Home |
Help |
Advanced search
2024-04-20 01:07:07, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001081 11933 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens cubilin (intrinsic factor-cobalamin receptor) (CUBN),
mRNA.
ACCESSION NM_001081
VERSION NM_001081.3 GI:126091151
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 11933)
AUTHORS Prabakaran,T., Christensen,E.I., Nielsen,R. and Verroust,P.J.
TITLE Cubilin is expressed in rat and human glomerular podocytes
JOURNAL Nephrol. Dial. Transplant. 27 (8), 3156-3159 (2012)
PUBMED 22337902
REMARK GeneRIF: used immunocytochemistry and reverse
transcription-polymerase chain reaction on laser-captured glomeruli
to demonstrate synthesis and expression of cubilin in glomerular
podocytes
REFERENCE 2 (bases 1 to 11933)
AUTHORS Schreiber,A., Theilig,F., Schweda,F. and Hocherl,K.
TITLE Acute endotoxemia in mice induces downregulation of megalin and
cubilin in the kidney
JOURNAL Kidney Int. 82 (1), 53-59 (2012)
PUBMED 22437417
REMARK GeneRIF: Expression of megalin and cubilin is decreased during
experimental endotoxemia, which may contribute to an increase in
urine levels of albumin during acute renal failure.
REFERENCE 3 (bases 1 to 11933)
AUTHORS Tanner,S.M., Sturm,A.C., Baack,E.C., Liyanarachchi,S. and de la
Chapelle,A.
TITLE Inherited cobalamin malabsorption. Mutations in three genes reveal
functional and ethnic patterns
JOURNAL Orphanet J Rare Dis 7, 56 (2012)
PUBMED 22929189
REMARK GeneRIF: Our genetic screening of 154 families of patients with
inherited cobalamin malabsorption revealed population-specific
mutations, mutational hotspots, and functionally distinct regions
in the three causal genes: CUBN, AMN, and GIF.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 11933)
AUTHORS McLaren,C.E., McLachlan,S., Garner,C.P., Vulpe,C.D., Gordeuk,V.R.,
Eckfeldt,J.H., Adams,P.C., Acton,R.T., Murray,J.A.,
Leiendecker-Foster,C., Snively,B.M., Barcellos,L.F., Cook,J.D. and
McLaren,G.D.
TITLE Associations between single nucleotide polymorphisms in
iron-related genes and iron status in multiethnic populations
JOURNAL PLoS ONE 7 (6), E38339 (2012)
PUBMED 22761678
REMARK GeneRIF: Single nucleotide polymorphisms in cubilin gene is
associated with iron overload.
REFERENCE 5 (bases 1 to 11933)
AUTHORS Reznichenko A, Snieder H, van den Born J, de Borst MH, Damman J,
van Dijk MC, van Goor H, Hepkema BG, Hillebrands JL, Leuvenink HG,
Niesing J, Bakker SJ, Seelen M and Navis G.
CONSRTM REGaTTA (REnal GeneTics TrAnsplantation) Groningen group
TITLE CUBN as a novel locus for end-stage renal disease: insights from
renal transplantation
JOURNAL PLoS ONE 7 (5), E36512 (2012)
PUBMED 22574174
REMARK GeneRIF: CUBN rs7918972 as a novel risk variant for renal function
loss
REFERENCE 6 (bases 1 to 11933)
AUTHORS Batuman,V., Verroust,P.J., Navar,G.L., Kaysen,J.H., Goda,F.O.,
Campbell,W.C., Simon,E., Pontillon,F., Lyles,M., Bruno,J. and
Hammond,T.G.
TITLE Myeloma light chains are ligands for cubilin (gp280)
JOURNAL Am. J. Physiol. 275 (2 PT 2), F246-F254 (1998)
PUBMED 9691015
REFERENCE 7 (bases 1 to 11933)
AUTHORS Kozyraki,R., Kristiansen,M., Silahtaroglu,A., Hansen,C.,
Jacobsen,C., Tommerup,N., Verroust,P.J. and Moestrup,S.K.
TITLE The human intrinsic factor-vitamin B12 receptor, cubilin: molecular
characterization and chromosomal mapping of the gene to 10p within
the autosomal recessive megaloblastic anemia (MGA1) region
JOURNAL Blood 91 (10), 3593-3600 (1998)
PUBMED 9572993
REMARK Erratum:[Blood 1998 Oct 1;92(7):2608]
REFERENCE 8 (bases 1 to 11933)
AUTHORS Moestrup,S.K., Kozyraki,R., Kristiansen,M., Kaysen,J.H.,
Rasmussen,H.H., Brault,D., Pontillon,F., Goda,F.O.,
Christensen,E.I., Hammond,T.G. and Verroust,P.J.
TITLE The intrinsic factor-vitamin B12 receptor and target of teratogenic
antibodies is a megalin-binding peripheral membrane protein with
homology to developmental proteins
JOURNAL J. Biol. Chem. 273 (9), 5235-5242 (1998)
PUBMED 9478979
REFERENCE 9 (bases 1 to 11933)
AUTHORS Birn,H., Verroust,P.J., Nexo,E., Hager,H., Jacobsen,C.,
Christensen,E.I. and Moestrup,S.K.
TITLE Characterization of an epithelial approximately 460-kDa protein
that facilitates endocytosis of intrinsic factor-vitamin B12 and
binds receptor-associated protein
JOURNAL J. Biol. Chem. 272 (42), 26497-26504 (1997)
PUBMED 9334227
REFERENCE 10 (bases 1 to 11933)
AUTHORS Bork,P. and Beckmann,G.
TITLE The CUB domain. A widespread module in developmentally regulated
proteins
JOURNAL J. Mol. Biol. 231 (2), 539-545 (1993)
PUBMED 8510165
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BP271329.1, AF034611.1,
AC067747.7, BP270790.1, AL731551.9 and AL365215.23.
