GGRNA Home | Help | Advanced search

2020-10-26 18:25:35, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001077358            1869 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens phosphodiesterase 11A (PDE11A), transcript variant 2,
            mRNA.
ACCESSION   NM_001077358
VERSION     NM_001077358.1  GI:116536088
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1869)
  AUTHORS   Vezzosi,D., Libe,R., Baudry,C., Rizk-Rabin,M., Horvath,A., Levy,I.,
            Rene-Corail,F., Ragazzon,B., Stratakis,C.A., Vandecasteele,G. and
            Bertherat,J.
  TITLE     Phosphodiesterase 11A (PDE11A) gene defects in patients with
            acth-independent macronodular adrenal hyperplasia (AIMAH):
            functional variants may contribute to genetic susceptibility of
            bilateral adrenal tumors
  JOURNAL   J. Clin. Endocrinol. Metab. 97 (11), E2063-E2069 (2012)
   PUBMED   22996146
  REMARK    GeneRIF: PDE11A genetic variants may increase predisposition to
            ACTH-independent macronodular adrenal hyperplasia.
REFERENCE   2  (bases 1 to 1869)
  AUTHORS   Uckert,S., Oelke,M., Albrecht,K., Breitmeier,D., Kuczyk,M.A. and
            Hedlund,P.
  TITLE     Expression and distribution of key enzymes of the cyclic GMP
            signaling in the human clitoris: relation to phosphodiesterase type
            5 (PDE5)
  JOURNAL   Int. J. Impot. Res. 23 (5), 206-212 (2011)
   PUBMED   21697861
  REMARK    GeneRIF: found in single nerve trunks in the clitoral stroma
REFERENCE   3  (bases 1 to 1869)
  AUTHORS   Libe,R., Horvath,A., Vezzosi,D., Fratticci,A., Coste,J.,
            Perlemoine,K., Ragazzon,B., Guillaud-Bataille,M., Groussin,L.,
            Clauser,E., Raffin-Sanson,M.L., Siegel,J., Moran,J.,
            Drori-Herishanu,L., Faucz,F.R., Lodish,M., Nesterova,M.,
            Bertagna,X., Bertherat,J. and Stratakis,C.A.
  TITLE     Frequent phosphodiesterase 11A gene (PDE11A) defects in patients
            with Carney complex (CNC) caused by PRKAR1A mutations: PDE11A may
            contribute to adrenal and testicular tumors in CNC as a modifier of
            the phenotype
  JOURNAL   J. Clin. Endocrinol. Metab. 96 (1), E208-E214 (2011)
   PUBMED   21047926
  REMARK    GeneRIF: We demonstrate, in a large cohort of Carney Complex
            patients, a high frequency of PDE11A variants, suggesting that
            PDE11A is a genetic modifying factor for the development of
            testicular and adrenal tumors in patients with germline PRKAR1A
            mutation.
            GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   4  (bases 1 to 1869)
  AUTHORS   Lango Allen,H., Estrada,K., Lettre,G., Berndt,S.I., Weedon,M.N.,
            Rivadeneira,F., Willer,C.J., Jackson,A.U., Vedantam,S.,
            Raychaudhuri,S., Ferreira,T., Wood,A.R., Weyant,R.J., Segre,A.V.,
            Speliotes,E.K., Wheeler,E., Soranzo,N., Park,J.H., Yang,J.,
            Gudbjartsson,D., Heard-Costa,N.L., Randall,J.C., Qi,L., Vernon
            Smith,A., Magi,R., Pastinen,T., Liang,L., Heid,I.M., Luan,J.,
            Thorleifsson,G., Winkler,T.W., Goddard,M.E., Sin Lo,K., Palmer,C.,
            Workalemahu,T., Aulchenko,Y.S., Johansson,A., Zillikens,M.C.,
            Feitosa,M.F., Esko,T., Johnson,T., Ketkar,S., Kraft,P., Mangino,M.,
            Prokopenko,I., Absher,D., Albrecht,E., Ernst,F., Glazer,N.L.,
            Hayward,C., Hottenga,J.J., Jacobs,K.B., Knowles,J.W., Kutalik,Z.,
            Monda,K.L., Polasek,O., Preuss,M., Rayner,N.W., Robertson,N.R.,
            Steinthorsdottir,V., Tyrer,J.P., Voight,B.F., Wiklund,F., Xu,J.,
