Home |
Help |
Advanced search
2024-04-16 17:33:27, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001067 5753 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens topoisomerase (DNA) II alpha 170kDa (TOP2A), mRNA.
ACCESSION NM_001067
VERSION NM_001067.3 GI:300193028
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 5753)
AUTHORS Chen,S., Huang,L., Liu,Y., Chen,C.M., Wu,J. and Shao,Z.M.
TITLE The predictive and prognostic significance of pre- and
post-treatment topoisomerase IIalpha in anthracycline-based
neoadjuvant chemotherapy for local advanced breast cancer
JOURNAL Eur J Surg Oncol 39 (6), 619-626 (2013)
PUBMED 23473851
REMARK GeneRIF: Topo IIalpha, together with HER-2, might help to select
for patients who could benefit from anthracycline-based neoadjuvant
chemotherapy and identify non-complete responders at a higher risk
of disease recurrence or death.
REFERENCE 2 (bases 1 to 5753)
AUTHORS Dykhuizen,E.C., Hargreaves,D.C., Miller,E.L., Cui,K., Korshunov,A.,
Kool,M., Pfister,S., Cho,Y.J., Zhao,K. and Crabtree,G.R.
TITLE BAF complexes facilitate decatenation of DNA by topoisomerase
IIalpha
JOURNAL Nature 497 (7451), 624-627 (2013)
PUBMED 23698369
REMARK GeneRIF: studies indicate that the ability of TOP2A to prevent DNA
entanglement at mitosis requires BAF complexes and suggest that
this activity contributes to the role of BAF subunits as tumour
suppressors
REFERENCE 3 (bases 1 to 5753)
AUTHORS Seol,Y., Gentry,A.C., Osheroff,N. and Neuman,K.C.
TITLE Chiral discrimination and writhe-dependent relaxation mechanism of
human topoisomerase IIalpha
JOURNAL J. Biol. Chem. 288 (19), 13695-13703 (2013)
PUBMED 23508957
REMARK GeneRIF: Mechanistic basis for chiral discrimination and
explanation for the effects of DNA twist and tension on eukaryotic
type IIA topoisomerases.
REFERENCE 4 (bases 1 to 5753)
AUTHORS Sundov,D., Caric,A., Mrklic,I., Gugic,D., Capkun,V., Hofman,I.D.,
Mise,B.P. and Tomic,S.
TITLE P53, MAPK, topoisomerase II alpha and Ki67 immunohistochemical
expression and KRAS/BRAF mutation in ovarian serous carcinomas
JOURNAL Diagn Pathol 8, 21 (2013)
PUBMED 23388101
REMARK GeneRIF: Report topoisomerase II alpha expression in ovarian serous
carcinoma.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 5753)
AUTHORS Keith,W.N., Tan,K.B. and Brown,R.
TITLE Amplification of the topoisomerase II alpha gene in a non-small
cell lung cancer cell line and characterisation of polymorphisms at
the human topoisomerase II alpha and beta loci in normal tissue
JOURNAL Genes Chromosomes Cancer 4 (2), 169-175 (1992)
PUBMED 1373318
REFERENCE 6 (bases 1 to 5753)
AUTHORS Tan,K.B., Dorman,T.E., Falls,K.M., Chung,T.D., Mirabelli,C.K.,
Crooke,S.T. and Mao,J.
TITLE Topoisomerase II alpha and topoisomerase II beta genes:
characterization and mapping to human chromosomes 17 and 3,
respectively
JOURNAL Cancer Res. 52 (1), 231-234 (1992)
PUBMED 1309226
REFERENCE 7 (bases 1 to 5753)
AUTHORS Bugg,B.Y., Danks,M.K., Beck,W.T. and Suttle,D.P.
TITLE Expression of a mutant DNA topoisomerase II in CCRF-CEM human
leukemic cells selected for resistance to teniposide
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (17), 7654-7658 (1991)
PUBMED 1652758
REFERENCE 8 (bases 1 to 5753)
AUTHORS Chung,T.D., Drake,F.H., Tan,K.B., Per,S.R., Crooke,S.T. and
Mirabelli,C.K.
