Home |
Help |
Advanced search
2024-04-25 04:43:48, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001079692 3302 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens membrane-spanning 4-domains, subfamily A, member 14
(MS4A14), transcript variant 2, mRNA.
ACCESSION NM_001079692
VERSION NM_001079692.2 GI:387849345
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3302)
AUTHORS Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
Snippe,H., Hibberd,M.L. and Seielstad,M.
TITLE New genetic associations detected in a host response study to
hepatitis B vaccine
JOURNAL Genes Immun. 11 (3), 232-238 (2010)
PUBMED 20237496
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AP003127.2 and AY094611.1.
On May 17, 2012 this sequence version replaced gi:119226219.
Transcript Variant: This variant (2) has multiple coding region
differences, compared to variant 4, which results in a shorter
protein (isoform 2), compared to isoform 4.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
##Evidence-Data-START##
Transcript exon combination :: AY094611.1, AY584610.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025085 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-472 AP003127.2 99935-100406
473-1042 AY094611.1 57-626
1043-3302 AP003127.2 119418-121677
FEATURES Location/Qualifiers
source 1..3302
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q12.2"
gene 1..3302
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/note="membrane-spanning 4-domains, subfamily A, member
14"
/db_xref="GeneID:84689"
/db_xref="HGNC:30706"
exon 1..703
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 31
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:186234557"
variation 39
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:7929046"
variation 40
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:190992915"
variation 51..52
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="a"
/db_xref="dbSNP:377307026"
variation 102
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76333679"
variation 110
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:143358541"
variation 149
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3816270"
variation 223
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76174817"
variation 281
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:180800488"
variation 296
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:185942516"
variation 379
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:141665394"
misc_feature 410..412
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/note="upstream in-frame stop codon"
variation 421
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:112785513"
variation 427
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375045470"
variation 432
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:190864604"
variation 472
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:6591579"
variation 517
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:368431455"
variation 545
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:367878785"
variation 560
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200592380"
CDS 566..2554
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/note="isoform 2 is encoded by transcript variant 2;
membrane-spanning 4-domains, subfamily A, member 16;
testes development-related NYD-SP21; MS4A13 protein;
testis development protein NYD-SP21"
/codon_start=1
/product="membrane-spanning 4-domains subfamily A member
14 isoform 2"
/protein_id="NP_001073160.1"
/db_xref="GI:119226220"
/db_xref="CCDS:CCDS41652.1"
/db_xref="GeneID:84689"
/db_xref="HGNC:30706"
/translation="
MESTSQDRRATHVITIKPNETVLTAFPYRPHSSLLDFLKGEPRVLGATQILLALIIVGFGTIFALNYIGFSQRLPLVVLTGYPFWGALIGQGVTGMNVISSLVAITGITFTILSYRHQDKYCQMPSFEEICVFSRTLFIVLFFLPSDVTQNSEQPAPEENDQLQFVLQEEFSSDDSTTNAQSVIFGGYAFFKLTLSRSPLVSQPGNKGREFVPDEQKQSILPSPKFSEEEIEPLPPTLEKKPSENMSIQLDSTFKQMKDEDLQSAIVQPSQMQTKLLQDQAASLQVFPSHSALKLEDISPEDLPSQALPVEGLSEQTMPSKSTSSHVKQSSNLTANDLPPQGILSQDTSSQDMLFHDMTSQDMQSLDMLSQDTPSHAMPPQDIPSQDMLSQALSAHAILPEASTSHIVQFPEIQHLLQQPPDLQPENTEPQNQQILQMSYQDIRSEVMEETKEWKSEEELHRRKSSRRHSLNQQTKALQYLRRHSLDVQAKGQKSSKRHSLDQQSKGWQSPKQKSLDQQIKDWLSPKRHSVDKQAQLNQTKEQLPDQQAEDQQAKGEQYPEGQSKDGQVKDQQTDKEQNSKKQTQDQQTEDQPAQEKKSPKGQFQNVQAEGQQAQVEKVPKLLCQDSESQIQQYQFWQFHKGNLQAGQPRTVNLLAKNPLTG
"
misc_feature 695..>973
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/note="CD20-like family; Region: CD20; pfam04103"
/db_xref="CDD:202888"
variation 569
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:201462421"
variation 577
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:375301622"
variation 589
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:140226757"
variation 601
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200092161"
variation 602
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371634910"
variation 640
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:150323558"
variation 653
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:200017443"
variation 701
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:138895874"
exon 704..832
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 709
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:141700245"
variation 731
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:72514098"
variation 732..733
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:3217518"
variation 732
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:74733740"
variation 732
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:77630012"
variation 747
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147119308"
variation 769
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:138517611"
variation 770
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:368053345"
variation 771
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:144076317"
variation 794
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:369576834"
variation 796
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:144248317"
variation 802
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:2197234"
variation 810
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:372708908"
variation 815
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:148297999"
variation 827
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375255532"