            Zhao,J.H., Nyholt,D.R., Pellikka,N., Perola,M., Perry,J.R.,
            Surakka,I., Tammesoo,M.L., Altmaier,E.L., Amin,N., Aspelund,T.,
            Bhangale,T., Boucher,G., Chasman,D.I., Chen,C., Coin,L.,
            Cooper,M.N., Dixon,A.L., Gibson,Q., Grundberg,E., Hao,K., Juhani
            Junttila,M., Kaplan,L.M., Kettunen,J., Konig,I.R., Kwan,T.,
            Lawrence,R.W., Levinson,D.F., Lorentzon,M., McKnight,B.,
            Morris,A.P., Muller,M., Suh Ngwa,J., Purcell,S., Rafelt,S.,
            Salem,R.M., Salvi,E., Sanna,S., Shi,J., Sovio,U., Thompson,J.R.,
            Turchin,M.C., Vandenput,L., Verlaan,D.J., Vitart,V., White,C.C.,
            Ziegler,A., Almgren,P., Balmforth,A.J., Campbell,H., Citterio,L.,
            De Grandi,A., Dominiczak,A., Duan,J., Elliott,P., Elosua,R.,
            Eriksson,J.G., Freimer,N.B., Geus,E.J., Glorioso,N., Haiqing,S.,
            Hartikainen,A.L., Havulinna,A.S., Hicks,A.A., Hui,J., Igl,W.,
            Illig,T., Jula,A., Kajantie,E., Kilpelainen,T.O., Koiranen,M.,
            Kolcic,I., Koskinen,S., Kovacs,P., Laitinen,J., Liu,J., Lokki,M.L.,
            Marusic,A., Maschio,A., Meitinger,T., Mulas,A., Pare,G.,
            Parker,A.N., Peden,J.F., Petersmann,A., Pichler,I.,
            Pietilainen,K.H., Pouta,A., Ridderstrale,M., Rotter,J.I.,
            Sambrook,J.G., Sanders,A.R., Schmidt,C.O., Sinisalo,J., Smit,J.H.,
            Stringham,H.M., Bragi Walters,G., Widen,E., Wild,S.H.,
            Willemsen,G., Zagato,L., Zgaga,L., Zitting,P., Alavere,H.,
            Farrall,M., McArdle,W.L., Nelis,M., Peters,M.J., Ripatti,S., van
            Meurs,J.B., Aben,K.K., Ardlie,K.G., Beckmann,J.S., Beilby,J.P.,
            Bergman,R.N., Bergmann,S., Collins,F.S., Cusi,D., den Heijer,M.,
            Eiriksdottir,G., Gejman,P.V., Hall,A.S., Hamsten,A., Huikuri,H.V.,
            Iribarren,C., Kahonen,M., Kaprio,J., Kathiresan,S., Kiemeney,L.,
            Kocher,T., Launer,L.J., Lehtimaki,T., Melander,O., Mosley,T.H. Jr.,
            Musk,A.W., Nieminen,M.S., O'Donnell,C.J., Ohlsson,C., Oostra,B.,
            Palmer,L.J., Raitakari,O., Ridker,P.M., Rioux,J.D., Rissanen,A.,
            Rivolta,C., Schunkert,H., Shuldiner,A.R., Siscovick,D.S.,
            Stumvoll,M., Tonjes,A., Tuomilehto,J., van Ommen,G.J., Viikari,J.,
            Heath,A.C., Martin,N.G., Montgomery,G.W., Province,M.A., Kayser,M.,
            Arnold,A.M., Atwood,L.D., Boerwinkle,E., Chanock,S.J., Deloukas,P.,
            Gieger,C., Gronberg,H., Hall,P., Hattersley,A.T., Hengstenberg,C.,
            Hoffman,W., Lathrop,G.M., Salomaa,V., Schreiber,S., Uda,M.,
            Waterworth,D., Wright,A.F., Assimes,T.L., Barroso,I., Hofman,A.,
            Mohlke,K.L., Boomsma,D.I., Caulfield,M.J., Cupples,L.A.,
            Erdmann,J., Fox,C.S., Gudnason,V., Gyllensten,U., Harris,T.B.,
            Hayes,R.B., Jarvelin,M.R., Mooser,V., Munroe,P.B., Ouwehand,W.H.,
            Penninx,B.W., Pramstaller,P.P., Quertermous,T., Rudan,I.,
            Samani,N.J., Spector,T.D., Volzke,H., Watkins,H., Wilson,J.F.,
            Groop,L.C., Haritunians,T., Hu,F.B., Kaplan,R.C., Metspalu,A.,
            North,K.E., Schlessinger,D., Wareham,N.J., Hunter,D.J.,
            O'Connell,J.R., Strachan,D.P., Wichmann,H.E., Borecki,I.B., van
            Duijn,C.M., Schadt,E.E., Thorsteinsdottir,U., Peltonen,L.,
            Uitterlinden,A.G., Visscher,P.M., Chatterjee,N., Loos,R.J.,
            Boehnke,M., McCarthy,M.I., Ingelsson,E., Lindgren,C.M.,
            Abecasis,G.R., Stefansson,K., Frayling,T.M. and Hirschhorn,J.N.
