2024-04-19 21:35:42, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001098834 1324 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens gastrulation brain homeobox 1 (GBX1), mRNA. ACCESSION NM_001098834 VERSION NM_001098834.1 GI:149588929 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1324) AUTHORS Huntriss,J., Hinkins,M. and Picton,H.M. TITLE cDNA cloning and expression of the human NOBOX gene in oocytes and ovarian follicles JOURNAL Mol. Hum. Reprod. 12 (5), 283-289 (2006) PUBMED 16597639 REMARK GeneRIF: Study reveals the preferential expression of GBX1 by germinal vesicle (GV) oocytes. REFERENCE 2 (bases 1 to 1324) AUTHORS Matsui,T., Hirai,M., Hirano,M. and Kurosawa,Y. TITLE The HOX complex neighbored by the EVX gene, as well as two other homeobox-containing genes, the GBX-class and the EN-class, are located on the same chromosomes 2 and 7 in humans JOURNAL FEBS Lett. 336 (1), 107-110 (1993) PUBMED 7903253 REFERENCE 3 (bases 1 to 1324) AUTHORS Matsui,T., Hirai,M., Wakita,M., Hirano,M. and Kurosawa,Y. TITLE Expression of a novel human homeobox-containing gene that maps to chromosome 7q36.1 in hematopoietic cells JOURNAL FEBS Lett. 322 (2), 181-185 (1993) PUBMED 8097731 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AC010973.6. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns ERS025088 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-770 AC010973.6 37915-38684 771-1324 AC010973.6 56553-57106 FEATURES Location/Qualifiers source 1..1324 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="7" /map="7q36.1" gene 1..1324 /gene="GBX1" /note="gastrulation brain homeobox 1" /db_xref="GeneID:2636" /db_xref="HGNC:4185" /db_xref="MIM:603354" exon 1..770 /gene="GBX1" /inference="alignment:Splign:1.39.8" misc_feature 2..4 /gene="GBX1" /note="upstream in-frame stop codon" CDS 233..1324 /gene="GBX1" /note="gastrulation brain homeo box 1; gastrulation and brain-specific homeobox protein 1" /codon_start=1 /product="homeobox protein GBX-1" /protein_id="NP_001092304.1" /db_xref="GI:149588930" /db_xref="CCDS:CCDS43682.1" /db_xref="GeneID:2636" /db_xref="HGNC:4185" /db_xref="MIM:603354" /translation="
MQRAGGGSAPGGNGGGGGGGPGTAFSIDSLIGPPPPRSGHLLYTGYPMFMPYRPLVLPQALAPAPLPAGLPPLAPLASFAGRLTNTFCAGLGQAVPSMVALTTALPSFAEPPDAFYGPQELAAAAAAAAATAARNNPEPGGRRPEGGLEADELLPAREKVAEPPPPPPPHFSETFPSLPAEGKVYSSDEEKLEASAGDPAGSEQEEEGSGGDSEDDGFLDSSAGGPGALLGPKPKLKGSLGTGAEEGAPVTAGVTAPGGKSRRRRTAFTSEQLLELEKEFHCKKYLSLTERSQIAHALKLSEVQVKIWFQNRRAKWKRIKAGNVSSRSGEPVRNPKIVVPIPVHVNRFAVRSQHQQMEQGARP
" misc_feature 1016..1192 /gene="GBX1" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(1016..1030,1034..1036,1085..1087,1103..1105, 1142..1144,1148..1153,1160..1165,1169..1177,1181..1186) /gene="GBX1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(1022..1024,1031..1033,1151..1153,1160..1165, 1172..1174) /gene="GBX1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" variation complement(325) /gene="GBX1" /replace="c" /replace="g" /db_xref="dbSNP:13242341" variation complement(628) /gene="GBX1" /replace="c" /replace="g" /db_xref="dbSNP:13241978" variation complement(634) /gene="GBX1" /replace="a" /replace="c" /db_xref="dbSNP:193195002" variation complement(671) /gene="GBX1" /replace="a" /replace="g" /db_xref="dbSNP:377469765" variation complement(683) /gene="GBX1" /replace="a" /replace="g" /db_xref="dbSNP:200545413" variation complement(689) /gene="GBX1" /replace="c" /replace="g" /db_xref="dbSNP:201650225" variation complement(696) /gene="GBX1" /replace="c" /replace="t" /db_xref="dbSNP:370046549" variation complement(751) /gene="GBX1" /replace="g" /replace="t" /db_xref="dbSNP:201756310" variation complement(764) /gene="GBX1" /replace="a" /replace="c" /db_xref="dbSNP:372158178" variation complement(768) /gene="GBX1" /replace="c" /replace="t" /db_xref="dbSNP:369810012" variation