This sequence is a reference standard in the RefSeqGene project.
On Feb 23, 2007 this sequence version replaced gi:21536291.
Summary: Cubilin (CUBN) acts as a receptor for intrinsic
factor-vitamin B12 complexes. The role of receptor is supported by
the presence of 27 CUB domains. Cubulin is located within the
epithelium of intestine and kidney. Mutations in CUBN may play a
role in autosomal recessive megaloblastic anemia. [provided by
RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF034611.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-518 BP271329.1 1-518
519-809 AF034611.1 493-783
810-935 AC067747.7 59252-59377
936-1067 AC067747.7 62354-62485
1068-3573 AF034611.1 1042-3547
3574-3936 BP270790.1 220-582
3937-4684 AF034611.1 3911-4658
4685-4747 AL731551.9 57549-57611 c
4748-5356 AF034611.1 4722-5330
5357-5394 AL731551.9 22300-22337 c
5395-5907 AF034611.1 5369-5881
5908-5978 AL731551.9 12657-12727 c
5979-6536 AF034611.1 5953-6510
6537-6698 AL731551.9 306-467 c
6699-8201 AF034611.1 6673-8175
8202-8236 AL365215.23 169829-169863 c
8237-9894 AF034611.1 8211-9868
9895-10084 AL365215.23 108821-109010 c
10085-11193 AF034611.1 10059-11167
11194-11933 AL365215.23 92457-93196 c
FEATURES Location/Qualifiers
source 1..11933
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10p12.31"
gene 1..11933
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="cubilin (intrinsic factor-cobalamin receptor)"
/db_xref="GeneID:8029"
/db_xref="HGNC:2548"
/db_xref="MIM:602997"
exon 1..174
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
CDS 53..10924
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="cubilin precursor variant 1; cubilin precursor
variant 2; intrinsic factor-vitamin B12 receptor; 460 kDa
receptor; intestinal intrinsic factor receptor"
/codon_start=1
/product="cubilin precursor"
/protein_id="NP_001072.2"
/db_xref="GI:126091152"
/db_xref="CCDS:CCDS7113.1"
/db_xref="GeneID:8029"
/db_xref="HGNC:2548"
/db_xref="MIM:602997"
/translation="
MMNMSLPFLWSLLTLLIFAEVNGEAGELELQRQKRSINLQQPRMATERGNLVFLTGSAQNIEFRTGSLGKIKLNDEDLSECLHQIQKNKEDIIELKGSAIGLPQNISSQIYQLNSKLVDLERKFQGLQQTVDKKVCSSNPCQNGGTCLNLHDSFFCICPPQWKGPLCSADVNECEIYSGTPLSCQNGGTCVNTMGSYSCHCPPETYGPQCASKYDDCEGGSVARCVHGICEDLMREQAGEPKYSCVCDAGWMFSPNSPACTLDRDECSFQPGPCSTLVQCFNTQGSFYCGACPTGWQGNGYICEDINECEINNGGCSVAPPVECVNTPGSSHCQACPPGYQGDGRVCTLTDICSVSNGGCHPDASCSSTLGSLPLCTCLPGYTGNGYGPNGCVQLSNICLSHPCLNGQCIDTVSGYFCKCDSGWTGVNCTENINECLSNPCLNGGTCVDGVDSFSCECTRLWTGALCQVPQQVCGESLSGINGSFSYRSPDVGYVHDVNCFWVIKTEMGKVLRITFTFFRLESMDNCPHEFLQVYDGDSSSAFQLGRFCGSSLPHELLSSDNALYFHLYSEHLRNGRGFTVRWETQQPECGGILTGPYGSIKSPGYPGNYPPGRDCVWIVVTSPDLLVTFTFGTLSLEHHDDCNKDYLEIRDGPLYQDPLLGKFCTTFSVPPLQTTGPFARIHFHSDSQISDQGFHITYLTSPSDLRCGGNYTDPEGELFLPELSGPFTHTRQCVYMMKQPQGEQIQINFTHVELQCQSDSSQNYIEVRDGETLLGKVCGNGTISHIKSITNSVWIRFKIDASVEKASFRAVYQVACGDELTGEGVIRSPFFPNVYPGERTCRWTIHQPQSQVILLNFTVFEIGSSAHCETDYVEIGSSSILGSPENKKYCGTDIPSFITSVYNFLYVTFVKSSSTENHGFMAKFSAEDLACGEILTESTGTIQSPGHPNVYPHGINCTWHILVQPNHLIHLMFETFHLEFHYNCTNDYLEVYDTDSETSLGRYCGKSIPPSLTSSGNSLMLVFVTDSDLAYEGFLINYEAISAATACLQDYTDDLGTFTSPNFPNNYPNNWECIYRITVRTGQLIAVHFTNFSLEEAIGNYYTDFLEIRDGGYEKSPLLGIFYGSNLPPTIISHSNKLWLKFKSDQIDTRSGFSAYWDGSSTGCGGNLTTSSGTFISPNYPMPYYHSSECYWWLKSSHGSAFELEFKDFHLEHHPNCTLDYLAVYDGPSSNSHLLTQLCGDEKPPLIRSSGDSMFIKLRTDEGQQGRGFKAEYRQTCENVVIVNQTYGILESIGYPNPYSENQHCNWTIRATTGNTVNYTFLAFDLEHHINCSTDYLELYDGPRQMGRYCGVDLPPPGSTTSSKLQVLLLTDGVGRREKGFQMQWFVYGCGGELSGATGSFSSPGFPNRYPPNKECIWYIRTDPGSSIQLTIHDFDVEYHSRCNFDVLEIYGGPDFHSPRIAQLCTQRSPENPMQVSSTGNELAIRFKTDLSINGRGFNASWQAVTGGCGGIFQAPSGEIHSPNYPSPYRSNTDCSWVIRVDRNHRVLLNFTDFDLEPQDSCIMAYDGLSSTMSRLARTCGREQLANPIVSSGNSLFLRFQSGPSRQNRGFRAQFRQACGGHILTSSFDTVSSPRFPANYPNNQNCSWIIQAQPPLNHITLSFTHFELERSTTCARDFVEILDGGHEDAPLRGRYCGTDMPHPITSFSSALTLRFVSDSSISAGGFHTTVTASVSACGGTFYMAEGIFNSPGYPDIYPPNVECVWNIVSSPGNRLQLSFISFQLEDSQDCSRDFVEIREGNATGHLVGRYCGNSFPLNYSSIVGHTLWVRFISDGSGSGTGFQATFMKIFGNDNIVGTHGKVASPFWPENYPHNSNYQWTVNVNASHVVHGRILEMDIEEIQNCYYDKLRIYDGPSIHARLIGAYCGTQTESFSSTGNSLTFHFYSDSSISGKGFLLEWFAVDAPDGVLPTIAPGACGGFLRTGDAPVFLFSPGWPDSYSNRVDCTWLIQAPDSTVELNILSLDIESHRTCAYDSLVIRDGDNNLAQQLAVLCGREIPGPIRSTGEYMFIRFTSDSSVTRAGFNASFHKSCGGYLHADRGIITSPKYPETYPSNLNCSWHVLVQSGLTIAVHFEQPFQIPNGDSSCNQGDYLVLRNGPDICSPPLGPPGGNGHFCGSHASSTLFTSDNQMFVQFISDHSNEGQGFKIKYEAKSLACGGNVYIHDADSAGYVTSPNHPHNYPPHADCIWILAAPPETRIQLQFEDRFDIEVTPNCTSNYLELRDGVDSDAPILSKFCGTSLPSSQWSSGEVMYLRFRSDNSPTHVGFKAKYSIAQCGGRVPGQSGVVESIGHPTLPYRDNLFCEWHLQGLSGHYLTISFEDFNLQNSSGCEKDFVEIWDNHTSGNILGRYCGNTIPDSIDTSSNTAVVRFVTDGSVTASGFRLRFESSMEECGGDLQGSIGTFTSPNYPNPNPHGRICEWRITAPEGRRITLMFNNLRLATHPSCNNEHVIVFNGIRSNSPQLEKLCSSVNVSNEIKSSGNTMKVIFFTDGSRPYGGFTASYTSSEDAVCGGSLPNTPEGNFTSPGYDGVRNYSRNLNCEWTLSNPNQGNSSISIHFEDFYLESHQDCQFDVLEFRVGDADGPLMWRLCGPSKPTLPLVIPYSQVWIHFVTNERVEHIGFHAKYSFTDCGGIQIGDSGVITSPNYPNAYDSLTHCSSLLEAPQGHTITLTFSDFDIEPHTTCAWDSVTVRNGGSPESPIIGQYCGNSNPRTIQSGSNQLVVTFNSDHSLQGGGFYATWNTQTLGCGGIFHSDNGTIRSPHWPQNFPENSRCSWTAITHKSKHLEISFDNNFLIPSGDGQCQNSFVKVWAGTEEVDKALLATGCGNVAPGPVITPSNTFTAVFQSQEAPAQGFSASFVSRCGSNFTGPSGYIISPNYPKQYDNNMNCTYVIEANPLSVVLLTFVSFHLEARSAVTGSCVNDGVHIIRGYSVMSTPFATVCGDEMPAPLTIAGPVLLNFYSNEQITDFGFKFSYRIISCGGVFNFSSGIITSPAYSYADYPNDMHCLYTITVSDDKVIELKFSDFDVVPSTSCSHDYLAIYDGANTSDPLLGKFCGSKRPPNVKSSNNSMLLVFKTDSFQTAKGWKMSFRQTLGPQQGCGGYLTGSNNTFASPDSDSNGMYDKNLNCVWIIIAPVNKVIHLTFNTFALEAASTRQRCLYDYVKLYDGDSENANLAGTFCGSTVPAPFISSGNFLTVQFISDLTLEREGFNATYTIMDMPCGGTYNATWTPQNISSPNSSDPDVPFSICTWVIDSPPHQQVKITVWALQLTSQDCTQNYLQLQDSPQGHGNSRFQFCGRNASAVPVFYSSMSTAMVIFKSGVVNRNSRMSFTYQIADCNRDYHKAFGNLRSPGWPDNYDNDKDCTVTLTAPQNHTISLFFHSLGIENSVECRNDFLEVRNGSNSNSPLLGKYCGTLLPNPVFSQNNELYLRFKSDSVTSDRGYEIIWTSSPSGCGGTLYGDRGSFTSPGYPGTYPNNTYCEWVLVAPAGRLVTINFYFISIDDPGDCVQNYLTLYDGPNASSPSSGPYCGGDTSIAPFVASSNQVFIKFHADYARRPSAFRLTWDS