variation 831
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:141490187"
exon 833..982
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 833
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375760675"
variation 834
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:202236686"
variation 846
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:146613208"
variation 847
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371907012"
variation 856
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:183715072"
variation 876
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76136794"
variation 881
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375247098"
variation 891
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:146035561"
variation 910
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:140270120"
variation 960
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:145354751"
exon 983..3302
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 1003
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371774895"
variation 1014
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375761169"
variation 1028
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:143463721"
variation 1043
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:7131283"
variation 1044
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:148391374"
variation 1091
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:369024994"
variation 1097
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142563385"
variation 1107
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:373780418"
variation 1115
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:116626186"
variation 1120
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:140195795"
variation 1146
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:142269991"
variation 1152
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147713621"
variation 1153
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142667482"
variation 1164
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:370208539"
variation 1202
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:373858678"
variation 1205
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:150268605"
variation 1262
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:117801657"
variation 1265
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:149338262"
variation 1301
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:187868937"
variation 1347
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:150868984"
variation 1363
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:193025815"
variation 1364
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:368158780"
variation 1365
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:375278465"
variation 1370
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:114064661"
variation 1386
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:138285006"
variation 1391
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142839945"
variation 1411
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:369608879"
variation 1422
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:185708225"
variation 1459
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201469306"
variation 1465
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:114663860"
variation 1474
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:376669252"
variation 1485
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:139364741"
variation 1491
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:149681158"
variation 1511
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:150784858"
variation 1561
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:370940283"
variation 1590
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:145539034"
variation 1610
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:149868650"
variation 1621
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:144883718"
variation 1658
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:140428922"
variation 1694
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:144301602"
variation 1728
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:116345276"
variation 1750
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:112103602"
variation 1782
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:369619070"
variation 1810
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:373220783"
variation 1822..1823
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="c"
/db_xref="dbSNP:35183103"
variation 1866
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3802959"
variation 1897
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:143398166"
variation 1908
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:139435636"
variation 1915
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:145054362"
variation 1953
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140456628"
variation 1967
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:376488191"
variation 2005
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:150409796"
variation 2010
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:74837900"
variation 2026
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142892172"
variation 2041
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:145051590"
variation 2058
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:199805024"
variation 2082
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:199505839"
variation 2085
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:374402343"
variation 2096
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:201227484"
variation 2119
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142235413"
variation 2151
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:113290465"
variation 2155
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:80173276"
variation 2156
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:144635507"
variation 2169
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:372468983"
variation 2191
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:370935983"
variation 2241
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200738251"
variation 2242
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:148489703"
