GGRNA Home | Help | Advanced search

2020-10-26 19:06:06, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001093730            2051 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens dystrotelin (DYTN), mRNA.
ACCESSION   NM_001093730
VERSION     NM_001093730.1  GI:157364925
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2051)
  AUTHORS   Jin,H., Tan,S., Hermanowski,J., Bohm,S., Pacheco,S., McCauley,J.M.,
            Greener,M.J., Hinits,Y., Hughes,S.M., Sharpe,P.T. and Roberts,R.G.
  TITLE     The dystrotelin, dystrophin and dystrobrevin superfamily: new
            paralogues and old isoforms
  JOURNAL   BMC Genomics 8, 19 (2007)
   PUBMED   17233888
  REMARK    Publication Status: Online-Only
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from DQ516347.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DQ516347.1 [ECO:0000332]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2051
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q33.3"
     gene            1..2051
                     /gene="DYTN"
                     /note="dystrotelin"
                     /db_xref="GeneID:391475"
                     /db_xref="HGNC:23279"
     exon            1..136
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(35)
                     /gene="DYTN"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:373787138"
     variation       complement(47)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375554872"
     misc_feature    70..72
                     /gene="DYTN"
                     /note="upstream in-frame stop codon"
     variation       complement(84)
                     /gene="DYTN"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370099249"
     CDS             118..1854
                     /gene="DYTN"
                     /codon_start=1
                     /product="dystrotelin"
                     /protein_id="NP_001087199.1"
                     /db_xref="GI:157364926"
                     /db_xref="CCDS:CCDS46502.1"
                     /db_xref="GeneID:391475"
                     /db_xref="HGNC:23279"
                     /translation="
MDPDKQDALNSIENSIYRTAFKLQSVQTLCQLDLIDSSLIQQVLLRPSFWEARKHSLSVQQLSQALQELFQKAREENPGQVHPRAPELTLSLLTTMYNSKGTGFLQLMPAAAALITLSGDSPLSKYRALFQLYAENSRGGYDSGPRMTRRVLRKLLTDLQQIPTFVGESRALCPVESATRSCFQGVLSPAIKEEKFLSWVQSEPPILLWLPTCHRLSAAERVTHPARCTLCRTFPITGLRYRCLKCLNFDICQMCFLSGLHSKSHQKSHPVIEHCIQMSAMQNTKLLFRTLRNNLLQGRCRKKEAARRQQLLDQVNPKGVPHHAQARLLKKQLNQYKDKLQAIYTSQEERICRFETRIHKLKTNQDSLWTKLQQIRRDLQARLQPPGPSSSSFQNVGNKVDHSSTEKVPKGGDYLQIKNATEDASTGEPLPKLDEVDRSHRSHTNAEHALRNPESPETTLHSTRAQSQTQKMPQKVISALPSYQEGLKQDIPKMVPAEMSSPALAAVEKKEAGNIKERKDELEEEELQELLSKLMDAFNLETPSGPESSVNMDLYSGAQRVCRAFSALVDQIALPNLK
"
     misc_feature    142..471
                     /gene="DYTN"
                     /note="EF hand; Region: efhand_1; pfam09068"
                     /db_xref="CDD:149945"
     misc_feature    490..768
                     /gene="DYTN"
                     /note="EF-hand; Region: efhand_2; pfam09069"
                     /db_xref="CDD:149946"
     misc_feature    793..939
                     /gene="DYTN"
                     /note="Zinc finger, ZZ type. Zinc finger present in
                     dystrophin and dystrobrevin. The ZZ motif coordinates two
                     zinc ions and most likely participates in ligand binding
                     or molecular scaffolding. Dystrophin attaches actin
                     filaments to an integral membrane...; Region:
                     ZZ_dystrophin; cd02334"
                     /db_xref="CDD:30238"
     misc_feature    order(799..801,808..810,844..846,853..855,871..873,
                     880..882,910..912,922..924)
                     /gene="DYTN"
                     /note="Zinc-binding sites [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(799..801,808..810,871..873,880..882)
                     /gene="DYTN"
                     /note="zinc cluster 1 [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(802..804,835..837,841..843,859..861,865..867)
                     /gene="DYTN"
                     /note="putative charged binding surface; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(838..840,883..885,928..930,937..939)
                     /gene="DYTN"
                     /note="putative hydrophobic binding surface; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(844..846,853..855,910..912,922..924)
                     /gene="DYTN"
                     /note="zinc cluster 2 [ion binding]; other site"
                     /db_xref="CDD:30238"
     exon            137..211
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(148)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372992603"
     variation       complement(193)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145763126"
     variation       complement(209)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376875747"
     exon            212..413
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(244)
                     /gene="DYTN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376672997"
     variation       complement(253)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144139666"
     variation       complement(254)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369410820"
     variation       complement(275)
                     /gene="DYTN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201346934"
     variation       complement(306)
                     /gene="DYTN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:67248530"
     variation       complement(321)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78679916"
     variation       complement(362)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368526887"
     variation       complement(374)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184242013"
     variation       complement(384)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374496658"
     variation       complement(388)
                     /gene="DYTN"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372880670"
     variation       complement(390)
                     /gene="DYTN"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201983397"
     exon            414..499
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(430)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375852360"
     variation       complement(446)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200127309"