"
sig_peptide 53..121
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 155..160
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="non-experimental evidence, no additional
details recorded"
/note="Cleavage, by furin (Potential); propagated from
UniProtKB/Swiss-Prot (O60494.5); cleavage site"
misc_feature 461..553
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:28936"
misc_feature 560..682
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:28936"
misc_feature order(560..562,569..571,626..628)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:28936"
misc_feature 839..946
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:28936"
misc_feature order(839..841,848..850,896..898)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:28936"
misc_feature 965..1081
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:28936"
misc_feature order(965..967,974..976,1028..1030)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:28936"
misc_feature 1109..>1186
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="EGF domain; Region: EGF_3; pfam12947"
/db_xref="CDD:205157"
misc_feature 1241..1342
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:28936"
misc_feature order(1244..1246,1283..1285)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:28936"
misc_feature 1346..1456
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:28936"
misc_feature order(1346..1348,1355..1357,1397..1399)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:28936"
misc_feature 1472..1807
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(1496..1498,1502..1504,1508..1510,1589..1591,
1604..1606,1718..1720,1790..1792,1796..1798,1802..1807)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 1820..2149
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(1844..1846,1850..1852,1856..1858,1937..1939,
1952..1954,2066..2068,2138..2140,2144..2146)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 2174..2497
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(2198..2200,2204..2206,2210..2212,2291..2293,
2306..2308,2408..2410,2480..2482,2486..2488,2492..2497)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 2501..2833
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(2522..2524,2528..2530,2534..2536,2615..2617,
2630..2632,2744..2746,2816..2818,2822..2824,2828..2833)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 2846..3175
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(2876..2878,2882..2884,2963..2965,2978..2980,
3086..3088,3158..3160,3164..3166,3170..3175)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 3221..3526
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(3224..3226,3230..3232,3311..3313,3326..3328,
3443..3445,3515..3517,3521..3523)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 3545..3877
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(3569..3571,3575..3577,3581..3583,3662..3664,
3677..3679,3791..3793,3863..3865,3869..3871,3875..3877)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 3896..4216
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(3914..3916,3920..3922,3926..3928,4007..4009,
4022..4024,4124..4126,4199..4201,4205..4207,4211..4216)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 4223..4567
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(4253..4255,4259..4261,4340..4342,4355..4357,
4469..4471,4550..4552,4556..4558,4562..4567)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 4580..4903
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(4604..4606,4610..4612,4616..4618,4697..4699,
4712..4714,4817..4819,4889..4891,4895..4897,4901..4903)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 4910..5251
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(4937..4939,4943..4945,4949..4951,5033..5035,
5048..5050,5162..5164,5234..5236,5240..5242,5246..5251)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 5264..5593
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(5288..5290,5294..5296,5300..5302,5381..5383,
5396..5398,5507..5509,5582..5584,5588..5590)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 5606..5938
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(5630..5632,5636..5638,5642..5644,5723..5725,
5738..5740,5849..5851,5921..5923,5927..5929,5933..5938)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 5984..6316
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(6014..6016,6020..6022,6026..6028,6104..6106,
6119..6121,6233..6235,6305..6307,6311..6313)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 6326..6688
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(6356..6358,6362..6364,6443..6445,6458..6460,
6599..6601,6671..6673,6677..6679,6683..6688)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 6701..7051