TITLE Characterization and immunological identification of cDNA clones
encoding two human DNA topoisomerase II isozymes
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 86 (23), 9431-9435 (1989)
PUBMED 2556712
REFERENCE 9 (bases 1 to 5753)
AUTHORS Tsai-Pflugfelder,M., Liu,L.F., Liu,A.A., Tewey,K.M., Whang-Peng,J.,
Knutsen,T., Huebner,K., Croce,C.M. and Wang,J.C.
TITLE Cloning and sequencing of cDNA encoding human DNA topoisomerase II
and localization of the gene to chromosome region 17q21-22
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 85 (19), 7177-7181 (1988)
PUBMED 2845399
REFERENCE 10 (bases 1 to 5753)
AUTHORS Singh,S.P., Mohamed,R., Salmond,C. and Lavin,M.F.
TITLE Reduced DNA topoisomerase II activity in ataxia-telangiectasia
cells
JOURNAL Nucleic Acids Res. 16 (9), 3919-3929 (1988)
PUBMED 2836804
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB069825.1, BC140791.1 and
AC080112.15.
This sequence is a reference standard in the RefSeqGene project.
On Jul 7, 2010 this sequence version replaced gi:19913405.
Summary: This gene encodes a DNA topoisomerase, an enzyme that
controls and alters the topologic states of DNA during
transcription. This nuclear enzyme is involved in processes such as
chromosome condensation, chromatid separation, and the relief of
torsional stress that occurs during DNA transcription and
replication. It catalyzes the transient breaking and rejoining of
two strands of duplex DNA which allows the strands to pass through
one another, thus altering the topology of DNA. Two forms of this
enzyme exist as likely products of a gene duplication event. The
gene encoding this form, alpha, is localized to chromosome 17 and
the beta gene is localized to chromosome 3. The gene encoding this
enzyme functions as the target for several anticancer agents and a
variety of mutations in this gene have been associated with the
development of drug resistance. Reduced activity of this enzyme may
also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul
2010].
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC140791.1, J04088.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-130 DB069825.1 1-130
131-4755 BC140791.1 1-4625
4756-5753 AC080112.15 34180-35177
FEATURES Location/Qualifiers
source 1..5753
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="17"
/map="17q21-q22"
gene 1..5753
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="topoisomerase (DNA) II alpha 170kDa"
/db_xref="GeneID:7153"
/db_xref="HGNC:11989"
/db_xref="HPRD:00536"
/db_xref="MIM:126430"
exon 1..180
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
misc_feature 118..120
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="upstream in-frame stop codon"
CDS 160..4755
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/EC_number="5.99.1.3"
/note="DNA gyrase; DNA topoisomerase (ATP-hydrolyzing);
DNA topoisomerase II, 170 kD; DNA topoisomerase II, alpha
isozyme"
/codon_start=1
/product="DNA topoisomerase 2-alpha"
/protein_id="NP_001058.2"
/db_xref="GI:19913406"
/db_xref="CCDS:CCDS45672.1"
/db_xref="GeneID:7153"
/db_xref="HGNC:11989"
/db_xref="HPRD:00536"
/db_xref="MIM:126430"
/translation="
