Home |
Help |
Advanced search
2024-04-24 02:26:05, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001098210 3256 bp mRNA linear PRI 01-JUL-2013
DEFINITION Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa
(CTNNB1), transcript variant 3, mRNA.
ACCESSION NM_001098210
VERSION NM_001098210.1 GI:148227671
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3256)
AUTHORS Li,Y. and Shively,J.E.
TITLE CEACAM1 regulates Fas-mediated apoptosis in Jurkat T-cells via its
interaction with beta-catenin
JOURNAL Exp. Cell Res. 319 (8), 1061-1072 (2013)
PUBMED 23499736
REMARK GeneRIF: CEACAM1 regulates Fas-mediated apoptosis in Jurkat T-cells
via its interaction with beta-catenin.
REFERENCE 2 (bases 1 to 3256)
AUTHORS Chiang,C.H., Hou,M.F. and Hung,W.C.
TITLE Up-regulation of miR-182 by beta-catenin in breast cancer increases
tumorigenicity and invasiveness by targeting the matrix
metalloproteinase inhibitor RECK
JOURNAL Biochim. Biophys. Acta 1830 (4), 3067-3076 (2013)
PUBMED 23333633
REMARK GeneRIF: data demonstrate for the first time that miR-182
expression is controlled by beta-catenin
REFERENCE 3 (bases 1 to 3256)
AUTHORS Lee,H.J., Lee,O.J., Jang,K.T., Bae,Y.K., Chung,J.Y., Eom,D.W.,
Kim,J.M., Yu,E. and Hong,S.M.
TITLE Combined loss of E-cadherin and aberrant beta-catenin protein
expression correlates with a poor prognosis for small intestinal
adenocarcinomas
JOURNAL Am. J. Clin. Pathol. 139 (2), 167-176 (2013)
PUBMED 23355201
REMARK GeneRIF: Loss of E-cadherin and aberrant beta-catenin expression
could be a prognostic factor in patients with small intestinal
adeno-carcinomas.
REFERENCE 4 (bases 1 to 3256)
AUTHORS Zanna,P., Maida,I., Grieco,C., Guida,S., Turpin Sevilla,M.C., De
Summa,S., Tommasi,S., Vena,G.A., Filotico,R. and Guida,G.
TITLE Three novel human sporadic melanoma cell lines: signaling pathways
controlled by MC1R, BRAF and beta-catenins
JOURNAL J. Biol. Regul. Homeost. Agents 27 (1), 131-141 (2013)
PUBMED 23489693
REMARK GeneRIF: Quantity and subcellular localization of beta-catenin were
analyzed in both novel and control cell lines.
REFERENCE 5 (bases 1 to 3256)
AUTHORS Wangefjord,S., Brandstedt,J., Lindquist,K.E., Nodin,B., Jirstrom,K.
and Eberhard,J.
TITLE Associations of beta-catenin alterations and MSI screening status
with expression of key cell cycle regulating proteins and survival
from colorectal cancer
JOURNAL Diagn Pathol 8, 10 (2013)
PUBMED 23337059
REMARK GeneRIF: Report association of microsatellite instability and
beta-catenin alterations with prognosis in colorectal cancer.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 3256)
AUTHORS Sacco,P.A., McGranahan,T.M., Wheelock,M.J. and Johnson,K.R.
TITLE Identification of plakoglobin domains required for association with
N-cadherin and alpha-catenin
JOURNAL J. Biol. Chem. 270 (34), 20201-20206 (1995)
PUBMED 7650039
REFERENCE 7 (bases 1 to 3256)
AUTHORS Brady-Kalnay,S.M., Rimm,D.L. and Tonks,N.K.
TITLE Receptor protein tyrosine phosphatase PTPmu associates with
cadherins and catenins in vivo
JOURNAL J. Cell Biol. 130 (4), 977-986 (1995)
PUBMED 7642713
REFERENCE 8 (bases 1 to 3256)
AUTHORS Kanai,Y., Ochiai,A., Shibata,T., Oyama,T., Ushijima,S., Akimoto,S.
and Hirohashi,S.
TITLE c-erbB-2 gene product directly associates with beta-catenin and
plakoglobin
JOURNAL Biochem. Biophys. Res. Commun. 208 (3), 1067-1072 (1995)
PUBMED 7702605
REFERENCE 9 (bases 1 to 3256)
AUTHORS van Hengel,J., Nollet,F., Berx,G., van Roy,N., Speleman,F. and van
Roy,F.
TITLE Assignment of the human beta-catenin gene (CTNNB1) to 3p22-->p21.3
by fluorescence in situ hybridization
JOURNAL Cytogenet. Cell Genet. 70 (1-2), 68-70 (1995)
PUBMED 7736793
REFERENCE 10 (bases 1 to 3256)
AUTHORS Aberle,H., Butz,S., Stappert,J., Weissig,H., Kemler,R. and
Hoschuetzky,H.
TITLE Assembly of the cadherin-catenin complex in vitro with recombinant
proteins
JOURNAL J. Cell. Sci. 107 (PT 12), 3655-3663 (1994)
PUBMED 7706414
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DA216720.1, Z19054.1 and
AC104307.2.