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(6737..6739,6743..6745,6749..6751,6830..6832,
6845..6847,6962..6964,7034..7036,7040..7042,7046..7051)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 7058..7393
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(7082..7084,7088..7090,7094..7096,7178..7180,
7193..7195,7304..7306,7376..7378,7382..7384,7388..7393)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 7406..7744
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(7436..7438,7442..7444,7523..7525,7538..7540,
7655..7657,7727..7729,7733..7735,7739..7744)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 7760..8110
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(7787..7789,7793..7795,7799..7801,7892..7894,
7907..7909,8021..8023,8093..8095,8099..8101,8105..8110)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 8117..8452
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(8141..8143,8147..8149,8153..8155,8234..8236,
8249..8251,8363..8365,8435..8437,8441..8443,8447..8452)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 8465..8806
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(8489..8491,8495..8497,8501..8503,8582..8584,
8597..8599,8720..8722,8789..8791,8795..8797,8801..8806)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 8810..9154
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(8834..8836,8840..8842,8846..8848,8927..8929,
8942..8944,9068..9070,9137..9139,9143..9145,9149..9154)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 9161..9496
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(9185..9187,9191..9193,9197..9199,9281..9283,
9296..9298,9410..9412,9482..9484,9488..9490,9494..9496)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 9521..9871
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(9548..9550,9551..9553,9557..9559,9644..9646,
9659..9661,9782..9784,9854..9856,9860..9862,9866..9871)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 9884..10228
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(9914..9916,9920..9922,9926..9928,10007..10009,
10022..10024,10139..10141,10211..10213,10217..10219,
10223..10228)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 10235..10570
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(10259..10261,10265..10267,10271..10273,10352..10354,
10367..10369,10481..10483,10553..10555,10559..10561,
10565..10570)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
misc_feature 10583..10915
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="CUB domain; extracellular domain; present in
proteins mostly known to be involved in development; not
found in prokaryotes, plants and yeast; Region: CUB;
cd00041"
/db_xref="CDD:28922"
misc_feature order(10613..10615,10619..10621,10700..10702,10715..10717,
10832..10834,10904..10906,10910..10912)
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="heterodimerization interface [polypeptide binding];
other site"
/db_xref="CDD:28922"
exon 175..304
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 305..400
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 401..439
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 422
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1801220"
exon 440..541
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 542..645
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 563..691
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes EGF repeat"
variation 625
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1801221"
exon 646..772
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 773..935
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 810
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801222"
exon 936..1067
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 991
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801223"
exon 1068..1163
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 1103..1247
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes EGF repeat"
exon 1164..1282
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 1217
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1801224"
misc_feature 1248..1348
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes EGF repeat"
exon 1283..1469
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 1349..1462
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes EGF repeat"
exon 1470..1582
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 1472..1819
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
variation 1564
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2228053"
exon 1583..1817
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 1818..1999
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 1820..2173
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 2000..2162
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 2163..2353
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 2174..2500
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 2354..2498
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 2499..2677
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 2501..2845