     variation       complement(451)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201045711"
     variation       complement(457)
                     /gene="DYTN"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201993785"
     variation       complement(459)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199991903"
     variation       complement(482)
                     /gene="DYTN"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:56067462"
     variation       complement(496)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200713304"
     exon            500..600
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(527)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200720001"
     variation       complement(544)
                     /gene="DYTN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:116768218"
     variation       complement(554)
                     /gene="DYTN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376587365"
     variation       complement(555)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146519194"
     variation       complement(562)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372283021"
     variation       complement(563)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368477015"
     variation       complement(568)
                     /gene="DYTN"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201301748"
     variation       complement(582)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371211980"
     variation       complement(587)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114675847"
     exon            601..672
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(612)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370984067"
     variation       complement(626)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141321104"
     variation       complement(641)
                     /gene="DYTN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113838785"
     variation       complement(650)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199745795"
     variation       complement(652)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201657349"
     variation       complement(653)
                     /gene="DYTN"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372828749"
     variation       complement(655)
                     /gene="DYTN"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200369556"
     exon            673..836
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(714)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372309495"
     variation       complement(725)
                     /gene="DYTN"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:112735024"
     variation       complement(741)
                     /gene="DYTN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:116493063"
     variation       complement(749)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200283597"
     variation       complement(750)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113447424"
     variation       complement(771)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374016300"
     variation       complement(790)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370880332"
     variation       complement(796)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202213345"
     variation       complement(797)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200422382"
     exon            837..948
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(839)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16838593"
     variation       complement(842)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183705947"
     variation       complement(855)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201422671"
     variation       complement(864)
                     /gene="DYTN"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369466188"
     variation       complement(893)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376294616"
     variation       complement(908)
                     /gene="DYTN"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373406102"
     variation       complement(918)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369987895"
     variation       complement(925)
                     /gene="DYTN"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200782718"
     exon            949..1097
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(976)
                     /gene="DYTN"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375843014"
     variation       complement(977)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201166130"
     variation       complement(987)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182085591"
     variation       complement(999)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200592657"
     variation       complement(1031)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114709725"
     variation       complement(1035)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200794203"
     variation       complement(1041)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60722121"
     variation       complement(1043)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201676491"
     variation       complement(1053)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368704058"
     variation       complement(1056)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199695763"
     variation       complement(1057)
                     /gene="DYTN"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374635947"
     variation       complement(1086)
                     /gene="DYTN"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370297106"
     variation       complement(1088)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376262781"
     variation       complement(1089)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150696195"
     exon            1098..1257
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1100)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377442544"
     variation       complement(1101)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200245926"
     variation       complement(1126)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369087472"
     variation       complement(1156)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180718219"
     variation       complement(1174)