complement(769) /gene="GBX1" /replace="c" /replace="t" /db_xref="dbSNP:375522842" exon 771..1324 /gene="GBX1" /inference="alignment:Splign:1.39.8" variation complement(812) /gene="GBX1" /replace="a" /replace="g" /db_xref="dbSNP:11975799" variation complement(828) /gene="GBX1" /replace="c" /replace="t" /db_xref="dbSNP:367624740" variation complement(895) /gene="GBX1" /replace="g" /replace="t" /db_xref="dbSNP:192479027" variation complement(917) /gene="GBX1" /replace="c" /replace="t" /db_xref="dbSNP:200119934" variation complement(933) /gene="GBX1" /replace="c" /replace="t" /db_xref="dbSNP:375529208" variation complement(937) /gene="GBX1" /replace="a" /replace="g" /db_xref="dbSNP:370970805" variation complement(942) /gene="GBX1" /replace="a" /replace="g" /db_xref="dbSNP:6970768" variation complement(978) /gene="GBX1" /replace="c" /replace="t" /db_xref="dbSNP:201395169" variation complement(990) /gene="GBX1" /replace="g" /replace="t" /db_xref="dbSNP:374261532" variation complement(1023) /gene="GBX1" /replace="a" /replace="g" /db_xref="dbSNP:200333232" variation complement(1088) /gene="GBX1" /replace="c" /replace="t" /db_xref="dbSNP:200785319" variation complement(1114) /gene="GBX1" /replace="c" /replace="t" /db_xref="dbSNP:201417319" variation complement(1121) /gene="GBX1" /replace="a" /replace="g" /db_xref="dbSNP:200609477" variation complement(1147) /gene="GBX1" /replace="a" /replace="c" /db_xref="dbSNP:75176255" variation complement(1168) /gene="GBX1" /replace="a" /replace="g" /db_xref="dbSNP:373562908" variation complement(1184) /gene="GBX1" /replace="c" /replace="g" /db_xref="dbSNP:368877994" variation complement(1204) /gene="GBX1" /replace="g" /replace="t" /db_xref="dbSNP:376045645" variation complement(1212) /gene="GBX1" /replace="a" /replace="g" /db_xref="dbSNP:199515474" variation complement(1278) /gene="GBX1" /replace="c" /replace="t" /db_xref="dbSNP:201566761" variation complement(1283) /gene="GBX1" /replace="c" /replace="t" /db_xref="dbSNP:202046564" variation complement(1317) /gene="GBX1" /replace="a" /replace="g" /db_xref="dbSNP:376566770" ORIGIN
atgagtccggagggcgacacccccagcccgcctgctcgcccgccccctccctccttatgagagagagggagcgcggcgccggagccacactgcgccgagcccgcgccccgccgccacctcggcccgggagccagggagcgagccctgcgtgtccgcgcggggcgcccgagccgcggggcgcacggaggcgcccagagaggagcgccccggggcggccgcagctccgaacaagatgcagcgggccggaggcggtagcgcccctgggggcaacggcgggggcggcggcgggggcccgggcactgccttctccatcgactccctaatcgggccgccgccgccgcgctccggccacttgctgtacaccggctaccccatgttcatgccctaccggccgctcgtgctgccgcaggcgctggcccctgcgccgctgcccgctggcctcccgcccctcgccccgctagcctctttcgccggccgccttaccaacaccttctgcgcggggctgggtcaggctgtgccctcgatggtggcgctgaccaccgcgctgcccagcttcgcggagccgcccgacgctttctacgggccccaggagctcgccgccgccgctgccgccgccgccgccactgccgcccgaaacaaccccgagccaggcggccgacgcccagagggtgggctggaagctgatgagctgctgccggcccgggagaaagtggcagagcccccaccacctccgcctccgcacttctcagagacttttccaagtctgcccgcagaggggaaggtgtacagctcagatgaggagaagctggaggcatcagcaggagacccagcaggcagcgaacaggaggaagagggctcaggcggtgacagcgaggatgacggtttcctggacagttctgcagggggcccaggggctcttctgggacctaaaccgaagctaaagggaagcctggggactggagctgaggagggggcaccggtgacagcaggggtcacagctcctggggggaaaagccgacggcgccgcacagcatttaccagcgagcagcttttggaattggagaaggaatttcattgcaagaaatacctgagcttgacagagcgctctcagatcgcccacgccctcaagctcagtgaggtgcaggtcaagatctggtttcagaatcgacgggccaagtggaagcgcatcaaagctggcaatgtgagcagccgttctggggagcccgtaagaaaccccaagattgttgtccccatacctgtgcatgtcaacaggtttgctgtgcggagccagcaccaacaaatggagcagggggcccggccctga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:2636 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: NAS GeneID:2636 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:2636 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:2636 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: NAS GeneID:2636 -> Cellular component: GO:0000228 [nuclear chromosome] evidence: NAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.