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
variation 2539
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801225"
exon 2678..2843
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 2844..3060
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 2846..3193
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 3061..3191
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 3145
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801226"
variation 3146
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801227"
exon 3192..3381
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 3194..3544
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 3382..3542
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 3469
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801228"
exon 3543..3724
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 3725..3881
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 3882..4069
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 4070..4220
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 4221..4402
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 4223..4579
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 4403..4577
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 4578..4747
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 4615
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1801229"
variation 4727
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801231"
exon 4748..4907
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 4908..5021
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 4910..5263
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 5022..5132
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 5133..5261
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 5262..5394
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 5375
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1276708"
exon 5395..5600
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
STS 5413..6896
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/standard_name="D1S3698"
/db_xref="UniSTS:474276"
exon 5601..5785
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 5707
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801233"
exon 5786..5978
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 5908
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801234"
exon 5979..6176
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 5984..6325
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 6177..6323
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 6324..6514
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 6515..6698
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 6699..6873
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 6701..7057
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 6874..7052
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 7053..7262
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 7058..7405
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 7263..7403
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 7404..7585
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 7406..7759
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 7586..7757
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 7714
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="g"
/db_xref="dbSNP:3740165"
exon 7758..7964
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 7760..8116
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
variation 7776
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="c"
/replace="g"
/db_xref="dbSNP:3740168"
exon 7965..8114
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 8115..8236
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 8123
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801237"
exon 8237..8462
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 8463..8650
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 8465..8809
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 8651..8807
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 8687
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1801238"
exon 8808..8957
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 8810..9160
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 8958..9158
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 9002
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801239"
variation 9057
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801240"
variation 9082
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801241"
exon 9159..9288
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 9161..9520
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 9289..9506
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 9507..9715
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 9521..9883
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
exon 9716..9878
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 9879..10084
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
variation 9895
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="g"
/db_xref="dbSNP:703064"