MEVSPLQPVNENMQVNKIKKNEDAKKRLSVERIYQKKTQLEHILLRPDTYIGSVELVTQQMWVYDEDVGINYREVTFVPGLYKIFDEILVNAADNKQRDPKMSCIRVTIDPENNLISIWNNGKGIPVVEHKVEKMYVPALIFGQLLTSSNYDDDEKKVTGGRNGYGAKLCNIFSTKFTVETASREYKKMFKQTWMDNMGRAGEMELKPFNGEDYTCITFQPDLSKFKMQSLDKDIVALMVRRAYDIAGSTKDVKVFLNGNKLPVKGFRSYVDMYLKDKLDETGNSLKVIHEQVNHRWEVCLTMSEKGFQQISFVNSIATSKGGRHVDYVADQIVTKLVDVVKKKNKGGVAVKAHQVKNHMWIFVNALIENPTFDSQTKENMTLQPKSFGSTCQLSEKFIKAAIGCGIVESILNWVKFKAQVQLNKKCSAVKHNRIKGIPKLDDANDAGGRNSTECTLILTEGDSAKTLAVSGLGVVGRDKYGVFPLRGKILNVREASHKQIMENAEINNIIKIVGLQYKKNYEDEDSLKTLRYGKIMIMTDQDQDGSHIKGLLINFIHHNWPSLLRHRFLEEFITPIVKVSKNKQEMAFYSLPEFEEWKSSTPNHKKWKVKYYKGLGTSTSKEAKEYFADMKRHRIQFKYSGPEDDAAISLAFSKKQIDDRKEWLTNFMEDRRQRKLLGLPEDYLYGQTTTYLTYNDFINKELILFSNSDNERSIPSMVDGLKPGQRKVLFTCFKRNDKREVKVAQLAGSVAEMSSYHHGEMSLMMTIINLAQNFVGSNNLNLLQPIGQFGTRLHGGKDSASPRYIFTMLSSLARLLFPPKDDHTLKFLYDDNQRVEPEWYIPIIPMVLINGAEGIGTGWSCKIPNFDVREIVNNIRRLMDGEEPLPMLPSYKNFKGTIEELAPNQYVISGEVAILNSTTIEISELPVRTWTQTYKEQVLEPMLNGTEKTPPLITDYREYHTDTTVKFVVKMTEEKLAEAERVGLHKVFKLQTSLTCNSMVLFDHVGCLKKYDTVLDILRDFFELRLKYYGLRKEWLLGMLGAESAKLNNQARFILEKIDGKIIIENKPKKELIKVLIQRGYDSDPVKAWKEAQQKVPDEEENEESDNEKETEKSDSVTDSGPTFNYLLDMPLWYLTKEKKDELCRLRNEKEQELDTLKRKSPSDLWKEDLATFIEELEAVEAKEKQDEQVGLPGKGGKAKGKKTQMAEVLPSPRGQRVIPRITIEMKAEAEKKNKKKIKNENTEGSPQEDGVELEGLKQRLEKKQKREPGTKTKKQTTLAFKPIKKGKKRNPWSDSESDRSSDESNFDVPPRETEPRRAATKTKFTMDLDSDEDFSDFDEKTDDEDFVPSDASPPKTKTSPKLSNKELKPQKSVVSDLEADDVKGSVPLSSSPPATHFPDETEITNPVPKKNVTVKKTAAKSQSSTSTTGAKKRAAPKGTKRDPALNSGVSQKPDPAKTKNRRKRKPSTSDDSDSNFEKIVSKAVTSKKSKGESDDFHMDFDSAVAPRAKSVRAKKPIKYLEESDEDDLF
"
misc_feature 160..162
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="N-acetylmethionine; propagated from
UniProtKB/Swiss-Prot (P11388.3); acetylation site"
misc_feature 169..171
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 244..3696
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="DNA topoisomerase 2; Provisional; Region: PLN03128"
/db_xref="CDD:178674"
misc_feature 244..246
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 244..246
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01498"
misc_feature 244..246
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01499"
misc_feature 244..246
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01502"
misc_feature 400..>681
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="Histidine kinase-like ATPases; This family includes
several ATP-binding proteins for example: histidine
kinase, DNA gyrase B, topoisomerases, heat shock protein
HSP90, phytochrome-like ATPases and DNA mismatch repair
proteins; Region: HATPase_c; cd00075"
/db_xref="CDD:28956"
misc_feature order(418..420,430..432,439..441,511..513,517..519,
523..525,529..534,649..660)
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:28956"
misc_feature 430..432
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="Mg2+ binding site [ion binding]; other site"
/db_xref="CDD:28956"
misc_feature order(523..525,529..531,649..651,655..657)
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="G-X-G motif; other site"
/db_xref="CDD:28956"
misc_feature 952..1410
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="TopoIIA_Trans_ScTopoIIA: Transducer domain, having
a ribosomal S5 domain 2-like fold, of the type found in
proteins of the type IIA family of DNA topoisomerases
similar to Saccharomyces cerevisiae Topo IIA. S.