Summary: The protein encoded by this gene is part of a complex of
proteins that constitute adherens junctions (AJs). AJs are
necessary for the creation and maintenance of epithelial cell
layers by regulating cell growth and adhesion between cells. The
encoded protein also anchors the actin cytoskeleton and may be
responsible for transmitting the contact inhibition signal that
causes cells to stop dividing once the epithelial sheet is
complete. Finally, this protein binds to the product of the APC
gene, which is mutated in adenomatous polyposis of the colon.
Mutations in this gene are a cause of colorectal cancer (CRC),
pilomatrixoma (PTR), medulloblastoma (MDB), and ovarian cancer.
Three transcript variants encoding the same protein have been found
for this gene.[provided by RefSeq, Oct 2009].
Transcript Variant: This variant (3) differs in the 3' UTR compared
to variant 1. All three variants encode the same protein.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: Z19054.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-70 DA216720.1 1-70
71-2650 Z19054.1 3-2582
2651-3256 AC104307.2 84258-84863
FEATURES Location/Qualifiers
source 1..3256
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3p21"
gene 1..3256
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="catenin (cadherin-associated protein), beta 1,
88kDa"
/db_xref="GeneID:1499"
/db_xref="HGNC:2514"
/db_xref="MIM:116806"
exon 1..220
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 87
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/db_xref="dbSNP:369634833"
variation 103
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="g"
/replace="t"
/db_xref="dbSNP:13067968"
variation 126
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:13067975"
variation 151
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/db_xref="dbSNP:11564434"
variation 213
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/db_xref="dbSNP:11564435"
exon 221..281
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 224
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:4135376"
misc_feature 227..229
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="upstream in-frame stop codon"
STS 257..543
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/standard_name="PMC130963P2"
/db_xref="UniSTS:270617"
variation 260
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/db_xref="dbSNP:5743390"
CDS 269..2614
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/codon_start=1
/product="catenin beta-1"
/protein_id="NP_001091680.1"
/db_xref="GI:148227672"
/db_xref="CCDS:CCDS2694.1"
/db_xref="GeneID:1499"
/db_xref="HGNC:2514"
/db_xref="MIM:116806"
/translation="
MATQADLMELDMAMEPDRKAAVSHWQQQSYLDSGIHSGATTTAPSLSGKGNPEEEDVDTSQVLYEWEQGFSQSFTQEQVADIDGQYAMTRAQRVRAAMFPETLDEGMQIPSTQFDAAHPTNVQRLAEPSQMLKHAVVNLINYQDDAELATRAIPELTKLLNDEDQVVVNKAAVMVHQLSKKEASRHAIMRSPQMVSAIVRTMQNTNDVETARCTAGTLHNLSHHREGLLAIFKSGGIPALVKMLGSPVDSVLFYAITTLHNLLLHQEGAKMAVRLAGGLQKMVALLNKTNVKFLAITTDCLQILAYGNQESKLIILASGGPQALVNIMRTYTYEKLLWTTSRVLKVLSVCSSNKPAIVEAGGMQALGLHLTDPSQRLVQNCLWTLRNLSDAATKQEGMEGLLGTLVQLLGSDDINVVTCAAGILSNLTCNNYKNKMMVCQVGGIEALVRTVLRAGDREDITEPAICALRHLTSRHQEAEMAQNAVRLHYGLPVVVKLLHPPSHWPLIKATVGLIRNLALCPANHAPLREQGAIPRLVQLLVRAHQDTQRRTSMGGTQQQFVEGVRMEEIVEGCTGALHILARDVHNRIVIRGLNTIPLFVQLLYSPIENIQRVAAGVLCELAQDKEAAEAIEAEGATAPLTELLHSRNEGVATYAAAVLFRMSEDKPQDYKKRLSVELTSSLFRTEPMAWNETADLGLDIGAQGEPLGYRQDDPSYRSFHSGGYGQDALGMDPMMEHEMGGHHPGADYPVDGLPDLGHAQDLMDGLPPGDSNQLAWFDTDL
"
misc_feature 269..337
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: Interaction with VCL (By similarity)"
misc_feature 335..337
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by GSK3-beta; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature 353..355
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by GSK3-beta; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature 365..367
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by GSK3-beta and HIPK2; propagated
from UniProtKB/Swiss-Prot (P35222.1); phosphorylation
site"
misc_feature 377..379
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by GSK3-beta and HIPK2; propagated
from UniProtKB/Swiss-Prot (P35222.1); phosphorylation
site"
misc_feature 389..391
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by GSK3-beta; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature 401..403
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P35222.1); phosphorylation site"
misc_feature 458..460
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by PTK6; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature 524..526
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by CSK; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature 590..934
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:237987"
misc_feature order(608..610,626..628,638..640,764..766,776..778,
785..787,797..799,905..907,914..916,923..928)
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:237987"
misc_feature 692..694
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by FYN and PTK6; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature 719..841
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 1"
misc_feature 839..841
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by CDK5; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature 845..970
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 2"
misc_feature 953..1312
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:237987"
misc_feature 971..1096
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 3"
misc_feature 1004..1006
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by CDK5; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature order(1025..1027,1037..1039,1049..1051,1142..1144,