exon 10085..10232
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 10233..10414
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 10235..10582
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
variation 10317
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801230"
exon 10415..10580
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
exon 10581..10816
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
misc_feature 10583..10921
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/note="encodes CUB domain"
variation 10708
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1801232"
exon 10817..11933
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/inference="alignment:Splign:1.39.8"
STS 11151..11268
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
/standard_name="D22S296"
/db_xref="UniSTS:147641"
polyA_signal 11908..11913
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
polyA_site 11933
/gene="CUBN"
/gene_synonym="gp280; IFCR; MGA1"
ORIGIN
atgctcagttggttggagtggcctcactcttacctgccaacctgggaggttgatgatgaacatgtctttaccttttctttggagtttgcttaccttattaatatttgctgaagtaaatggcgaagctggagaacttgagctgcagagacaaaaaagaagcatcaatctccaacagcctcgaatggctacagagagaggaaatttggtgtttcttacggggtctgctcaaaacattgagtttagaaccggatccctgggaaaaattaaattaaatgatgaagatctcagtgagtgtttacatcagatccagaaaaacaaagaagatattatagagttaaaagggagtgcaattggtctgcctcaaaatatatctagtcaaatctatcagcttaattccaagctggtggatcttgagagaaaattccaaggcttgcagcagactgttgacaaaaaggtttgcagcagcaatccttgccagaatggtggaacctgcctcaatctgcatgattcctttttttgtatctgtcccccacagtggaagggtcctctctgctcagctgatgttaacgaatgtgagatttactcaggaacacccttgagctgccagaatggaggcacatgtgttaatacaatgggaagttacagttgtcactgcccacctgagacgtacggaccccagtgtgcatccaaatatgacgactgtgaagggggttctgtggcacgctgtgtccatggcatctgtgaggatttaatgcgagagcaagctggagagcccaagtacagctgcgtctgtgatgctgggtggatgttttcacccaacagccctgcctgcacgctggacagagacgagtgcagcttccagcccgggccttgctccacacttgtgcagtgtttcaacactcaaggctctttctactgtggggcctgtccaacaggctggcaaggcaatggatatatttgcgaagatatcaatgaatgtgagataaataacggcggctgttctgtggctccacccgttgagtgtgtgaatacacctgggtcttcccactgccaggcctgtccaccagggtaccagggtgacggaagagtgtgcacactcacagacatctgctcagtcagtaatggaggctgccacccagatgcctcatgctcctcaactctaggttccttacctctctgcacgtgtctcccgggttatactggaaatggttatgggccaaatggatgtgtgcagctcagtaatatttgcctaagtcacccctgtctaaatggacaatgcatcgacactgtctctggttatttttgtaagtgtgactcaggttggacaggtgtcaactgtacagaaaacatcaatgagtgtttgagcaacccctgtttgaatggaggaacttgtgttgatggcgttgattctttcagttgtgaatgcacacgtctctggactggagctctctgtcaggttcctcagcaagtttgtggagagtccctctcaggaataaatggaagcttcagctacaggagcccggatgttggttatgttcatgatgttaactgcttctgggttatcaaaactgaaatgggaaaggtcctgcgtatcactttcacttttttccggttagaatccatggacaactgtccacacgagtttcttcaggtttatgatggagattcctcttctgcttttcaacttggaagattttgtggctccagcctccctcatgaactcctcagcagtgacaatgctctctattttcatctctattctgaacatttaagaaatgggagaggctttacagtaagatgggaaacacagcaaccagagtgtggaggtatcctgactggtccttacggttctattaagtctccggggtatcctggaaactatcccccaggaagagattgtgtctggattgttgtaactagtcctgacctcctggtaacatttacttttgggaccttgagcctcgagcaccatgatgactgcaacaaagattaccttgagattcgagatggtcctttgtatcaggacccccttcttgggaagttctgcaccactttctctgtcccaccgctccagactactggcccctttgccagaattcacttccattcagactcccagattagtgaccaaggcttccatatcacctacttaacatcaccttcggatctgcgttgtggtgggaactacacggacccagagggtgaactcttcttgcctgagttgtctgggcctttcactcacaccaggcaatgcgtctatatgatgaagcagccccagggagaacaaatacaaatcaacttcacccacgtggagctgcaatgccagagtgacagttctcagaattacattgaggttcgagatggtgaaaccttacttggaaaagtctgtggcaacggaaccatctctcacattaaatccattactaatagtgtctggatcaggtttaaaatagatgcttctgttgaaaaagctagtttcagagctgtttatcaagtcgcttgcggggatgaattaactggagaaggggtcattcgctcgcctttttttcctaacgtgtatcctggagaaagaacctgtaggtggaccatccaccagccccaaagccaagtcattctcctcaacttcactgtctttgaaattggaagttctgcccactgtgaaacagattatgttgagattggtagcagttccattttgggttctcctgaaaataaaaagtattgcggtacagacataccttcatttataacatctgtgtacaattttctttatgtcacattcgtgaaaagttcttctactgaaaaccatggtttcatggctaagttcagtgctgaggatttggcatgtggagaaattcttacagaatcaacagggaccattcaaagtcctggccatccaaatgtctacccccacggtatcaactgtacttggcatatattagtccaacctaatcacctgattcatttaatgttcgaaacatttcatctggagtttcattacaattgcacaaacgactacttggaagtttatgacaccgactctgagacatcccttggaagatactgtggaaagtcgatcccgccatctctcacaagcagtggtaactcattgatgctggtgtttgtgactgactccgacctcgcttatgaaggcttcttaataaactatgaagcaatcagtgcagcaacagcatgtttgcaagactacacagatgatttggggacattcacttctccaaacttccccaataattatcccaacaactgggaatgcatttatcggatcacagtgagaactggccaactgattgcagtgcacttcacaaacttctccttggaggaagccattggaaactattatacagattttctggaaatcagagatggaggctatgaaaaatcaccattgctgggaatattctatggctcaaatctacccccaacaatcatctctcatagtaacaaactatggttaaaatttaagagtgaccaaatagacacaaggtctggattctcagcttactgggatgggtcatcaacaggttgcgggggtaatctcaccacttcaagcggcacgttcatatctcccaactacccgatgccctattaccacagctctgaatgctactggtggttgaaatctagccacggcagcgcatttgaactggaattcaaagactttcacttggagcatcatccaaactgcactttagattacctggctgtatatgatggcccaagtagcaactctcatctgctaactcagctttgtggggatgagaaaccccctcttattcgttctagtggagacagcatgtttataaaactgaggacagatgaaggtcagcaaggacgtggcttcaaggctgaataccggcagacatgtgagaatgtggtaatagtcaatcaaacctatggcatcttagagagtatagggtatccgaatccttattctgaaaatcagcattgcaactggaccatccgggcaacaacaggcaacactgtgaactacacatttttagcatttgacttggaacatcacataaactgctccacagattatttagagctctatgatggaccacggcagatgggacgctactgtggagtagacctgccccctccagggagtactacaagctccaagcttcaagtgctgctccttacagatggggttggccgccgtgagaaaggatttcagatgcagtggtttgtttacggttgtggtggagagctgtctggggccacaggctccttcagcagccccgggttccccaacaggtatccaccaaacaaggagtgtatctggtacattaggacggaccccgggagtagcattcagctcaccatccatgacttcgatgtggagtatcattcaaggtgcaactttgatgtcttggagatctatggaggccccgatttccactctcccagaatagcccaactgtgtacccagagatcacctgagaaccccatgcaggtctccagcactggaaatgagctagcaattcgattcaagaccgacttgtccataaatgggagaggcttcaatgcgtcatggcaagcagtcactggaggttgtggtgggattttccaggctcccagtggagagattcattctccaaattaccccagtccttataggagcaacacagactgttcttgggtcattcgggttgacagaaatcatcgtgttctcttgaacttcactgactttgatcttgaaccacaagactcttgtattatggcatacgatggcttaagctccacaatgtcccgccttgccaggacgtgtggaagggagcagctggctaaccccatcgtctcctcaggaaacagcctcttcttgagatttcagtctggcccttccagacagaacagaggcttccgagctcaattcaggcaagcctgcggaggccacatcctcaccagctcatttgatactgtttcctctccacggttccctgccaattatccaaacaatcagaactgcagctggatcattcaagcgcaacctccattaaatcatatcaccctctcttttacccactttgaacttgaaagaagcacaacgtgtgcacgtgactttgtagaaattttggatggcggccacgaagacgcgcccctccgaggccgttactgtggcaccgacatgccccatcctatcacatccttcagcagcgccctgacgctgagattcgtctctgattctagcatcagtgctgggggtttccacaccacggtcaccgcatcagtgtcggcttgtggtggaacgttctacatggctgaaggcatcttcaacagccctggctacccagacatttatccccctaatgtggaatgtgtctggaacatcgtcagttcccctggcaaccggctccagctgtcttttatatctttccagttggaagactctcaggactgcagcagagattttgtggagatccgtgaaggaaatgccacgggtcacttggtgggacgatactgtggaaactccttccctctcaattattcttccatcgttggacataccctgtgggtcagatttatctcagatggttctggcagcggcacgggcttccaggccacatttatgaagatatttggcaatgataatattgtgggaactcatgggaaagtcgcctctcctttctggcctgaaaactacccacataactccaattaccaatggacagtaaatgtgaatgcatctcacgttgtccatggtagaatcttggagatggacatagaagaaatacaaaactgctattatgacaaattaaggatctatgatgggcctagcattcacgcccgcctaattggagcttactgtggtacccagactgaatctttcagctccactggaaattctttgacatttcatttttactccgactcttcaatctcagggaagggattccttctggagtggtttgcagtggatgcacctgatggtgttttacctaccattgctccaggtgcttgtggtggcttcctgaggacgggagatgcacccgtgtttctcttctccccgggctggcctgacagttacagtaatagagtggactgtacgtggctcatccaggctcccgactctaccgtggaactcaacattctttccctggacattgaatctcaccgaacgtgtgcctatgatagccttgtgatacgagatggagataataacttggcccagcagctagcagttctctgtggcagagagatccctgggcccatccggtctactggagagtacatgttcatccgcttcacctcggactccagtgtaaccagggcaggcttcaatgcatcctttcacaagagctgcggtggatatttgcatgcagacagagggatcatcacgtcccccaagtatccagagacttacccatccaacctcaactgttcttggcacgtcctggtccaaagtggcctgaccattgctgtccattttgaacagcctttccagattccaaatggagattcttcttgcaaccagggggattacttggtgctaagaaatggtcctgatatctgttctccacccttgggaccccctggaggaaatggtcatttttgtggcagtcatgcttcatcaactctgttcacctcggataatcaaatgtttgttcagtttatttctgatcacagtaatgaagggcaaggatttaaaatcaaatatgaggcaaagagtttagcctgtgggggcaacgtctacatccatgatgctgattctgctgggtatgtgacctcccccaaccaccctcataattatcccccgcacgctgattgcatttggatcttagcggctccaccggaaacacgcatacagctgcaatttgaagatcgattcgatattgaagtaacacccaactgtacttccaactaccttgagttgcgggatggagtggattcggatgcaccaatactttccaaattttgtgggacatctttgcccagcagtcagtggtcctcaggagaggttatgtatttgagatttcgatctgacaacagccccacacatgtgggattcaaggccaagtattctatagctcagtgtgggggaagagtaccagggcaaagtggtgttgttgaaagcattggacatccaacacttccatacagagacaacttattctgtgagtggcatctccaggggctctctggacactatctcaccatctcttttgaagactttaaccttcagaattcttctggctgtgaaaaagacttcgtggagatctgggacaatcatacctctggaaacatcttgggcagatactgtggaaacaccattcctgacagcatagacacttctagcaatactgctgtggtcaggtttgtcacagacggctctgtgactgcctcaggattcagactgcgatttgaatccagtatggaagagtgtggtggggatcttcagggctctattggaacatttacttctcccaactacccgaacccaaatcctcatggccggatctgcgagtggagaatcactgccccggagggaaggcggatcaccctaatgtttaacaacctgaggctggccacgcatccgtcctgcaacaatgagcatgtgatagtattcaatggcattagaagtaactcaccccagctagagaaactgtgtagtagtgtgaatgtaagcaatgagattaaatcttcaggaaacacaatgaaagtcatttttttcacggatggatccaggccatatggcggcttcactgcttcctatacctccagtgaagatgcagtgtgtggtgggtctcttccaaatactcctgaaggaaactttacttctcctggctatgacggagtcaggaattactcaagaaacctgaactgcgaatggactctcagcaatccaaatcagggaaattcatccatttccattcactttgaagatttttacctagaaagtcaccaagactgtcaatttgatgtcctcgagtttcgagtgggtgatgctgatgggcccctgatgtggagactttgtggtccttcaaagcctacattgccattggttataccttattctcaggtatggattcactttgtcaccaacgaacgtgtagaacacattggattccatgcaaagtattcctttacagattgtggcggaatacagataggtgacagtggagtgatcacaagccccaactatccaaatgcttatgacagcctgacccactgctcttcgctgttggaggccccacaagggcacaccatcactctcacatttagtgactttgatattgaaccccatacaacttgtgcttgggactctgtcactgtcaggaatggtgggtcccctgaatcacccatcataggacaatactgtggaaattcaaaccccaggacaatacagtcaggttccaatcagctggtcgtgacttttaactcagaccattcattgcaaggtggtggattttatgctacgtggaacacacaaactttaggttgtggtggaatatttcattctgataatggtacaatcagatcccctcactggcctcagaattttcccgaaaacagcagatgttcctggacggccattactcacaaaagtaaacacttggagatcagctttgacaacaacttcctaatccccagcggtgatggacaatgtcagaatagcttcgtgaaggtgtgggcaggaactgaggaggtggacaaagccctgctagccactggctgtgggaacgtggctccgggtcccgttatcacaccaagtaacacattcactgccgtcttccagtctcaggaggcaccagctcagggcttctccgcgtcctttgttagccgatgtggaagtaatttcactggcccttcaggttacatcatttctccaaattacccaaaacaatatgacaacaacatgaattgcacctatgtcatagaggctaatcctctgtcagtggtcctcttgacttttgtgtccttccacttagaagctcgttccgctgtgacgggaagctgtgtcaacgatggcgtgcacattatcagaggttacagcgtcatgtccaccccatttgctactgtgtgtggggatgagatgccagctcccctcaccatcgctgggccggttctgcttaacttctactccaacgagcaaatcacagacttcggattcaagttttcctataggataatctcctgtggtggtgtgttcaatttctcttctggaatcatcacaagtcctgcctattcatacgcagactacccaaatgatatgcactgtctgtataccatcaccgttagtgacgacaaggtgatcgagctcaagttcagtgattttgatgtggttccctccacctcctgctcccatgactacctggcaatttacgatggtgccaataccagcgatccccttcttggcaaattctgcggttccaagcgcccaccaaatgtgaagagcagcaataatagtatgctcctggtgttcaagacagattcatttcagacagcaaaaggctggaagatgtctttccggcagacattggggcctcagcaaggatgtggtggttatctgacaggctcgaataatacctttgcctctcctgattctgattcgaatggaatgtatgacaagaatttaaactgtgtatggatcataattgcacctgtaaacaaagtaattcacctcaccttcaatacatttgctctggaggcagcaagtactaggcaaagatgcctttatgattatgtaaagttatatgatggggatagtgaaaatgcgaacttggctggaacgttttgtggttccacagtacctgctccttttatctcttctggtaacttccttacggttcaattcatcagtgacttaacattagagagggaaggatttaatgctacatacaccatcatggacatgccttgtggtggaacatacaatgcaacttggaccccacaaaatatttcatcacccaattcatcagacccagatgtcccattttccatctgtacttgggtcattgattcccctccgcatcagcaggtcaagataactgtgtgggcattacagctgacctcgcaagactgcacgcagaattacttacagcttcaggactcaccgcagggtcacggaaattcaagatttcagttctgtggcagaaatgcttcggctgtgccagtgttttattcttctatgagtactgcaatggtcattttcaaatctggagttgtaaacagaaactctagaatgagtttcacctatcagattgcagattgcaacagagactatcacaaggcatttggcaacctgagaagccctggatggccagataactacgacaatgacaaggattgcaccgttactctcacagccccccagaaccacaccatttccctcttttttcattcacttggcatcgagaactcagttgaatgcagaaacgatttcttggaggtgagaaatggaagtaacagcaattcaccattactgggcaagtactgtggaactctgctgccaaaccctgtcttctctcaaaataatgaactatacctacgatttaagagtgatagtgtaacttctgatcgtggatatgaaatcatctggacttcatcaccctctggatgtggtggaactctttatggagacagaggctcattcaccagccccggctatccaggcacatacccaaacaacacgtactgcgagtgggtccttgttgctcctgctggaaggcttgtcaccatcaacttctacttcatcagcattgacgatccaggagactgtgtccagaactatctcacactctatgatgggcccaacgccagctctccatcctctggaccatactgcggaggcgacaccagcatagctcccttcgtggcttcctcaaatcaggtcttcataaaatttcatgctgattatgcacggcgtccatccgcattccgattaacttgggacagctaagtgggtaacaactcgtgttcactcagcactttccctctgcagcacgctggacagcactctgccatcctgatacatgacccctgctgatgccacagagaataagctgaacttgtatggtttttcaccaaaccatggatagaatcaatatttgtaggccaggcgtggtggctcacccccctgtattctcagcactttgggaggccgaggcaggttgatcacctgaggtcaggagtttgagactagcctggccagcatggtgaaacctcatctctctaacaatataataattagccaggcgtggtggtgggtgcctgtaattccagccactcgagaggctgaggcaggagaattgcttgaacccaggaggcagaggttgcagtgagctaagatcacaccactacactccagcctgggcgagacggcaagactccatctcaaaaaaaaaagaaacaaaaaaaaccagaatcaatatttgtacattttctcgaacatagaatatagcttctttagtcttgagtgtgcatttcattctaatattttgagctgaaatttaaaaaaactttgaaagagttggaaatgattatggcatatgtgacatacatttttaaaagttaataataatagccaggggcagtggctcatacccataatcccagcacgctgggaggccatgatgggaggattgcttgaacctaggagtttgagaccagcctgggcaacaaagtgagacctgatttttacaaaaaatcaaaaaattagccaggcatggtggcatgcacccgtggttccagctacacaggaggttgaagcaggaggatcacttgagcccagtaggttaaggctgcagtgaaaccctgtgaattaaccactgtactccagcctgggtgacagactgagaccctatctcaaaaatgacaacaagaacaacaaaagttaatgataatatagaagcataaatttcctgtgaatgttcaattacacataataaacattattgaattgtacacaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:8029 -> Molecular function: GO:0004872 [receptor activity] evidence: TAS
GeneID:8029 -> Molecular function: GO:0005215 [transporter activity] evidence: TAS
GeneID:8029 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
GeneID:8029 -> Molecular function: GO:0031419 [cobalamin binding] evidence: IEA
GeneID:8029 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IDA
GeneID:8029 -> Biological process: GO:0001894 [tissue homeostasis] evidence: NAS
GeneID:8029 -> Biological process: GO:0006766 [vitamin metabolic process] evidence: TAS
GeneID:8029 -> Biological process: GO:0006767 [water-soluble vitamin metabolic process] evidence: TAS
GeneID:8029 -> Biological process: GO:0006898 [receptor-mediated endocytosis] evidence: NAS
GeneID:8029 -> Biological process: GO:0008202 [steroid metabolic process] evidence: TAS
GeneID:8029 -> Biological process: GO:0008203 [cholesterol metabolic process] evidence: IEA
GeneID:8029 -> Biological process: GO:0009235 [cobalamin metabolic process] evidence: TAS
GeneID:8029 -> Biological process: GO:0015889 [cobalamin transport] evidence: TAS
GeneID:8029 -> Biological process: GO:0042157 [lipoprotein metabolic process] evidence: TAS
GeneID:8029 -> Biological process: GO:0042359 [vitamin D metabolic process] evidence: TAS
GeneID:8029 -> Biological process: GO:0042953 [lipoprotein transport] evidence: IEA
GeneID:8029 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:8029 -> Cellular component: GO:0005765 [lysosomal membrane] evidence: IEA
GeneID:8029 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IEA
GeneID:8029 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IEA
GeneID:8029 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:8029 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:8029 -> Cellular component: GO:0005905 [coated pit] evidence: IEA
GeneID:8029 -> Cellular component: GO:0010008 [endosome membrane] evidence: TAS
GeneID:8029 -> Cellular component: GO:0016020 [membrane] evidence: TAS
GeneID:8029 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: IEA
GeneID:8029 -> Cellular component: GO:0030139 [endocytic vesicle] evidence: IEA
GeneID:8029 -> Cellular component: GO:0031232 [extrinsic to external side of plasma membrane] evidence: NAS
GeneID:8029 -> Cellular component: GO:0031526 [brush border membrane] evidence: NAS
GeneID:8029 -> Cellular component: GO:0043202 [lysosomal lumen] evidence: TAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.