cerevisiae Topo IIA is a homodimer encoded...; Region:
TopoIIA_Trans_ScTopoIIA; cd03481"
/db_xref="CDD:48469"
misc_feature 1003..1005
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
misc_feature 1183..1191
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (P11388.3);
Region: Interaction with DNA (Probable)"
misc_feature order(1222..1224,1234..1236,1279..1284)
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:48469"
misc_feature order(1285..1287,1291..1293)
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="ATP binding [chemical binding]; other site"
/db_xref="CDD:48469"
misc_feature 1522..1884
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="TOPRIM_TopoIIA: topoisomerase-primase (TOPRIM)
nucleotidyl transferase/hydrolase domain of the type found
in proteins of the type IIA family of DNA topoisomerases
similar to Saccharomyces cerevisiae Topoisomerase II.
TopoIIA enzymes cut both strands of...; Region:
TOPRIM_TopoIIA; cd03365"
/db_xref="CDD:173785"
misc_feature order(1540..1545,1552..1554,1780..1782,1786..1788,
1792..1794)
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="active site"
/db_xref="CDD:173785"
misc_feature order(1540..1542,1780..1782)
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="putative metal-binding site [ion binding]; other
site"
/db_xref="CDD:173785"
misc_feature 1624..1626
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="non-experimental evidence, no additional
details recorded"
/note="Interaction with DNA (By similarity); propagated
from UniProtKB/Swiss-Prot (P11388.3); other site"
misc_feature 1633..1635
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Interaction with DNA; propagated from
UniProtKB/Swiss-Prot (P11388.3); other site"
misc_feature 2140..2142
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Interaction with DNA; propagated from
UniProtKB/Swiss-Prot (P11388.3); other site"
misc_feature 2143..2145
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Interaction with DNA; propagated from
UniProtKB/Swiss-Prot (P11388.3); other site"
misc_feature 2290..3681
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="DNA Topoisomerase, subtype IIA; domain A';
bacterial DNA topoisomerase IV (C subunit, ParC),
bacterial DNA gyrases (A subunit, GyrA),mammalian DNA
toposiomerases II. DNA topoisomerases are essential
enzymes that regulate the conformational changes in
DNA...; Region: TOP4c; cd00187"
/db_xref="CDD:29149"
misc_feature order(2290..2370,2377..2424,2428..2484,2491..2535,
2545..2601,2605..2652,2653..2673,2680..2682)
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="CAP-like domain; other site"
/db_xref="CDD:29149"
misc_feature 2326..2328
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Interaction with DNA; propagated from
UniProtKB/Swiss-Prot (P11388.3); other site"
misc_feature 2428..2430
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Interaction with DNA; propagated from
UniProtKB/Swiss-Prot (P11388.3); other site"
misc_feature 2446..2448
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Interaction with DNA; propagated from
UniProtKB/Swiss-Prot (P11388.3); other site"
misc_feature 2569..2571
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="non-experimental evidence, no additional
details recorded"
/note="Transition state stabilizer (By similarity);
propagated from UniProtKB/Swiss-Prot (P11388.3); other
site"
misc_feature 2572..2574
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="active site"
/db_xref="CDD:29149"
misc_feature 2725..2727
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="non-experimental evidence, no additional
details recorded"
/note="Important for DNA bending, intercalates between
base pairs of target DNA (By similarity); propagated from
UniProtKB/Swiss-Prot (P11388.3); other site"
misc_feature 2950..2952
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Interaction with DNA; propagated from
UniProtKB/Swiss-Prot (P11388.3); other site"
misc_feature 3127..3156
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P11388.3);
Region: Interaction with DNA"
misc_feature 3211..3243
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P11388.3);
Region: Nuclear export signal"
misc_feature order(3325..3333,3340..3345,3367..3372,3535..3585)
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="primary dimer interface [polypeptide binding];