  TITLE     Hundreds of variants clustered in genomic loci and biological
            pathways affect human height
  JOURNAL   Nature 467 (7317), 832-838 (2010)
   PUBMED   20881960
REFERENCE   5  (bases 1 to 1869)
  AUTHORS   DeWan,A.T., Triche,E.W., Xu,X., Hsu,L.I., Zhao,C., Belanger,K.,
            Hellenbrand,K., Willis-Owen,S.A., Moffatt,M., Cookson,W.O.,
            Himes,B.E., Weiss,S.T., Gauderman,W.J., Baurley,J.W., Gilliland,F.,
            Wilk,J.B., O'Connor,G.T., Strachan,D.P., Hoh,J. and Bracken,M.B.
  TITLE     PDE11A associations with asthma: results of a genome-wide
            association scan
  JOURNAL   J. Allergy Clin. Immunol. 126 (4), 871-873 (2010)
   PUBMED   20920776
  REMARK    GeneRIF: PDE11A SNP assocaited with allergic asthma.
            GeneRIF: Observational study and genome-wide association study of
            gene-disease association. (HuGE Navigator)
REFERENCE   6  (bases 1 to 1869)
  AUTHORS   Hetman,J.M., Robas,N., Baxendale,R., Fidock,M., Phillips,S.C.,
            Soderling,S.H. and Beavo,J.A.
  TITLE     Cloning and characterization of two splice variants of human
            phosphodiesterase 11A
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 97 (23), 12891-12895 (2000)
   PUBMED   11050148
REFERENCE   7  (bases 1 to 1869)
  AUTHORS   Yuasa,K., Kotera,J., Fujishige,K., Michibata,H., Sasaki,T. and
            Omori,K.
  TITLE     Isolation and characterization of two novel phosphodiesterase
            PDE11A variants showing unique structure and tissue-specific
            expression
  JOURNAL   J. Biol. Chem. 275 (40), 31469-31479 (2000)
   PUBMED   10906126
REFERENCE   8  (bases 1 to 1869)
  AUTHORS   Fawcett,L., Baxendale,R., Stacey,P., McGrouther,C., Harrow,I.,
            Soderling,S., Hetman,J., Beavo,J.A. and Phillips,S.C.
  TITLE     Molecular cloning and characterization of a distinct human
            phosphodiesterase gene family: PDE11A
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3702-3707 (2000)
   PUBMED   10725373
REFERENCE   9  (bases 1 to 1869)
  AUTHORS   Loughney,K., Martins,T.J., Harris,E.A., Sadhu,K., Hicks,J.B.,
            Sonnenburg,W.K., Beavo,J.A. and Ferguson,K.
  TITLE     Isolation and characterization of cDNAs corresponding to two human
            calcium, calmodulin-regulated, 3',5'-cyclic nucleotide
            phosphodiesterases
  JOURNAL   J. Biol. Chem. 271 (2), 796-806 (1996)
   PUBMED   8557689
REFERENCE   10 (bases 1 to 1869)
  AUTHORS   Beavo,J.A., Conti,M. and Heaslip,R.J.
  TITLE     Multiple cyclic nucleotide phosphodiesterases
  JOURNAL   Mol. Pharmacol. 46 (3), 399-405 (1994)
   PUBMED   7935318
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BX105579.1, AF281865.1 and
            AC073834.6.
            
            Summary: The 3',5'-cyclic nucleotides cAMP and cGMP function as
            second messengers in a wide variety of signal transduction
            pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs)
            catalyze the hydrolysis of cAMP and cGMP to the corresponding
            5'-monophosphates and provide a mechanism to downregulate cAMP and
            cGMP signaling. This gene encodes a member of the PDE protein
            superfamily. Mutations in this gene are a cause of Cushing disease
            and adrenocortical hyperplasia. Multiple transcript variants
            encoding different isoforms have been found for this gene.
