,G.M. et al.
TITLE Two long QT syndrome loci map to chromosomes 3 and 7 with evidence
for further heterogeneity
JOURNAL Nat. Genet. 8 (2), 141-147 (1994)
PUBMED 7842012
REFERENCE 10 (bases 1 to 8504)
AUTHORS Gellens,M.E., George,A.L. Jr., Chen,L.Q., Chahine,M., Horn,R.,
Barchi,R.L. and Kallen,R.G.
TITLE Primary structure and functional expression of the human cardiac
tetrodotoxin-insensitive voltage-dependent sodium channel
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (2), 554-558 (1992)
PUBMED 1309946
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BU845010.1, AB158469.2,
AY038064.1, AF482988.1, EF629346.1 and AB208866.1.
This sequence is a reference standard in the RefSeqGene project.
Summary: The protein encoded by this gene is an integral membrane
protein and tetrodotoxin-resistant voltage-gated sodium channel
subunit. This protein is found primarily in cardiac muscle and is
responsible for the initial upstroke of the action potential in an
electrocardiogram. Defects in this gene are a cause of long QT
syndrome type 3 (LQT3), an autosomal dominant cardiac disease.
Alternative splicing results in several transcript variants
encoding different isoforms. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (3), also known as hB1, uses an
alternate, duplicated coding exon compared to transcript variant 1,
resulting in an isoform (c) of the same size, but differing in a
few internal aa compared to isoform a.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
CDS exon combination :: AB158469.2, EF629346.1 [ECO:0000331]
RNAseq introns :: mixed/partial sample support ERS025081,
ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-152 BU845010.1 1-152
153-765 AB158469.2 1-613
766-805 AY038064.1 630-669
806-2110 AB158469.2 654-1958
2111-3247 AY038064.1 1975-3111
3248-3422 AF482988.1 3063-3237
3423-4218 EF629346.1 3271-4066
4219-6831 AY038064.1 4080-6692
6832-8390 AB208866.1 5319-6877
8391-8504 AB208866.1 6903-7016
FEATURES Location/Qualifiers
source 1..8504
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3p21"
gene 1..8504
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="sodium channel, voltage-gated, type V, alpha
subunit"
/db_xref="GeneID:6331"
/db_xref="HGNC:10593"
/db_xref="MIM:600163"
exon 1..142
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 1, numbering commonly used in
literature and the LOVD database."
variation 130
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45608739"
exon 143..467
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
CDS 195..6245
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="isoform c is encoded by transcript variant 3;
cardiac tetrodotoxin-insensitive voltage-dependent sodium
channel alpha subunit; sodium channel protein type 5
subunit alpha; voltage-gated sodium channel subunit alpha
Nav1.5; sodium channel protein cardiac muscle subunit
alpha"
/codon_start=1
/product="sodium channel protein type 5 subunit alpha
isoform c"
/protein_id="NP_001092874.1"
/db_xref="GI:150417967"
/db_xref="CCDS:CCDS46799.1"
/db_xref="GeneID:6331"
/db_xref="HGNC:10593"
/db_xref="MIM:600163"
/translation="
MANFLLPRGTSSFRRFTRESLAAIEKRMAEKQARGSTTLQESREGLPEEEAPRPQLDLQASKKLPDLYGNPPQELIGEPLEDLDPFYSTQKTFIVLNKGKTIFRFSATNALYVLSPFHPIRRAAVKILVHSLFNMLIMCTILTNCVFMAQHDPPPWTKYVEYTFTAIYTFESLVKILARGFCLHAFTFLRDPWNWLDFSVIIMAYVSENIKLGNLSALRTFRVLRALKTISVIPGLKTIVGALIQSVKKLADVMVLTVFCLSVFALIGLQLFMGNLRHKCVRNFTALNGTNGSVEADGLVWESLDLYLSDPENYLLKNGTSDVLLCGNSSDAGTCPEGYRCLKAGENPDHGYTSFDSFAWAFLALFRLMTQDCWERLYQQTLRSAGKIYMIFFMLVIFLGSFYLVNLILAVVAMAYEEQNQATIAETEEKEKRFQEAMEMLKKEHEALTIRGVDTVSRSSLEMSPLAPVNSHERRSKRRKRMSSGTEECGEDRLPKSDSEDGPRAMNHLSLTRGLSRTSMKPRSSRGSIFTFRRRDLGSEADFADDENSTAGESESHHTSLLVPWPLRRTSAQGQPSPGTSAPGHALHGKKNSTVDCNGVVSLLGAGDPEATSPGSHLLRPVMLEHPPDTTTPSEEPGGPQMLTSQAPCVDGFEEPGARQRALSAVSVLTSALEELEESRHKCPPCWNRLAQRYLIWECCPLWMSIKQGVKLVVMDPFTDLTITMCIVLNTLFMALEHYNMTSEFEEMLQVGNLVFTGIFTAEMTFKIIALDPYYYFQQGWNIFDSIIVILSLMELGLSRMSNLSVLRSFRLLRVFKLAKSWPTLNTLIKIIGNSVGALGNLTLVLAIIVFIFAVVGMQLFGKNYSELRDSDSGLLPRWHMMDFFHAFLIIFRILCGEWIETMWDCMEVSGQSLCLLVFLLVMVIGNLVVLNLFLALLLSSFSADNLTAPDEDREMNNLQLALARIQRGLRFVKRTTWDFCCGLLRQRPQKPAALAAQGQLPSCIATPYSPPPPETEKVPPTRKETRFEEGEQPGQGTPGDPEPVCVPIAVAESDTDDQEEDEENSLGTEEESSKQQESQPVSGGPEAPPDSRTWSQVSATASSEAEASASQADWRQQWKAEPQAPGCGETPEDSCSEGSTADMTNTAELLEQIPDLGQDVKDPEDCFTEGCVRRCPCCAVDTTQAPGKVWWRLRKTCYHIVEHSWFETFIIFMILLSSGALAFEDIYLEERKTIKVLLEYADKMFTYVFVLEMLLKWVAYGFKKYFTNAWCWLDFLIVDVSLVSLVANTLGFAEMGPIKSLRTLRALRPLRALSRFEGMRVVVNALVGAIPSIMNVLLVCLIFWLIFSIMGVNLFAGKFGRCINQTEGDLPLNYTIVNNKSQCESLNLTGELYWTKVKVNFDNVGAGYLALLQVATFKGWMDIMYAAVDSRGYEEQPQWEYNLYMYIYFVIFIIFGSFFTLNLFIGVIIDNFNQQKKKLGGQDIFMTEEQKKYYNAMKKLGSKKPQKPIPRPLNKYQGFIFDIVTKQAFDVTIMFLICLNMVTMMVETDDQSPEKINILAKINLLFVAIFTGECIVKLAALRHYYFTNSWNIFDFVVVILSIVGTVLSDIIQKYFFSPTLFRVIRLARIGRILRLIRGAKGIRTLLFALMMSLPALFNIGLLLFLVMFIYSIFGMANFAYVKWEAGIDDMFNFQTFANSMLCLFQITTSAGWDGLLSPILNTGPPYCDPTLPNSNGSRGDCGSPAVGILFFTTYIIISFLIVVNMYIAIILENFSVATEESTEPLSEDDFDMFYEIWEKFDPEATQFIEYSVLSDFADALSEPLRIAKPNQISLINMDLPMVSGDRIHCMDILFAFTKRVLGESGEMDALKIQMEEKFMAANPSKISYEPITTTLRRKHEEVSAMVIQRAFRRHLLQRSLKHASFLFRQQAGSGLSEEDAPEREGLIAYVMSENFSRPLGPPSSSSISSTSFPPSYDSVTRATSDNLQVRGSDYSHSEDLADFPPSPDRDRESIV
"
misc_feature 573..644
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 669..>1067
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 669..728
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 843..902
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 951..1022
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature <1200..1430
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 1362..1439
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 1575..2198
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Domain of unknown function (DUF3451); Region:
DUF3451; pfam11933"
/db_xref="CDD:204785"
misc_feature 1731..1733
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/experiment="experimental evidence, no additional details
recorded"
/note="Dimethylated arginine, alternate;
Omega-N-methylarginine, alternate; propagated from
UniProtKB/Swiss-Prot (Q14524.2); methylation site"
misc_feature 1770..1772
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/experiment="experimental evidence, no additional details
recorded"
/note="Dimethylated arginine, alternate;
Omega-N-methylarginine, alternate; propagated from
UniProtKB/Swiss-Prot (Q14524.2); methylation site"
misc_feature 2232..2234
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/experiment="experimental evidence, no additional details
recorded"
/note="Dimethylated arginine, alternate;
Omega-N-methylarginine, alternate; propagated from
UniProtKB/Swiss-Prot (Q14524.2); methylation site"
misc_feature 2328..2402
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 2436..2507
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 2451..2972
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 2532..2591
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 2610..2669
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 2718..2780
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 2934..3011
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 3051..>3212
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Sodium ion transport-associated; Region:
Na_trans_assoc; pfam06512"
/db_xref="CDD:203469"
misc_feature <3579..3839
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Sodium ion transport-associated; Region:
Na_trans_assoc; pfam06512"
/db_xref="CDD:203469"
misc_feature 3795..3866
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 3906..3983
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 3915..4601
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature 4002..4067
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 4080..4145