other site"
/db_xref="CDD:29149"
misc_feature 3475..3477
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by CK1; propagated from
UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
misc_feature 3475..3477
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3772..3774
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
misc_feature 3796..3798
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 3796..3798
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00302"
misc_feature 3796..3798
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3796..3798
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3898..3900
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 3898..3900
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00302"
misc_feature 3898..3900
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 4042..4044
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4042..4044
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 4048..4050
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4048..4050
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 4054..4056
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4063..4065
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4153..4155
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4168..4170
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4186..4188
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by PLK3; propagated from
UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
misc_feature 4186..4188
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 4210..4212
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4210..4212
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 4219..4221
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4219..4221
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00302"
misc_feature 4219..4221
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 4240..4242
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00302"
misc_feature 4279..4281
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4288..4290
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4288..4290
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 4288..4290
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 4318..4320
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4318..4320
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 4333..4335
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4336..4338
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4336..4338
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00302"
misc_feature 4462..4728
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/note="DTHCT (NUC029) region; Region: DTHCT; pfam08070"
/db_xref="CDD:149254"
misc_feature 4504..4506
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4564..4566
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by CK2; propagated from
UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
misc_feature 4564..4566
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 4564..4566
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 4567..4569
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
misc_feature 4570..4572
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4579..4581
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4579..4581
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 4585..4587
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4642..4644
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4669..4671
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4732..4734
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P11388.3); phosphorylation site"
misc_feature 4732..4734
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 4732..4734
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
exon 181..336
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 337..427
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 428..491
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 492..637
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 638..735
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 736..948
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 949..1122
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 1123..1224
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 1225..1362