1154..1156,1163..1165,1175..1177,1283..1285,1292..1294,
1301..1306)
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:237987"
misc_feature 1097..1222
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 4"
misc_feature 1223..1348
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 5"
misc_feature 1259..1261
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by PTK6; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature 1316..1438
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="Armadillo/beta-catenin-like repeats; Region: ARM;
smart00185"
/db_xref="CDD:214547"
misc_feature 1349..1435
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 6"
misc_feature 1463..1822
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:237987"
misc_feature 1466..1591
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 7"
misc_feature order(1520..1522,1532..1534,1544..1546,1643..1645,
1655..1657,1664..1666,1676..1678,1793..1795,1802..1804,
1811..1816)
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:237987"
misc_feature 1592..1720
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 8"
misc_feature 1718..2137
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:237987"
misc_feature 1733..1858
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 9"
misc_feature order(1790..1792,1802..1804,1814..1816,1970..1972,
1982..1984,1991..1993,2003..2005,2105..2107,2114..2116,
2123..2128,2135..2137)
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:237987"
misc_feature 1859..1981
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 10"
misc_feature 1919..1921
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature 1922..1924
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P35222.1); phosphorylation site"
misc_feature 1922..1924
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1934..1936
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature 2033..>2272
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:237987"
misc_feature 2048..2176
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 11"
misc_feature order(2102..2104,2114..2116,2126..2128,2216..2218,
2228..2230,2237..2239,2249..2251)
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:237987"
misc_feature 2177..2266
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: ARM 12"
misc_feature 2228..2230
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by CSK; propagated from
UniProtKB/Swiss-Prot (P35222.1); phosphorylation site"
misc_feature 2291..2293
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P35222.1); phosphorylation site"
misc_feature 2291..2293
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2582..2611
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35222.1);
Region: Interaction with SCRIB (By similarity)"
exon 282..509
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
STS 285..510
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/standard_name="PMC15782P2"
/db_xref="UniSTS:271431"
STS 286..457
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/standard_name="PMC123056P1"
/db_xref="UniSTS:270433"
variation 305
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:121913394"
variation 329
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:121913395"
variation 332..382
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="gttagtcactggcagcaacagtcttacctggactctggaatccattct
ggt"
/db_xref="dbSNP:121913416"
variation 333
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:77064436"
variation 342..365
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="ggcagcaacagtcttacctggact"
/db_xref="dbSNP:121913417"
variation 349
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:369714835"
variation 362
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:28931588"
variation 363
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:121913396"
variation 366
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:121913400"
variation 368
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:121913399"
variation 369
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:28931589"
variation 377
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:121913228"
variation 378
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:121913403"
variation 389
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:121913412"
variation 390
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:121913413"
variation 401
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:121913407"
variation 402
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:121913409"
variation 505
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:113120762"
exon 510..763
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 650
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:202217100"
variation 688
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:3856746"
variation 720
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:200968230"
variation 751
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:369510063"
variation 754
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:5743392"
exon 764..1002
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
STS 766..996
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/standard_name="PMC15782P1"
/db_xref="UniSTS:271430"
variation 769
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:142472167"
variation 804
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="c"
/db_xref="dbSNP:77624106"
variation 820
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:375776725"
variation 826
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:373990577"