            [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (2) contains a distinct 5' UTR and
            lacks an in-frame portion of the 5' coding region, compared to
            variant 4. The resulting isoform (2) has a shorter N-terminus,
            compared to isoform 4.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            CDS exon combination :: AF281865.1, HM771389.1 [ECO:0000331]
            RNAseq introns       :: mixed/partial sample support ERS025082,
                                    ERS025083 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-42                BX105579.1         1-42
            43-1822             AF281865.1         15-1794
            1823-1869           AC073834.6         122495-122541       c
FEATURES             Location/Qualifiers
     source          1..1869
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q31.2"
     gene            1..1869
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /note="phosphodiesterase 11A"
                     /db_xref="GeneID:50940"
                     /db_xref="HGNC:8773"
                     /db_xref="MIM:604961"
     exon            1..130
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    98..100
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /note="upstream in-frame stop codon"
     exon            131..220
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     CDS             134..1861
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /EC_number="3.1.4.35"
                     /EC_number="3.1.4.17"
                     /note="isoform 2 is encoded by transcript variant 2; cAMP
                     and cGMP cyclic nucleotide phosphodiesterase 11A; dual
                     3',5'-cyclic-AMP and -GMP phosphodiesterase 11A"
                     /codon_start=1
                     /product="dual 3',5'-cyclic-AMP and -GMP phosphodiesterase
                     11A isoform 2"
                     /protein_id="NP_001070826.1"
                     /db_xref="GI:116536089"
                     /db_xref="CCDS:CCDS46459.1"
                     /db_xref="GeneID:50940"
                     /db_xref="HGNC:8773"
                     /db_xref="MIM:604961"
                     /translation="
MQMYLPFCGIAISNAQLFAASRKEYERSRALLEVVNDLFEEQTDLEKIVKKIMHRAQTLLKCERCSVLLLEDIESPVVKFTKSFELMSPKCSADAENSFKESMEKSSYSDWLINNSIAELVASTGLPVNISDAYQDPRFDAEADQISGFHIRSVLCVPIWNSNHQIIGVAQVLNRLDGKPFDDADQRLFEAFVIFCGLGINNTIMYDQVKKSWAKQSVALDVLSYHATCSKAEVDKFKAANIPLVSELAIDDIHFDDFSLDVDAMITAALRMFMELGMVQKFKIDYETLCRWLLTVRKNYRMVLYHNWRHAFNVCQLMFAMLTTAGFQDILTEVEILAVIVGCLCHDLDHRGTNNAFQAKSGSALAQLYGTSATLEHHHFNHAVMILQSEGHNIFANLSSKEYSDLMQLLKQSILATDLTLYFERRTEFFELVSKGEYDWNIKNHRDIFRSMLMTACDLGAVTKPWEISRQVAELVTSEFFEQGDRERLELKLTPSAIFDRNRKDELPRLQLEWIDSICMPLYQALVKVNVKLKPMLDSVATNRSKWEELHQKRLLASTASSSPASVMVAKEDRN
"
     misc_feature    221..769
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /note="FOG: GAF domain [Signal transduction mechanisms];
                     Region: FhlA; COG2203"
                     /db_xref="CDD:32385"
     misc_feature    263..763
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /note="Domain present in phytochromes and cGMP-specific
                     phosphodiesterases; Region: GAF; smart00065"
                     /db_xref="CDD:197499"
     misc_feature    1046..1576
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /note="Metal dependent phosphohydrolases with conserved
                     'HD' motif; Region: HDc; cd00077"
                     /db_xref="CDD:28958"
     misc_feature    order(1061..1063,1169..1174,1505..1507)
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /note="Zn2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28958"
     misc_feature    1172..1174
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /note="Mg2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28958"
     exon            221..361
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       230
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78426895"
     variation       292
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77789692"
     variation       302
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74460362"
     variation       310
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76725221"
     exon            362..426
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       386
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75920749"
     exon            427..559
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       457
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78731210"
     variation       499
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77896877"
     exon            560..635
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     exon            636..703
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     exon            704..796
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     exon            797..847
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       816
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78384547"
     exon            848..994
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       872
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76110544"
     variation       884
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77934668"
     variation       898
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75157857"
     exon            995..1102
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       1032
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77597060"
     variation       1036