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 4203..4271
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 4524..4604
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 4764..4835
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 4869..4940
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 4881..5507
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:201279"
misc_feature <4887..5528
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/note="Polycystin cation channel; Region: PKD_channel;
pfam08016"
/db_xref="CDD:203839"
misc_feature 4959..5030
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 5061..5126
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 5172..5240
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 5436..5510
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
transmembrane region"
misc_feature 6114..6125
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
Region: Interaction with NEDD4, NEDD4L and WWP2"
exon 468..586
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
STS 468..586
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="GDB:624564"
/db_xref="UniSTS:158350"
variation 548
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45533640"
exon 587..676
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
exon 677..805
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
variation 680
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45489099"
exon 806..897
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
variation 842
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45475402"
exon 898..1128
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 7, numbering commonly used in
literature and the LOVD database."
variation 938
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45453395"
variation 995
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45587735"
variation 1034
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:72549413"
exon 1129..1192
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 8, numbering commonly used in
literature and the LOVD database."
exon 1193..1334
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 9, numbering commonly used in
literature and the LOVD database."
variation 1211
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:17215493"
variation 1259
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45570333"
exon 1335..1532
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 10, numbering commonly used
in literature and the LOVD database."
variation 1430
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45565936"
exon 1533..1712
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 11, numbering commonly used
in literature and the LOVD database."
variation 1541
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45477694"
exon 1713..2084
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 12, numbering commonly used
in literature and the LOVD database."
variation 1781
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45624133"
variation 1875
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45522138"
variation 1896
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45600438"
exon 2085..2217
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 13, numbering commonly used
in literature and the LOVD database."
exon 2218..2456
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 14, numbering commonly used
in literature and the LOVD database."
variation 2366
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="t"
/db_xref="dbSNP:45583237"
exon 2457..2630
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 15, numbering commonly used
in literature and the LOVD database."
exon 2631..2981
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 16, numbering commonly used
in literature and the LOVD database."