STS 847..1116
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/standard_name="Ctnnb1"
/db_xref="UniSTS:508428"
variation 851
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:147382769"
variation 866
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:139085081"
variation 901
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:148600849"
variation 903
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:200890083"
variation 910
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:3856747"
variation 911
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:369771822"
variation 942
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/db_xref="dbSNP:144087793"
variation 986
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/db_xref="dbSNP:373574509"
exon 1003..1204
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 1029..1030
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="t"
/db_xref="dbSNP:67701980"
variation 1108
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:13086686"
variation 1109..1110
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="a"
/db_xref="dbSNP:68115726"
variation 1128
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:35288908"
variation 1159
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:370662884"
variation 1174
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:375262741"
variation 1193
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/db_xref="dbSNP:376393123"
exon 1205..1349
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 1246
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:138154972"
variation 1291
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:34343353"
variation 1306
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:367845313"
variation 1333
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:200709497"
exon 1350..1453
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 1423
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="c"
/db_xref="dbSNP:74692094"
exon 1454..1792
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 1540
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:4135379"
variation 1660
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/db_xref="dbSNP:141678313"
variation 1724
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:113411271"
variation 1784
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:3856748"
exon 1793..1951
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 1831
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:370135014"
variation 1921
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:138539284"
variation 1925
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:199593411"
variation 1932
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:186068630"
STS 1949..2084
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/standard_name="GDB:435507"
/db_xref="UniSTS:157235"
exon 1952..2071
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
STS 2042..2135
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/standard_name="PMC21165P1"
/db_xref="UniSTS:272017"
exon 2072..2222
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 2098
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:374923885"
variation 2195
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:141493100"
exon 2223..2344
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 2250..2251
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="a"
/db_xref="dbSNP:35523547"
variation 2251
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800663"
variation 2263
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="c"
/db_xref="dbSNP:77750814"
variation 2269
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:374853593"
variation 2293
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:201061014"
variation 2330
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:4135384"
exon 2345..2405
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 2353
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:199856558"
variation 2397
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:200308943"
exon 2406..2626
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 2443
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:191410018"
variation 2467
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:148654224"
variation 2494
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:201583088"
variation 2523
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/db_xref="dbSNP:373158451"
variation 2533
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="t"
/db_xref="dbSNP:200991012"
variation 2571
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:377050808"
variation 2583
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:138501547"
variation 2588
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:4135386"
variation 2608
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:2293303"
exon 2627..3256
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/inference="alignment:Splign:1.39.8"
variation 2629
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:371800780"
variation 2641
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:375050845"
variation 2705
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="g"
/replace="t"
/db_xref="dbSNP:2953"
variation 2726..2727
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="a"
/db_xref="dbSNP:150512515"
variation 2729..2730
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="t"
/db_xref="dbSNP:34653633"
variation 2730
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="t"
/db_xref="dbSNP:4135387"
variation 2794
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:201175238"