                     /gene="DYTN"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139354756"
     variation       complement(1182)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375063110"
     variation       complement(1227)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188179011"
     variation       complement(1235)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201745628"
     variation       complement(1246)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372031421"
     variation       complement(1247)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369023527"
     variation       complement(1256)
                     /gene="DYTN"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376857940"
     variation       complement(1257)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372265464"
     exon            1258..1750
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1258)
                     /gene="DYTN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372401712"
     variation       complement(1270)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367667719"
     variation       complement(1307)
                     /gene="DYTN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373862091"
     variation       complement(1316)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370160378"
     variation       complement(1319)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367901418"
     variation       complement(1332)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374054060"
     variation       complement(1338)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143345015"
     variation       complement(1356)
                     /gene="DYTN"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376810245"
     variation       complement(1396)
                     /gene="DYTN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:184887506"
     variation       complement(1446)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371223903"
     variation       complement(1468)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377396036"
     variation       complement(1510)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373029999"
     variation       complement(1515)
                     /gene="DYTN"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4482460"
     variation       complement(1533)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368849506"
     variation       complement(1537)
                     /gene="DYTN"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2115591"
     variation       complement(1562)
                     /gene="DYTN"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:79969810"
     variation       complement(1717)
                     /gene="DYTN"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:13408906"
     variation       complement(1721)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201792178"
     variation       complement(1742)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200349172"
     variation       complement(1743)
                     /gene="DYTN"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372227236"
     exon            1751..2051
                     /gene="DYTN"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1772)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201045992"
     variation       complement(1807)
                     /gene="DYTN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201639314"
     variation       complement(1835)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373954592"
     variation       complement(1840)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373373737"
     variation       complement(1868)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200081961"
     variation       complement(1875)
                     /gene="DYTN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368435160"
     variation       complement(1878)
                     /gene="DYTN"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374419183"
     variation       complement(2003)
                     /gene="DYTN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369834015"
ORIGIN      
ttgcctttttgttcccctgtcctcattcctctgctgcaaaaccttctgcttaaaatactggttcatttctagttacagggacccacttgccatctgtcattccaggaaatttgtgaaatggatccagataaacaagatgctcttaatagtattgagaattccatttatagaacagccttcaaattacaatcagtgcaaactctgtgccagttggacttgattgacagctccctgattcagcaggtcctactgcgtccaagtttctgggaagctcgcaagcactccctttctgtgcagcaactttctcaggcactccaagagctgtttcagaaggccagggaggaaaacccaggacaagtgcatcccagagctccggaactcactctgagccttctcacgacaatgtacaacagcaaaggaacaggttttctccagcttatgcctgcggccgctgccctaataaccctctcaggagacagccctctttcaaaataccgagctctttttcaactctatgcagaaaatagcaggggaggctatgattctgggccacgcatgactcgaagggttttgagaaaactactaacagatctacagcagatcccaactttcgtgggagagagtcgtgctctgtgccctgtggaaagtgccacccgcagctgtttccaaggggtgttgagcccagcaatcaaagaagaaaaattcctgtcttgggtccaatctgagcctcccatcctcctgtggctcccgacctgccaccggttatcagctgctgaaagggtcactcaccctgctcggtgcactctctgcaggactttcccaatcacgggactcagataccgctgtctgaagtgtctcaactttgacatctgccagatgtgtttcttatctggtcttcacagcaagtcccatcagaagtctcatcctgtcattgagcactgcattcagatgtcagcaatgcagaatacaaaacttctcttcaggaccctcagaaacaaccttcttcaggggcgctgtaggaagaaagaagcagcgagaaggcagcagctgctggaccaggtgaatccaaagggtgtgcctcaccatgcgcaggccaggctccttaaaaaacagttaaaccaatacaaagacaagttgcaagctatatacacctcccaggaagaaagaatttgtcgatttgaaacaaggattcacaaactcaaaaccaaccaggatagtctatggaccaagctacaacagataagacgggacctacaggcaaggttgcagccacccggtccttcatcttcttcctttcaaaatgtggggaacaaggttgaccattcttcaactgaaaaggttccaaagggaggggattatttgcagatcaagaatgccactgaagatgcttcaacaggggaacctcttcctaagcttgatgaggttgacagaagtcacagaagtcacacaaatgcagagcatgctctgcgaaatccagaatcaccagagaccactttgcacagcaccagggcacaaagccaaacacaaaagatgccacagaaagtcattagtgccctacccagttatcaggagggactgaagcaggacatccccaaaatggttcctgctgaaatgagcagtcctgctctggcagccgtggaaaagaaagaggcaggtaacatcaaggagagaaaggatgagctggaggaagaggaactgcaagaactattgtcaaaacttatggatgccttcaatctagaaacgccatcaggcccggagtcttcagtaaacatggacctgtacagtggagctcagcgagtgtgcagggccttctctgcccttgttgatcaaattgccttgcccaatttgaagtgaaatggagtccaggctcaaaggcctcttggtgtgatgacaaaatgcagttgcacaactgtattaaaagaattaagacttctacctttcttttaatagtttagtgtgaactatgaagaaaacaggttttgttttttgatctccctccctacttatgtatcttagttctgcagttcagagtgaaggttgggggttagcag
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:391475 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:391475 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:391475 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.