STS 2961..3833
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="Scn5a"
/db_xref="UniSTS:516644"
exon 2982..3422
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 17, numbering commonly used
in literature and the LOVD database."
variation 3315
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45491996"
variation 3362
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45480800"
exon 3423..3584
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 18, numbering commonly used
in literature and the LOVD database."
exon 3585..3705
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 19, numbering commonly used
in literature and the LOVD database."
exon 3706..3860
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 20, numbering commonly used
in literature and the LOVD database."
variation 3758
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:17221875"
exon 3861..4034
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 21, numbering commonly used
in literature and the LOVD database."
exon 4035..4157
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 22, numbering commonly used
in literature and the LOVD database."
exon 4158..4439
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 23, numbering commonly used
in literature and the LOVD database."
exon 4440..4493
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 24, numbering commonly used
in literature and the LOVD database."
exon 4494..4631
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 25, numbering commonly used
in literature and the LOVD database."
exon 4632..4736
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 26, numbering commonly used
in literature and the LOVD database."
exon 4737..5007
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 27, numbering commonly used
in literature and the LOVD database."
STS 4815..5207
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="Scn3a"
/db_xref="UniSTS:516640"
exon 5008..8504
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/inference="alignment:Splign:1.39.8"
/note="alternate designation 28, numbering commonly used
in literature and the LOVD database."
variation 5018
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45437099"
variation 5442
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45606037"
variation 5651
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1805126"
STS 6107..6463
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="GDB:555574"
/db_xref="UniSTS:157686"
variation 6373
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45601739"
STS 6451..6629
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="D3S4190"
/db_xref="UniSTS:43452"
STS 6496..6793
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="GDB:624573"
/db_xref="UniSTS:158352"
variation 6627
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45459402"
variation 6797
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45615435"
variation 6840
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:4073687"
variation 6904
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45446194"
variation 6922
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45458203"
variation 7067
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45600839"
variation 7267
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45548632"
variation 7449
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45502198"
variation 7681
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45589543"
variation 7813
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:45503498"