variation 2795..2798
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="tttt"
/replace="tttttt"
/db_xref="dbSNP:34534133"
variation 2795..2796
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:71961438"
variation 2884..2885
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="taat"
/db_xref="dbSNP:376566844"
variation 2894
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:11708064"
variation 2917..2918
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="taat"
/db_xref="dbSNP:16339"
variation 2918..2919
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="aatt"
/replace="taat"
/db_xref="dbSNP:71623294"
variation 2921..2922
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="taat"
/db_xref="dbSNP:3834205"
variation 2923..2924
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="aatt"
/db_xref="dbSNP:71727399"
variation 2923
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="c"
/db_xref="dbSNP:202194019"
variation 2934..2937
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace=""
/replace="taat"
/db_xref="dbSNP:72273140"
STS 3000..3208
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/standard_name="EST12H1"
/db_xref="UniSTS:263086"
variation 3003
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:145906085"
variation 3007
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:1798792"
variation 3047
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="g"
/replace="t"
/db_xref="dbSNP:1722851"
variation 3055
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="g"
/replace="t"
/db_xref="dbSNP:148378295"
variation 3112
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="a"
/replace="g"
/db_xref="dbSNP:1058355"
variation 3190
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:116035162"
variation 3191
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="g"
/db_xref="dbSNP:141130241"
variation 3251
/gene="CTNNB1"
/gene_synonym="armadillo; CTNNB; MRD19"
/replace="c"
/replace="t"
/db_xref="dbSNP:150729932"
ORIGIN
aggatacagcggcttctgcgcgacttataagagctccttgtgcggcgccattttaagcctctcggtctgtggcagcagcgttggcccggccccgggagcggagagcgaggggaggcggagacggaggaaggtctgaggagcagcttcagtccccgccgagccgccaccgcaggtcgaggacggtcggactcccgcggcgggaggagcctgttcccctgagggtatttgaagtataccatacaactgttttgaaaatccagcgtggacaatggctactcaagctgatttgatggagttggacatggccatggaaccagacagaaaagcggctgttagtcactggcagcaacagtcttacctggactctggaatccattctggtgccactaccacagctccttctctgagtggtaaaggcaatcctgaggaagaggatgtggatacctcccaagtcctgtatgagtgggaacagggattttctcagtccttcactcaagaacaagtagctgatattgatggacagtatgcaatgactcgagctcagagggtacgagctgctatgttccctgagacattagatgagggcatgcagatcccatctacacagtttgatgctgctcatcccactaatgtccagcgtttggctgaaccatcacagatgctgaaacatgcagttgtaaacttgattaactatcaagatgatgcagaacttgccacacgtgcaatccctgaactgacaaaactgctaaatgacgaggaccaggtggtggttaataaggctgcagttatggtccatcagctttctaaaaaggaagcttccagacacgctatcatgcgttctcctcagatggtgtctgctattgtacgtaccatgcagaatacaaatgatgtagaaacagctcgttgtaccgctgggaccttgcataacctttcccatcatcgtgagggcttactggccatctttaagtctggaggcattcctgccctggtgaaaatgcttggttcaccagtggattctgtgttgttttatgccattacaactctccacaaccttttattacatcaagaaggagctaaaatggcagtgcgtttagctggtgggctgcagaaaatggttgccttgctcaacaaaacaaatgttaaattcttggctattacgacagactgccttcaaattttagcttatggcaaccaagaaagcaagctcatcatactggctagtggtggaccccaagctttagtaaatataatgaggacctatacttacgaaaaactactgtggaccacaagcagagtgctgaaggtgctatctgtctgctctagtaataagccggctattgtagaagctggtggaatgcaagctttaggacttcacctgacagatccaagtcaacgtcttgttcagaactgtctttggactctcaggaatctttcagatgctgcaactaaacaggaagggatggaaggtctccttgggactcttgttcagcttctgggttcagatgatataaatgtggtcacctgtgcagctggaattctttctaacctcacttgcaataattataagaacaagatgatggtctgccaagtgggtggtatagaggctcttgtgcgtactgtccttcgggctggtgacagggaagacatcactgagcctgccatctgtgctcttcgtcatctgaccagccgacaccaagaagcagagatggcccagaatgcagttcgccttcactatggactaccagttgtggttaagctcttacacccaccatcccactggcctctgataaaggctactgttggattgattcgaaatcttgccctttgtcccgcaaatcatgcacctttgcgtgagcagggtgccattccacgactagttcagttgcttgttcgtgcacatcaggatacccagcgccgtacgtccatgggtgggacacagcagcaatttgtggagggggtccgcatggaagaaatagttgaaggttgtaccggagcccttcacatcctagctcgggatgttcacaaccgaattgttatcagaggactaaataccattccattgtttgtgcagctgctttattctcccattgaaaacatccaaagagtagctgcaggggtcctctgtgaacttgctcaggacaaggaagctgcagaagctattgaagctgagggagccacagctcctctgacagagttacttcactctaggaatgaaggtgtggcgacatatgcagctgctgttttgttccgaatgtctgaggacaagccacaagattacaagaaacggctttcagttgagctgaccagctctctcttcagaacagagccaatggcttggaatgagactgctgatcttggacttgatattggtgcccagggagaaccccttggatatcgccaggatgatcctagctatcgttcttttcactctggtggatatggccaggatgccttgggtatggaccccatgatggaacatgagatgggtggccaccaccctggtgctgactatccagttgatgggctgccagatctggggcatgcccaggacctcatggatgggctgcctccaggtgacagcaatcagctggcctggtttgatactgacctgtaaatcatcctttaggagtaacaatacaaatggattttgggagtgactcaagaagtgaagaatgcacaagaatggatcacaagatggaatttatcaaaccctagccttgcttgttaaatttttttttttttttttttaagaatatctgtaatggtactgactttgcttgctttgaagtagctctttttttttttttttttttttttttgcagtaactgttttttaagtctctcgtagtgttaagttatagtgaatactgctacagcaatttctaatttttaagaattgagtaatggtgtagaacactaattcataatcactctaattaattgtaatctgaataaagtgtaacaattgtgtagcctttttgtataaaatagacaaatagaaaatggtccaattagtttcctttttaatatgcttaaaataagcaggtggatctatttcatgtttttgatcaaaaactatttgggatatgtatgggtagggtaaatcagtaagaggtgttatttggaaccttgttttggacagtttaccagttgccttttatcccaaagttgttgtaacctgctgtgatacgatgcttcaagagaaaatgcggttataaaaaatggttcagaattaaacttttaattcattcgattg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1499 -> Molecular function: GO:0001102 [RNA polymerase II activating transcription factor binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA
GeneID:1499 -> Molecular function: GO:0003690 [double-stranded DNA binding] evidence: IEA
GeneID:1499 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