variation 2249
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375897716"
variation 2264
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3825020"
variation 2290
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:374558627"
variation 2343
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:116224124"
variation 2350
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:73481226"
variation 2360
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200543306"
variation 2364
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:144309625"
variation 2365
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201726394"
variation 2372
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200307761"
variation 2379
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:3016727"
variation 2392
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147367847"
variation 2393
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:140936913"
variation 2408
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:368186934"
variation 2410
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:146179294"
variation 2422
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:370794980"
variation 2431
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:375353153"
variation 2451
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:145801550"
variation 2475
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:368014397"
variation 2477
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:149015522"
variation 2535
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142968938"
variation 2540
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:151183005"
variation 2573
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:181547264"
variation 2681
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:77025492"
variation 2791
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:184474834"
variation 2891
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:375774697"
variation 2913
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443243"
STS 2943..3136
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/standard_name="RH17567"
/db_xref="UniSTS:70207"
variation 3002
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:78731118"
variation 3081
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375396734"
STS 3099..3198
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/standard_name="SGC34191"
/db_xref="UniSTS:21339"
variation 3117
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:75538311"
variation 3139
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:138237921"
variation 3147
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:188971082"
variation 3238..3239
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="aacac"
/db_xref="dbSNP:140068962"
variation 3279
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:181921480"
ORIGIN
atcaagtaaaagaaactcctttcaaaggagggcagaagcgtggctgagtttaaaaaacatagattttggagacaggtcaagttgagtttgccccttccctgtcctgtatgtctttgggtgacataaccttgctgttcctcagtttcagtattgtagaactgttaaaagaataaatgttagtgcatgtcaacaccttctacacagttcccagaacataaggaatattccataagttttagttcctttataactcatgaacatatgtgtaaggacttgtttcgtatataccatctattctttgtttaccatatgtttgtaagcaaattgacaagagagtaagtcttctggatacagtacttttcaccaggaagatggggggctgagcatgctctagaattctaaaactctgtgactcaactatgattctgagattctactactgagtagagtcatcactaagggctcatctctgagggctccatgtgactctggtggagaggtagatcatgatttgggcggcaatgtttgctcactctttcccttactagagttctgccatagaatcatggagtcaacatcccaggacagaagggcaactcacgtcatcactataaaaccaaacgaaactgtattgactgcatttccctacagacctcatagctctctgctggattttctgaagggagagccaagagtcttgggggctacccagatcctgcttgctctaatcattgtgggctttggaactatatttgcacttaattacatcggtttctcccaaagacttccccttgttgtcctcacaggatatccattctggggagcacttattggtcaaggtgtcacgggcatgaatgttatcagctccttggttgcgataactgggattactttcaccattctcagctacagacatcaagacaagtactgccagatgccatcctttgaagaaatatgtgttttcagtagaactcttttcattgttctgtttttcttgccttcggatgttactcaaaatagtgaacaacctgccccagaagaaaatgatcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaatgcacaatctgttatctttggaggctatgctttcttcaagttaacactctctaggagtcctttagtctcccaaccaggtaataaaggtagagaatttgtgccagatgaacaaaagcaaagtatccttccatctcccaaattttcagaggaagaaattgaacctttgcctcccacactagagaaaaagccctcagaaaatatgtccattcagctagactctacatttaaacaaatgaaagatgaagatctacaatctgctattgtacaaccttctcaaatgcaaaccaagcttctgcaggaccaagctgcgtcactccaagtttttccatcccattctgcactaaaactcgaagatatatcacctgaagacttgccatcccaagctctaccagtagaaggcctgtcagaacaaaccatgccatctaagtctacatcatcccatgtcaaacagtcttctaatctgacagctaatgacctgccccctcaaggcatactatcccaagacacatcatctcaagatatgctgtttcatgacatgacatcccaagatatgcaatccctagatatgctatctcaagacacaccatcccacgccatgccacctcaagacataccttcccaagatatgctatcccaagctctatcagcgcatgccatattacctgaagcctcaacatcccatattgtgcagttccctgaaatacaacacctacttcagcagcccccagatcttcaaccagaaaacactgaacctcaaaaccagcaaattttacaaatgtcatatcaagatattagatcagaagttatggaagagaccaaagaatggaaatctgaggaggaactccatagaagaaaatcctcaagacggcattccttaaaccagcaaaccaaagccttgcaatacttaaggagacattctttagacgtgcaagccaaaggccagaaatcctcaaagaggcattccttagatcagcaaagcaaaggctggcaatctccaaagcagaaatccttagaccagcaaatcaaagactggctatccccaaagaggcactccgtagataagcaagctcaacttaatcaaactaaagagcaactcccagatcagcaagctgaagatcagcaagccaaaggggaacaatacccagaaggacaatctaaagatggacaagttaaagaccagcagactgataaggagcaaaactcaaagaagcaaacccaggatcagcaaactgaagaccagccggcccaagagaagaaatccccgaaaggacaattccaaaatgttcaagccgaaggacagcaagctcaggtggagaaagtgccaaaactgttatgccaagattcagaatcccaaatacagcaataccaattctggcaattccacaaaggcaatctccaggctggacaacccaggactgtcaatcttttggccaagaatcccctgactggataactcagggctggagaaacaaagattataaagcacgagaatggcaatttgaaatgaagcactggcaaacacaggatctattagagaaagaagccctaaagcagaaagctctataccaagaagtccaaacccagcacgcaacagcccaacataacctagaatgtcaagacactcaagataaagaccaacaagaccttcaatccagagttacacaaaaaggagatatgtacactagagacatcaaaccaggggacatgaaatgtatagggcaaacctcaggggacctgcaatcagaagacgtgaaggcagattttcattcttcttctggccaaagctcagtacaagacacatgtttagcctatttgtccaatctagattcagaacaagatgtgcaaccagacacttcagcttcctcaaattcatataaagaagatgtgaatttaacttctacttcatgtgatccaaaagatcaacagcaatctgaagactctgactaacatgcagaatctacccaataccacactgcccccattaatggaattaaattgggaaaaacaatattgcctcctccaatctgtgttctcaactgtggttgccacctcattaacttacaaaaaaatgaagggcatgctgagcactcaaacaatttgttcttacttaaaataaaatgacaacaaaccaaatgttaacactgtatcatcactttatgtatgtgaagaaataattcacatgtatattccttgtcatcaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:84689 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.