variation 7854
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace=""
/replace="c"
/db_xref="dbSNP:45589940"
variation 7866
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45512996"
variation 7869
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45441103"
STS 7919..8459
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/standard_name="SCN5A_3457"
/db_xref="UniSTS:471751"
variation 7988
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45474195"
variation 8045
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45615238"
variation 8065
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:45610536"
variation 8129
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45624736"
variation 8252
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:45593136"
variation 8380
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45502793"
variation 8390..8391
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
/replace=""
/replace="gagaagagagtaggaaaaaggaggg"
/db_xref="dbSNP:45592631"
polyA_signal 8459..8464
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
polyA_site 8504
/gene="SCN5A"
/gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
ORIGIN
agacggcggcggcgcccgtaggatgcagggatcgctcccccggggccgctgagcctgcgcccagtgccccgagccccgcgccgagccgagtccgcgccaagcagcagccgcccaccccggggcccggccgggggaccagcagcttccccacaggcaacgtgaggagagcctgtgcccagaagcaggatgagaagatggcaaacttcctattacctcggggcaccagcagcttccgcaggttcacacgggagtccctggcagccatcgagaagcgcatggcagagaagcaagcccgcggctcaaccaccttgcaggagagccgagaggggctgcccgaggaggaggctccccggccccagctggacctgcaggcctccaaaaagctgccagatctctatggcaatccaccccaagagctcatcggagagcccctggaggacctggaccccttctatagcacccaaaagactttcatcgtactgaataaaggcaagaccatcttccggttcagtgccaccaacgccttgtatgtcctcagtcccttccaccccatccggagagcggctgtgaagattctggttcactcgctcttcaacatgctcatcatgtgcaccatcctcaccaactgcgtgttcatggcccagcacgaccctccaccctggaccaagtatgtcgagtacaccttcaccgccatttacacctttgagtctctggtcaagattctggctcgaggcttctgcctgcacgcgttcactttccttcgggacccatggaactggctggactttagtgtgattatcatggcgtatgtatcagaaaatataaaactaggcaatttgtcggctcttcgaactttcagagtcctgagagctctaaaaactatttcagttatcccagggctgaagaccatcgtgggggccctgatccagtctgtgaagaagctggctgatgtgatggtcctcacagtcttctgcctcagcgtctttgccctcatcggcctgcagctcttcatgggcaacctaaggcacaagtgcgtgcgcaacttcacagcgctcaacggcaccaacggctccgtggaggccgacggcttggtctgggaatccctggacctttacctcagtgatccagaaaattacctgctcaagaacggcacctctgatgtgttactgtgtgggaacagctctgacgctgggacatgtccggagggctaccggtgcctaaaggcaggcgagaaccccgaccacggctacaccagcttcgattcctttgcctgggcctttcttgcactcttccgcctgatgacgcaggactgctgggagcgcctctatcagcagaccctcaggtccgcagggaagatctacatgatcttcttcatgcttgtcatcttcctggggtccttctacctggtgaacctgatcctggccgtggtcgcaatggcctatgaggagcaaaaccaagccaccatcgctgagaccgaggagaaggaaaagcgcttccaggaggccatggaaatgctcaagaaagaacacgaggccctcaccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggccccagtaaacagccatgagagaagaagcaagaggagaaaacggatgtcttcaggaactgaggagtgtggggaggacaggctccccaagtctgactcagaagatggtcccagagcaatgaatcatctcagcctcacccgtggcctcagcaggacttctatgaagccacgttccagccgcgggagcattttcacctttcgcaggcgagacctgggttctgaagcagattttgcagatgatgaaaacagcacagcgggggagagcgagagccaccacacatcactgctggtgccctggcccctgcgccggaccagtgcccagggacagcccagtcccggaacctcggctcctggccacgccctccatggcaaaaagaacagcactgtggactgcaatggggtggtctcattactgggggcaggcgacccagaggccacatccccaggaagccacctcctccgccctgtgatgctagagcacccgccagacacgaccacgccatcggaggagccaggcgggccccagatgctgacctcccaggctccgtgtgtagatggcttcgaggagccaggagcacggcagcgggccctcagcgcagtcagcgtcctcaccagcgcactggaagagttagaggagtctcgccacaagtgtccaccatgctggaaccgtctcgcccagcgctacctgatctgggagtgctgcccgctgtggatgtccatcaagcagggagtgaagttggtggtcatggacccgtttactgacctcaccatcactatgtgcatcgtactcaacacactcttcatggcgctggagcactacaacatgacaagtgaattcgaggagatgctgcaggtcggaaacctggtcttcacagggattttcacagcagagatgaccttcaagatcattgccctcgacccctactactacttccaacagggctggaacatcttcgacagcatcatcgtcatccttagcctcatggagctgggcctgtcccgcatgagcaacttgtcggtgctgcgctccttccgcctgctgcgggtcttcaagctggccaaatcatggcccaccctgaacacactcatcaagatcatcgggaactcagtgggggcactggggaacctgacactggtgctagccatcatcgtgttcatctttgctgtggtgggcatgcagctctttggcaagaactactcggagctgagggacagcgactcaggcctgctgcctcgctggcacatgatggacttctttcatgccttcctcatcatcttccgcatcctctgtggagagtggatcgagaccatgtgggactgcatggaggtgtcggggcagtcattatgcctgctggtcttcttgcttgttatggtcattggcaaccttgtggtcctgaatctcttcctggccttgctgctcagctccttcagtgcagacaacctcacagcccctgatgaggacagagagatgaacaacctccagctggccctggcccgcatccagaggggcctgcgctttgtcaagcggaccacctgggatttctgctgtggtctcctgcggcagcggcctcagaagcccgcagcccttgccgcccagggccagctgcccagctgcattgccaccccctactccccgccacccccagagacggagaaggtgcctcccacccgcaaggaaacacggtttgaggaaggcgagcaaccaggccagggcacccccggggatccagagcccgtgtgtgtgcccatcgctgtggccgagtcagacacagatgaccaagaagaagatgaggagaacagcctgggcacggaggaggagtccagcaagcagcaggaatcccagcctgtgtccggtggcccagaggcccctccggattccaggacctggagccaggtgtcagcgactgcctcctctgaggccgaggccagtgcatctcaggccgactggcggcagcagtggaaagcggaaccccaggccccagggtgcggtgagaccccagaggacagttgctccgagggcagcacagcagacatgaccaacaccgctgagctcctggagcagatccctgacctcggccaggatgtcaaggacccagaggactgcttcactgaaggctgtgtccggcgctgtccctgctgtgcggtggacaccacacaggccccagggaaggtctggtggcggttgcgcaagacctgctaccacatcgtggagcacagctggttcgagacattcatcatcttcatgatcctactcagcagtggagcgctggccttcgaggacatctacctagaggagcggaagaccatcaaggttctgcttgagtatgccgacaagatgttcacatatgtcttcgtgctggagatgctgctcaagtgggtggcctacggcttcaagaagtacttcaccaatgcctggtgctggctcgacttcctcatcgtagacgtctctctggtcagcctggtggccaacaccctgggctttgccgagatgggccccatcaagtcactgcggacgctgcgtgcactccgtcctctgagagctctgtcacgatttgagggcatgagggtggtggtcaatgccctggtgggcgccatcccgtccatcatgaacgtcctcctcgtctgcctcatcttctggctcatcttcagcatcatgggcgtgaacctctttgcggggaagtttgggaggtgcatcaaccagacagagggagacttgcctttgaactacaccatcgtgaacaacaagagccagtgtgagtccttgaacttgaccggagaattgtactggaccaaggtgaaagtcaactttgacaacgtgggggccgggtacctggcccttctgcaggtggcaacatttaaaggctggatggacattatgtatgcagctgtggactccagggggtatgaagagcagcctcagtgggaatacaacctctacatgtacatctattttgtcattttcatcatctttgggtctttcttcaccctgaacctctttattggtgtcatcattgacaacttcaaccaacagaagaaaaagttagggggccaggacatcttcatgacagaggagcagaagaagtactacaatgccatgaagaagctgggctccaagaagccccagaagcccatcccacggcccctgaacaagtaccagggcttcatattcgacattgtgaccaagcaggcctttgacgtcaccatcatgtttctgatctgcttgaatatggtgaccatgatggtggagacagatgaccaaagtcctgagaaaatcaacatcttggccaagatcaacctgctctttgtggccatcttcacaggcgagtgtattgtcaagctggctgccctgcgccactactacttcaccaacagctggaatatcttcgacttcgtggttgtcatcctctccatcgtgggcactgtgctctcggacatcatccagaagtacttcttctccccgacgctcttccgagtcatccgcctggcccgaataggccgcatcctcagactgatccgaggggccaaggggatccgcacgctgctctttgccctcatgatgtccctgcctgccctcttcaacatcgggctgctgctcttcctcgtcatgttcatctactccatctttggcatggccaacttcgcttatgtcaagtgggaggctggcatcgacgacatgttcaacttccagaccttcgccaacagcatgctgtgcctcttccagatcaccacgtcggccggctgggatggcctcctcagccccatcctcaacactgggccgccctactgcgaccccactctgcccaacagcaatggctctcggggggactgcgggagcccagccgtgggcatcctcttcttcaccacctacatcatcatctccttcctcatcgtggtcaacatgtacattgccatcatcctggagaacttcagcgtggccacggaggagagcaccgagcccctgagtgaggacgacttcgatatgttctatgagatctgggagaaatttgacccagaggccactcagtttattgagtattcggtcctgtctgactttgccgatgccctgtctgagccactccgtatcgccaagcccaaccagataagcctcatcaacatggacctgcccatggtgagtggggaccgcatccattgcatggacattctctttgccttcaccaaaagggtcctgggggagtctggggagatggacgccctgaagatccagatggaggagaagttcatggcagccaacccatccaagatctcctacgagcccatcaccaccacactccggcgcaagcacgaagaggtgtcggccatggttatccagagagccttccgcaggcacctgctgcaacgctctttgaagcatgcctccttcctcttccgtcagcaggcgggcagcggcctctccgaagaggatgcccctgagcgagagggcctcatcgcctacgtgatgagtgagaacttctcccgaccccttggcccaccctccagctcctccatctcctccacttccttcccaccctcctatgacagtgtcactagagccaccagcgataacctccaggtgcgggggtctgactacagccacagtgaagatctcgccgacttccccccttctccggacagggaccgtgagtccatcgtgtgagcctcggcctggctggccaggacacactgaaaagcagcctttttcaccatggcaaacctaaatgcagtcagtcacaaaccagcctggggccttcctggctttgggagtaagaaatgggcctcagccccgcggatcaaccaggcagagttctgtggcgccgcgtggacagccggagcagttggcctgtgcttggaggcctcagatagacctgtgacctggtctggtcaggcaatgccctgcggctctggaaagcaacttcatcccagctgctgaggcgaaatataaaactgagactgtatatgttgtgaatgggctttcataaatttattatatttgatatttttttacttgagcaaagaactaaggatttttccatggacatgggcagcaattcacgctgtctcttcttaaccctgaacaagagtgtctatggagcagccggaagtctgttctcaaagcagaagtggaatccagtgtggctcccacaggtcttcactgcccaggggtcgaatggggtccccctcccacttgacctgagatgctgggagggctgaacccccactcacacaagcacacacacacagtcctcacacacggaggccagacacaggccgtgggacccaggctcccagcctaagggagacaggcctttccctgccggccccccaaggatggggttcttgtccacggggctcactctggccccctattgtctccaaggtcccattttccccctgtgttttcacgcaggtcatattgtcagtcctacaaaaataaaaggcttccagaggagagtggcctgggtcccagggctggccctaggcactgatagttgccttttcttcccctcctgtaagagtattaacaaaaccaaaggacacaagggtgcaagccccattcacggcctggcatgcagcttgtccttgctcctggaacctggcaggccctgcccagccagccatcggaagagagggctgagccatgggggtttggggctaagaagttcaccagccctgagccatggcggcccctcagcctgcctgaagagaggaaactggcgatctcccagggctctctggaccatacgcggaggagttttctgtgtggtctccagctcctctccagacacagagacatgggagtggggagcggagcttggccctgcgccctgtgcagggaaagggatggtcaggcccagttctcgtgcccttagaggggaatgaaccatggcacctttgagagagggggcactgtggtcaggcccagcctctctggctcagcccgggatcctgatggcacccacacagaggacctctttggggcaagatccaggtggtcccataggtcttgtgaaaaggctttttcagggaaaaatattttactagtccaatcacccccaggacctcttcagctgctgacaatcctatttagcatatgcaaatcttttaacatagagaactgtcaccctgaggtaacagggtcaactggcgaagcctgagcaggcaggggcttggctgccccattccagctctcccatggagcccctccaccgggcgcatgcctcccaggccacctcagtctcacctgccggctctgggctggctgctcctaacctacctcgccgagctgtcggagggctggacatttgtggcagtgctgaagggggcattgccggcgagtaaagtattatgtttcttcttgtcaccccagttcccttggtggcaaccccagacccaacccatgcccctgacagatctagttctcttctcctgtgttccctttgagtccagtgtgggacacggtttaactgtcccagcgacatttctccaagtggaaatcctatttttgtagatctccatgctttgctctcaaggcttggagaggtatgtgcccctcctgggtgctcaccgcctgctacacaggcaggaatgcggttgggaggcaggtcgggctgccagcccagctggccggaaggagactgtggtttttgtgtgtgtggacagcccgggagctttgagacaggtgcctggggctggctgcagacggtgtggttgggggtgggaggtgagctagacccaacccttagcttttagcctggctgtcacctttttaatttccagaactgcacaatgaccagcaggagggaaggacagacatcaagtgccagatgttgtctgaactaatcgagcacttctcaccaaacttcatgtataaataaaatacatatttttaaaacaaaccaataaatggcttacatga
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6331 -> Molecular function: GO:0005248 [voltage-gated sodium channel activity] evidence: IDA
GeneID:6331 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0030506 [ankyrin binding] evidence: IDA
GeneID:6331 -> Molecular function: GO:0044325 [ion channel binding] evidence: IPI
GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IDA
GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IMP
GeneID:6331 -> Molecular function: GO:0097110 [scaffold protein binding] evidence: IPI
GeneID:6331 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP
GeneID:6331 -> Biological process: GO:0003231 [cardiac ventricle development] evidence: ISS
GeneID:6331 -> Biological process: GO:0003360 [brainstem development] evidence: ISS
GeneID:6331 -> Biological process: GO:0006814 [sodium ion transport] evidence: IDA