GeneID:1499 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: IDA
GeneID:1499 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: IMP
GeneID:1499 -> Molecular function: GO:0004871 [signal transducer activity] evidence: NAS
GeneID:1499 -> Molecular function: GO:0005198 [structural molecule activity] evidence: IBA
GeneID:1499 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0008022 [protein C-terminus binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0008134 [transcription factor binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0008134 [transcription factor binding] evidence: TAS
GeneID:1499 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0019900 [kinase binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IBA
GeneID:1499 -> Molecular function: GO:0019903 [protein phosphatase binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0030331 [estrogen receptor binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0032403 [protein complex binding] evidence: IEA
GeneID:1499 -> Molecular function: GO:0035255 [ionotropic glutamate receptor binding] evidence: IEA
GeneID:1499 -> Molecular function: GO:0035257 [nuclear hormone receptor binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0035257 [nuclear hormone receptor binding] evidence: TAS
GeneID:1499 -> Molecular function: GO:0044212 [transcription regulatory region DNA binding] evidence: IDA
GeneID:1499 -> Molecular function: GO:0044325 [ion channel binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0045294 [alpha-catenin binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0045296 [cadherin binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0046332 [SMAD binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0050681 [androgen receptor binding] evidence: NAS
GeneID:1499 -> Molecular function: GO:0070411 [I-SMAD binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0070412 [R-SMAD binding] evidence: IPI
GeneID:1499 -> Molecular function: GO:0070491 [repressing transcription factor binding] evidence: IEA
GeneID:1499 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IBA
GeneID:1499 -> Biological process: GO:0000578 [embryonic axis specification] evidence: IBA
GeneID:1499 -> Biological process: GO:0001569 [patterning of blood vessels] evidence: IBA
GeneID:1499 -> Biological process: GO:0001569 [patterning of blood vessels] evidence: IC
GeneID:1499 -> Biological process: GO:0001658 [branching involved in ureteric bud morphogenesis] evidence: IBA
GeneID:1499 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
GeneID:1499 -> Biological process: GO:0001702 [gastrulation with mouth forming second] evidence: IBA
GeneID:1499 -> Biological process: GO:0001708 [cell fate specification] evidence: IEA
GeneID:1499 -> Biological process: GO:0001711 [endodermal cell fate commitment] evidence: IBA
GeneID:1499 -> Biological process: GO:0001764 [neuron migration] evidence: IEA
GeneID:1499 -> Biological process: GO:0001837 [epithelial to mesenchymal transition] evidence: TAS
GeneID:1499 -> Biological process: GO:0001840 [neural plate development] evidence: IEA
GeneID:1499 -> Biological process: GO:0001889 [liver development] evidence: IBA
GeneID:1499 -> Biological process: GO:0002052 [positive regulation of neuroblast proliferation] evidence: IEA
GeneID:1499 -> Biological process: GO:0002053 [positive regulation of mesenchymal cell proliferation] evidence: IEA
GeneID:1499 -> Biological process: GO:0002089 [lens morphogenesis in camera-type eye] evidence: IEA
GeneID:1499 -> Biological process: GO:0003136 [negative regulation of heart induction by canonical Wnt receptor signaling pathway] evidence: IBA
GeneID:1499 -> Biological process: GO:0003266 [regulation of secondary heart field cardioblast proliferation] evidence: IEA
GeneID:1499 -> Biological process: GO:0003337 [mesenchymal to epithelial transition involved in metanephros morphogenesis] evidence: IBA
GeneID:1499 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:1499 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:1499 -> Biological process: GO:0006921 [cellular component disassembly involved in execution phase of apoptosis] evidence: TAS
GeneID:1499 -> Biological process: GO:0007016 [cytoskeletal anchoring at plasma membrane] evidence: IBA
GeneID:1499 -> Biological process: GO:0007155 [cell adhesion] evidence: IMP
GeneID:1499 -> Biological process: GO:0007160 [cell-matrix adhesion] evidence: IBA
GeneID:1499 -> Biological process: GO:0007398 [ectoderm development] evidence: IBA
GeneID:1499 -> Biological process: GO:0007403 [glial cell fate determination] evidence: IBA
GeneID:1499 -> Biological process: GO:0007494 [midgut development] evidence: IEA
GeneID:1499 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IDA
GeneID:1499 -> Biological process: GO:0009948 [anterior/posterior axis specification] evidence: IEA
GeneID:1499 -> Biological process: GO:0009950 [dorsal/ventral axis specification] evidence: IBA
GeneID:1499 -> Biological process: GO:0009954 [proximal/distal pattern formation] evidence: IBA
GeneID:1499 -> Biological process: GO:0010909 [positive regulation of heparan sulfate proteoglycan biosynthetic process] evidence: IMP
GeneID:1499 -> Biological process: GO:0014010 [Schwann cell proliferation] evidence: IBA
GeneID:1499 -> Biological process: GO:0016055 [Wnt receptor signaling pathway] evidence: IDA
GeneID:1499 -> Biological process: GO:0016337 [cell-cell adhesion] evidence: IMP
GeneID:1499 -> Biological process: GO:0022009 [central nervous system vasculogenesis] evidence: IBA
GeneID:1499 -> Biological process: GO:0030316 [osteoclast differentiation] evidence: IEA