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77341035"
     variation       1093
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78730670"
     exon            1103..1212
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       1145
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74666005"
     variation       1204
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35194777"
     exon            1213..1303
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       1292
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79840971"
     exon            1304..1404
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       1357
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78690307"
     exon            1405..1482
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       1470
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75127279"
     exon            1483..1546
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     exon            1547..1621
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       1556
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75950476"
     variation       1563
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75226037"
     variation       1577
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79903863"
     exon            1622..1705
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       1635
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79384192"
     variation       1691
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74357545"
     exon            1706..1869
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /inference="alignment:Splign:1.39.8"
     variation       1706
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79400048"
     variation       1724
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75437575"
     variation       1781
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80129029"
     variation       1822..1823
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace=""
                     /replace="tcc"
                     /db_xref="dbSNP:3830637"
     variation       1838
                     /gene="PDE11A"
                     /gene_synonym="PPNAD2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74326729"
ORIGIN      
caagaaatgtagagggagaagagtgctggaagatgagtcaagaaaagtccactgtgtgttgggaatagattatgaagggctttgagtgtaggccctgtaagcaataggaagccatggaacagccagaaaggttatgcagatgtatcttccattttgtggaatcgccatatctaacgctcagctctttgctgcctcaaggaaagaatatgaaagaagcagagctttgctagaggtggttaatgacctctttgaagaacagactgacctggagaaaattgtcaagaaaataatgcatcgggcccaaactctgctgaaatgtgaacgctgttctgttttactcctagaggacatcgaatcaccagtggtgaaatttaccaaatcctttgaattgatgtccccaaagtgcagtgctgatgctgagaacagtttcaaagaaagcatggagaaatcatcatactccgactggctaataaataacagcattgctgagctggttgcttcaacaggccttccagtgaacatcagtgatgcctaccaggatccgcgctttgatgcagaggcagaccagatatctggttttcacataagatctgttctttgtgtccctatttggaatagcaaccaccaaataattggagtggctcaagtgttaaacagacttgatgggaaaccttttgatgatgcagatcaacgactttttgaggcttttgtcatcttttgtggacttggcatcaacaacacaattatgtatgatcaagtgaagaagtcctgggccaagcagtctgtggctcttgatgtgctatcataccatgcaacatgttcaaaagctgaagttgacaagtttaaggcagccaacatccctctggtgtcagaacttgccatcgatgacattcattttgatgacttttctctcgacgttgatgccatgatcacagctgctctccggatgttcatggagctggggatggtacagaaatttaaaattgactatgagacactgtgtaggtggcttttgacagtgaggaaaaactatcggatggttctataccacaactggagacatgccttcaacgtgtgtcagctgatgttcgcgatgttaaccactgctgggtttcaagacattctgaccgaggtggaaattttagcggtgattgtgggatgcctgtgtcatgacctcgaccacaggggaaccaacaatgccttccaagctaagagtggctctgccctggcccaactctatggaacctctgctaccttggagcatcaccatttcaaccacgccgtgatgatccttcaaagtgagggtcacaatatctttgctaacctgtcctccaaggaatatagtgaccttatgcagcttttgaagcagtcaatattggcaacagacctcacgctgtactttgagaggagaactgaattctttgaacttgtcagtaaaggagaatacgattggaacatcaaaaaccatcgtgatatatttcgatcaatgttaatgacagcctgtgaccttggagccgtgaccaaaccgtgggagatctccagacaggtggcagaacttgtaaccagtgagttcttcgaacaaggagatcgggagagattagagctcaaactcactccttcagcaatttttgatcggaaccggaaggatgaactgcctcggttgcaactggagtggattgatagcatctgcatgcctttgtatcaggcactggtgaaggtcaacgtgaaactgaagccgatgctagattcagtagctacaaacagaagtaagtgggaagagctacaccaaaaacgactgctggcctcaactgcctcatcctcccctgccagtgttatggtagccaaggaagacaggaactaaacctccag
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:50940 -> Molecular function: GO:0004112 [cyclic-nucleotide phosphodiesterase activity] evidence: NAS
            GeneID:50940 -> Molecular function: GO:0004114 [3',5'-cyclic-nucleotide phosphodiesterase activity] evidence: TAS
            GeneID:50940 -> Molecular function: GO:0004118 [cGMP-stimulated cyclic-nucleotide phosphodiesterase activity] evidence: IDA
            GeneID:50940 -> Molecular function: GO:0030552 [cAMP binding] evidence: IEA
            GeneID:50940 -> Molecular function: GO:0030553 [cGMP binding] evidence: IDA
            GeneID:50940 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:50940 -> Molecular function: GO:0047555 [3',5'-cyclic-GMP phosphodiesterase activity] evidence: IEA
            GeneID:50940 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IEA
            GeneID:50940 -> Biological process: GO:0007165 [signal transduction] evidence: IEA
            GeneID:50940 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:50940 -> Biological process: GO:0046069 [cGMP catabolic process] evidence: IEA
            GeneID:50940 -> Cellular component: GO:0005575 [cellular_component] evidence: ND
            GeneID:50940 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:50940 -> Cellular component: GO:0043204 [perikaryon] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001070826 -> EC 3.1.4.17
            NP_001070826 -> EC 3.1.4.35

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.