GeneID:6331 -> Biological process: GO:0010765 [positive regulation of sodium ion transport] evidence: IDA
GeneID:6331 -> Biological process: GO:0014894 [response to denervation involved in regulation of muscle adaptation] evidence: ISS
GeneID:6331 -> Biological process: GO:0021537 [telencephalon development] evidence: ISS
GeneID:6331 -> Biological process: GO:0021549 [cerebellum development] evidence: ISS
GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IDA
GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IMP
GeneID:6331 -> Biological process: GO:0042475 [odontogenesis of dentin-containing tooth] evidence: ISS
GeneID:6331 -> Biological process: GO:0045760 [positive regulation of action potential] evidence: ISS
GeneID:6331 -> Biological process: GO:0050679 [positive regulation of epithelial cell proliferation] evidence: ISS
GeneID:6331 -> Biological process: GO:0051899 [membrane depolarization] evidence: IDA
GeneID:6331 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
GeneID:6331 -> Biological process: GO:0060307 [regulation of ventricular cardiac muscle cell membrane repolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0060371 [regulation of atrial cardiac muscle cell membrane depolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0060372 [regulation of atrial cardiac muscle cell membrane repolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0060373 [regulation of ventricular cardiac muscle cell membrane depolarization] evidence: IMP
GeneID:6331 -> Biological process: GO:0071277 [cellular response to calcium ion] evidence: IDA
GeneID:6331 -> Biological process: GO:0086002 [regulation of cardiac muscle cell action potential involved in contraction] evidence: IMP
GeneID:6331 -> Biological process: GO:0086004 [regulation of cardiac muscle cell contraction] evidence: IMP
GeneID:6331 -> Biological process: GO:0086005 [regulation of ventricular cardiac muscle cell action potential] evidence: IMP
GeneID:6331 -> Biological process: GO:0086010 [membrane depolarization involved in regulation of action potential] evidence: IDA
GeneID:6331 -> Biological process: GO:0086012 [membrane depolarization involved in regulation of cardiac muscle cell action potential] evidence: IMP
GeneID:6331 -> Biological process: GO:0086046 [membrane depolarization involved in regulation of SA node cell action potential] evidence: ISS
GeneID:6331 -> Biological process: GO:0086067 [AV node cell to bundle of His cell communication] evidence: IMP
GeneID:6331 -> Biological process: GO:0086069 [bundle of His cell to Purkinje myocyte communication] evidence: IMP
GeneID:6331 -> Biological process: GO:0086070 [SA node cell to atrial cardiac muscle cell communication] evidence: IMP
GeneID:6331 -> Biological process: GO:0086091 [regulation of heart rate by cardiac conduction] evidence: IMP
GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IC
GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IDA
GeneID:6331 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IDA
GeneID:6331 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:6331 -> Cellular component: GO:0005901 [caveola] evidence: TAS
GeneID:6331 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: IDA
GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: ISS
GeneID:6331 -> Cellular component: GO:0016021 [integral to membrane] evidence: IDA
GeneID:6331 -> Cellular component: GO:0030315 [T-tubule] evidence: IDA
GeneID:6331 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.