GeneID:1499 -> Biological process: GO:0030326 [embryonic limb morphogenesis] evidence: IBA
GeneID:1499 -> Biological process: GO:0030521 [androgen receptor signaling pathway] evidence: NAS
GeneID:1499 -> Biological process: GO:0030539 [male genitalia development] evidence: IBA
GeneID:1499 -> Biological process: GO:0030900 [forebrain development] evidence: IEA
GeneID:1499 -> Biological process: GO:0030902 [hindbrain development] evidence: IBA
GeneID:1499 -> Biological process: GO:0030997 [regulation of centriole-centriole cohesion] evidence: IDA
GeneID:1499 -> Biological process: GO:0031016 [pancreas development] evidence: IBA
GeneID:1499 -> Biological process: GO:0031069 [hair follicle morphogenesis] evidence: IBA
GeneID:1499 -> Biological process: GO:0031641 [regulation of myelination] evidence: IEA
GeneID:1499 -> Biological process: GO:0032331 [negative regulation of chondrocyte differentiation] evidence: IBA
GeneID:1499 -> Biological process: GO:0032355 [response to estradiol stimulus] evidence: IDA
GeneID:1499 -> Biological process: GO:0032481 [positive regulation of type I interferon production] evidence: TAS
GeneID:1499 -> Biological process: GO:0033077 [T cell differentiation in thymus] evidence: IBA
GeneID:1499 -> Biological process: GO:0033234 [negative regulation of protein sumoylation] evidence: IDA
GeneID:1499 -> Biological process: GO:0034097 [response to cytokine stimulus] evidence: IEA
GeneID:1499 -> Biological process: GO:0034333 [adherens junction assembly] evidence: IMP
GeneID:1499 -> Biological process: GO:0034394 [protein localization to cell surface] evidence: IMP
GeneID:1499 -> Biological process: GO:0035050 [embryonic heart tube development] evidence: IEA
GeneID:1499 -> Biological process: GO:0035112 [genitalia morphogenesis] evidence: IEA
GeneID:1499 -> Biological process: GO:0035115 [embryonic forelimb morphogenesis] evidence: IEA
GeneID:1499 -> Biological process: GO:0035116 [embryonic hindlimb morphogenesis] evidence: IEA
GeneID:1499 -> Biological process: GO:0035315 [hair cell differentiation] evidence: TAS
GeneID:1499 -> Biological process: GO:0036023 [embryonic skeletal limb joint morphogenesis] evidence: ISS
GeneID:1499 -> Biological process: GO:0042129 [regulation of T cell proliferation] evidence: IBA
GeneID:1499 -> Biological process: GO:0042475 [odontogenesis of dentin-containing tooth] evidence: IBA
GeneID:1499 -> Biological process: GO:0042493 [response to drug] evidence: IEP
GeneID:1499 -> Biological process: GO:0042692 [muscle cell differentiation] evidence: TAS
GeneID:1499 -> Biological process: GO:0042733 [embryonic digit morphogenesis] evidence: IEA
GeneID:1499 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IDA
GeneID:1499 -> Biological process: GO:0043123 [positive regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IBA
GeneID:1499 -> Biological process: GO:0043410 [positive regulation of MAPK cascade] evidence: IBA
GeneID:1499 -> Biological process: GO:0043587 [tongue morphogenesis] evidence: IBA
GeneID:1499 -> Biological process: GO:0044334 [canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition] evidence: IMP
GeneID:1499 -> Biological process: GO:0044336 [canonical Wnt receptor signaling pathway involved in negative regulation of apoptotic process] evidence: IMP
GeneID:1499 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
GeneID:1499 -> Biological process: GO:0045445 [myoblast differentiation] evidence: IEA
GeneID:1499 -> Biological process: GO:0045453 [bone resorption] evidence: IEA
GeneID:1499 -> Biological process: GO:0045603 [positive regulation of endothelial cell differentiation] evidence: IEA
GeneID:1499 -> Biological process: GO:0045669 [positive regulation of osteoblast differentiation] evidence: IBA
GeneID:1499 -> Biological process: GO:0045671 [negative regulation of osteoclast differentiation] evidence: IBA
GeneID:1499 -> Biological process: GO:0045743 [positive regulation of fibroblast growth factor receptor signaling pathway] evidence: IBA
GeneID:1499 -> Biological process: GO:0045765 [regulation of angiogenesis] evidence: TAS
GeneID:1499 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IMP
GeneID:1499 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IDA
GeneID:1499 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IMP
GeneID:1499 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
GeneID:1499 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IMP
GeneID:1499 -> Biological process: GO:0046686 [response to cadmium ion] evidence: IEA
GeneID:1499 -> Biological process: GO:0048145 [regulation of fibroblast proliferation] evidence: TAS
GeneID:1499 -> Biological process: GO:0048262 [determination of dorsal/ventral asymmetry] evidence: IBA
GeneID:1499 -> Biological process: GO:0048469 [cell maturation] evidence: IEA
GeneID:1499 -> Biological process: GO:0048489 [synaptic vesicle transport] evidence: IBA
GeneID:1499 -> Biological process: GO:0048538 [thymus development] evidence: IBA
GeneID:1499 -> Biological process: GO:0048599 [oocyte development] evidence: IBA
GeneID:1499 -> Biological process: GO:0048617 [embryonic foregut morphogenesis] evidence: IBA
GeneID:1499 -> Biological process: GO:0048660 [regulation of smooth muscle cell proliferation] evidence: IMP
GeneID:1499 -> Biological process: GO:0048715 [negative regulation of oligodendrocyte differentiation] evidence: IEA
GeneID:1499 -> Biological process: GO:0050808 [synapse organization] evidence: IBA
GeneID:1499 -> Biological process: GO:0051145 [smooth muscle cell differentiation] evidence: IBA
GeneID:1499 -> Biological process: GO:0051149 [positive regulation of muscle cell differentiation] evidence: TAS
GeneID:1499 -> Biological process: GO:0051291 [protein heterooligomerization] evidence: IEA
GeneID:1499 -> Biological process: GO:0060066 [oviduct development] evidence: IEA
GeneID:1499 -> Biological process: GO:0060070 [canonical Wnt receptor signaling pathway] evidence: IDA
GeneID:1499 -> Biological process: GO:0060440 [trachea formation] evidence: IBA
GeneID:1499 -> Biological process: GO:0060441 [epithelial tube branching involved in lung morphogenesis] evidence: IEA
GeneID:1499 -> Biological process: GO:0060479 [lung cell differentiation] evidence: IBA
GeneID:1499 -> Biological process: GO:0060484 [lung-associated mesenchyme development] evidence: IBA
GeneID:1499 -> Biological process: GO:0060492 [lung induction] evidence: IBA
GeneID:1499 -> Biological process: GO:0060742 [epithelial cell differentiation involved in prostate gland development] evidence: IEA
GeneID:1499 -> Biological process: GO:0060769 [positive regulation of epithelial cell proliferation involved in prostate gland development] evidence: IBA
GeneID:1499 -> Biological process: GO:0060789 [hair follicle placode formation] evidence: IBA
GeneID:1499 -> Biological process: GO:0060916 [mesenchymal cell proliferation involved in lung development] evidence: IBA
GeneID:1499 -> Biological process: GO:0061047 [positive regulation of branching involved in lung morphogenesis] evidence: IBA
GeneID:1499 -> Biological process: GO:0061154 [endothelial tube morphogenesis] evidence: IMP
GeneID:1499 -> Biological process: GO:0061198 [fungiform papilla formation] evidence: IEA
GeneID:1499 -> Biological process: GO:0061324 [canonical Wnt receptor signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation] evidence: ISS
GeneID:1499 -> Biological process: GO:0070602 [regulation of centromeric sister chromatid cohesion] evidence: IMP
GeneID:1499 -> Biological process: GO:0071363 [cellular response to growth factor stimulus] evidence: IMP
GeneID:1499 -> Biological process: GO:0071681 [cellular response to indole-3-methanol] evidence: IDA
GeneID:1499 -> Biological process: GO:0072033 [renal vesicle formation] evidence: IBA
GeneID:1499 -> Biological process: GO:0072053 [renal inner medulla development] evidence: IBA
GeneID:1499 -> Biological process: GO:0072054 [renal outer medulla development] evidence: IBA
GeneID:1499 -> Biological process: GO:0072079 [nephron tubule formation] evidence: IBA
GeneID:1499 -> Biological process: GO:0072182 [regulation of nephron tubule epithelial cell differentiation] evidence: ISS
GeneID:1499 -> Biological process: GO:0090279 [regulation of calcium ion import] evidence: IDA
GeneID:1499 -> Biological process: GO:2000008 [regulation of protein localization to cell surface] evidence: IDA
GeneID:1499 -> Biological process: GO:2000017 [positive regulation of determination of dorsal identity] evidence: IEA
GeneID:1499 -> Cellular component: GO:0000922 [spindle pole] evidence: IEA
GeneID:1499 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:1499 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:1499 -> Cellular component: GO:0005667 [transcription factor complex] evidence: IDA
GeneID:1499 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:1499 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
GeneID:1499 -> Cellular component: GO:0005829 [cytosol] evidence: IDA
GeneID:1499 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:1499 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:1499 -> Cellular component: GO:0005911 [cell-cell junction] evidence: IDA
GeneID:1499 -> Cellular component: GO:0005912 [adherens junction] evidence: IDA
GeneID:1499 -> Cellular component: GO:0005913 [cell-cell adherens junction] evidence: IDA
GeneID:1499 -> Cellular component: GO:0005915 [zonula adherens] evidence: IBA
GeneID:1499 -> Cellular component: GO:0005916 [fascia adherens] evidence: IBA
GeneID:1499 -> Cellular component: GO:0005924 [cell-substrate adherens junction] evidence: IDA
GeneID:1499 -> Cellular component: GO:0005938 [cell cortex] evidence: IDA
GeneID:1499 -> Cellular component: GO:0009898 [internal side of plasma membrane] evidence: IBA
GeneID:1499 -> Cellular component: GO:0016020 [membrane] evidence: ISS
GeneID:1499 -> Cellular component: GO:0016323 [basolateral plasma membrane] evidence: IEA
GeneID:1499 -> Cellular component: GO:0016328 [lateral plasma membrane] evidence: IDA
GeneID:1499 -> Cellular component: GO:0016342 [catenin complex] evidence: IDA
GeneID:1499 -> Cellular component: GO:0030018 [Z disc] evidence: IBA
GeneID:1499 -> Cellular component: GO:0030027 [lamellipodium] evidence: IBA
GeneID:1499 -> Cellular component: GO:0030054 [cell junction] evidence: IDA
GeneID:1499 -> Cellular component: GO:0030054 [cell junction] evidence: TAS
GeneID:1499 -> Cellular component: GO:0030057 [desmosome] evidence: IBA
GeneID:1499 -> Cellular component: GO:0030877 [beta-catenin destruction complex] evidence: IDA
GeneID:1499 -> Cellular component: GO:0031528 [microvillus membrane] evidence: IBA
GeneID:1499 -> Cellular component: GO:0032993 [protein-DNA complex] evidence: IDA
GeneID:1499 -> Cellular component: GO:0034750 [Scrib-APC-beta-catenin complex] evidence: IEA
GeneID:1499 -> Cellular component: GO:0043198 [dendritic shaft] evidence: IBA
GeneID:1499 -> Cellular component: GO:0045177 [apical part of cell] evidence: IEA
GeneID:1499 -> Cellular component: GO:0045202 [synapse] evidence: IBA
GeneID:1499 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IDA
GeneID:1499 -> Cellular component: GO:0070369 [beta-catenin-TCF7L2 complex] evidence: IDA
GeneID:1499 -> Cellular component: GO:0071944 [cell periphery] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.