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 1363..1501
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 1502..1659
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 1660..1785
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 1786..1896
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 1897..2002
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 2003..2112
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 2113..2205
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 2206..2320
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 2321..2442
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 2443..2591
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 2592..2823
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 2824..2958
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 2959..3159
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 3160..3355
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 3356..3447
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 3448..3612
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 3613..3696
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 3697..3879
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
variation 3749
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1804537"
variation 3765
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1061692"
variation 3858
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1141364"
exon 3880..3970
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 3971..4123
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
variation 4093
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1804538"
STS 4110..4290
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/standard_name="D17S1435E"
/db_xref="UniSTS:150473"
exon 4124..4247
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
variation 4130
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/replace="a"
/replace="c"
/db_xref="dbSNP:28969502"
exon 4248..4291
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 4292..4426
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
exon 4427..4626
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
variation 4571
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1804539"
exon 4627..5753
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/inference="alignment:Splign:1.39.8"
STS 4637..4865
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/standard_name="GDB:180937"
/db_xref="UniSTS:155131"
variation 4702
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/replace="g"
/replace="t"
/db_xref="dbSNP:11540720"
STS 4756..4908
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/standard_name="SHGC-12497"
/db_xref="UniSTS:6329"
STS 5249..5520
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/standard_name="RH17658"
/db_xref="UniSTS:7622"
variation 5333
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/replace="a"
/replace="g"
/db_xref="dbSNP:13695"
STS 5542..5667
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/standard_name="SHGC-31685"
/db_xref="UniSTS:70696"
variation 5563
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1064288"
polyA_signal 5726..5731
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
polyA_site 5753
/gene="TOP2A"
/gene_synonym="TOP2; TP2A"
ORIGIN
gattggctggtctgcttcgggcgggctaaaggaaggttcaagtggagctctcctaaccgacgcgcgtctgtggagaagcggcttggtcgggggtggtctcgtggggtcctgcctgtttagtcgctttcagggttcttgagccccttcacgaccgtcaccatggaagtgtcaccattgcagcctgtaaatgaaaatatgcaagtcaacaaaataaagaaaaatgaagatgctaagaaaagactgtctgttgaaagaatctatcaaaagaaaacacaattggaacatattttgctccgcccagacacctacattggttctgtggaattagtgacccagcaaatgtgggtttacgatgaagatgttggcattaactatagggaagtcacttttgttcctggtttgtacaaaatctttgatgagattctagttaatgctgcggacaacaaacaaagggacccaaaaatgtcttgtattagagtcacaattgatccggaaaacaatttaattagtatatggaataatggaaaaggtattcctgttgttgaacacaaagttgaaaagatgtatgtcccagctctcatatttggacagctcctaacttctagtaactatgatgatgatgaaaagaaagtgacaggtggtcgaaatggctatggagccaaattgtgtaacatattcagtaccaaatttactgtggaaacagccagtagagaatacaagaaaatgttcaaacagacatggatggataatatgggaagagctggtgagatggaactcaagcccttcaatggagaagattatacatgtatcacctttcagcctgatttgtctaagtttaaaatgcaaagcctggacaaagatattgttgcactaatggtcagaagagcatatgatattgctggatccaccaaagatgtcaaagtctttcttaatggaaataaactgccagtaaaaggatttcgtagttatgtggacatgtatttgaaggacaagttggatgaaactggtaactccttgaaagtaatacatgaacaagtaaaccacaggtgggaagtgtgtttaactatgagtgaaaaaggctttcagcaaattagctttgtcaacagcattgctacatccaagggtggcagacatgttgattatgtagctgatcagattgtgactaaacttgttgatgttgtgaagaagaagaacaagggtggtgttgcagtaaaagcacatcaggtgaaaaatcacatgtggatttttgtaaatgccttaattgaaaacccaacctttgactctcagacaaaagaaaacatgactttacaacccaagagctttggatcaacatgccaattgagtgaaaaatttatcaaagctgccattggctgtggtattgtagaaagcatactaaactgggtgaagtttaaggcccaagtccagttaaacaagaagtgttcagctgtaaaacataatagaatcaagggaattcccaaactcgatgatgccaatgatgcagggggccgaaactccactgagtgtacgcttatcctgactgagggagattcagccaaaactttggctgtttcaggccttggtgtggttgggagagacaaatatggggttttccctcttagaggaaaaatactcaatgttcgagaagcttctcataagcagatcatggaaaatgctgagattaacaatatcatcaagattgtgggtcttcagtacaagaaaaactatgaagatgaagattcattgaagacgcttcgttatgggaagataatgattatgacagatcaggaccaagatggttcccacatcaaaggcttgctgattaattttatccatcacaactggccctctcttctgcgacatcgttttctggaggaatttatcactcccattgtaaaggtatctaaaaacaagcaagaaatggcattttacagccttcctgaatttgaagagtggaagagttctactccaaatcataaaaaatggaaagtcaaatattacaaaggtttgggcaccagcacatcaaaggaagctaaagaatactttgcagatatgaaaagacatcgtatccagttcaaatattctggtcctgaagatgatgctgctatcagcctggcctttagcaaaaaacagatagatgatcgaaaggaatggttaactaatttcatggaggatagaagacaacgaaagttacttgggcttcctgaggattacttgtatggacaaactaccacatatctgacatataatgacttcatcaacaaggaacttatcttgttctcaaattctgataacgagagatctatcccttctatggtggatggtttgaaaccaggtcagagaaaggttttgtttacttgcttcaaacggaatgacaagcgagaagtaaaggttgcccaattagctggatcagtggctgaaatgtcttcttatcatcatggtgagatgtcactaatgatgaccattatcaatttggctcagaattttgtgggtagcaataatctaaacctcttgcagcccattggtcagtttggtaccaggctacatggtggcaaggattctgctagtccacgatacatctttacaatgctcagctctttggctcgattgttatttccaccaaaagatgatcacacgttgaagtttttatatgatgacaaccagcgtgttgagcctgaatggtacattcctattattcccatggtgctgataaatggtgctgaaggaatcggtactgggtggtcctgcaaaatccccaactttgatgtgcgtgaaattgtaaataacatcaggcgtttgatggatggagaagaacctttgccaatgcttccaagttacaagaacttcaagggtactattgaagaactggctccaaatcaatatgtgattagtggtgaagtagctattcttaattctacaaccattgaaatctcagagcttcccgtcagaacatggacccagacatacaaagaacaagttctagaacccatgttgaatggcaccgagaagacacctcctctcataacagactatagggaataccatacagataccactgtgaaatttgttgtgaagatgactgaagaaaaactggcagaggcagagagagttggactacacaaagtcttcaaactccaaactagtctcacatgcaactctatggtgctttttgaccacgtaggctgtttaaagaaatatgacacggtgttggatattctaagagacttttttgaactcagacttaaatattatggattaagaaaagaatggctcctaggaatgcttggtgctgaatctgctaaactgaataatcaggctcgctttatcttagagaaaatagatggcaaaataatcattgaaaataagcctaagaaagaattaattaaagttctgattcagaggggatatgattcggatcctgtgaaggcctggaaagaagcccagcaaaaggttccagatgaagaagaaaatgaagagagtgacaacgaaaaggaaactgaaaagagtgactccgtaacagattctggaccaaccttcaactatcttcttgatatgcccctttggtatttaaccaaggaaaagaaagatgaactctgcaggctaagaaatgaaaaagaacaagagctggacacattaaaaagaaagagtccatcagatttgtggaaagaagacttggctacatttattgaagaattggaggctgttgaagccaaggaaaaacaagatgaacaagtcggacttcctgggaaaggggggaaggccaaggggaaaaaaacacaaatggctgaagttttgccttctccgcgtggtcaaagagtcattccacgaataaccatagaaatgaaagcagaggcagaaaagaaaaataaaaagaaaattaagaatgaaaatactgaaggaagccctcaagaagatggtgtggaactagaaggcctaaaacaaagattagaaaagaaacagaaaagagaaccaggtacaaagacaaagaaacaaactacattggcatttaagccaatcaaaaaaggaaagaagagaaatccctggtctgattcagaatcagataggagcagtgacgaaagtaattttgatgtccctccacgagaaacagagccacggagagcagcaacaaaaacaaaattcacaatggatttggattcagatgaagatttctcagattttgatgaaaaaactgatgatgaagattttgtcccatcagatgctagtccacctaagaccaaaacttccccaaaacttagtaacaaagaactgaaaccacagaaaagtgtcgtgtcagaccttgaagctgatgatgttaagggcagtgtaccactgtcttcaagccctcctgctacacatttcccagatgaaactgaaattacaaacccagttcctaaaaagaatgtgacagtgaagaagacagcagcaaaaagtcagtcttccacctccactaccggtgccaaaaaaagggctgccccaaaaggaactaaaagggatccagctttgaattctggtgtctctcaaaagcctgatcctgccaaaaccaagaatcgccgcaaaaggaagccatccacttctgatgattctgactctaattttgagaaaattgtttcgaaagcagtcacaagcaagaaatccaagggggagagtgatgacttccatatggactttgactcagctgtggctcctcgggcaaaatctgtacgggcaaagaaacctataaagtacctggaagagtcagatgaagatgatctgttttaaaatgtgaggcgattattttaagtaattatcttaccaagcccaagactggttttaaagttacctgaagctcttaacttcctcccctctgaatttagtttggggaaggtgtttttagtacaagacatcaaagtgaagtaaagcccaagtgttctttagctttttataatactgtctaaatagtgaccatctcatgggcattgttttcttctctgctttgtctgtgttttgagtctgctttcttttgtctttaaaacctgatttttaagttcttctgaactgtagaaatagctatctgatcacttcagcgtaaagcagtgtgtttattaaccatccactaagctaaaactagagcagtttgatttaaaagtgtcactcttcctccttttctactttcagtagatatgagatagagcataattatctgttttatcttagttttatacataatttaccatcagatagaactttatggttctagtacagatactctactacactcagcctcttatgtgccaagtttttctttaagcaatgagaaattgctcatgttcttcatcttctcaaatcatcagaggccgaagaaaaacactttggctgtgtctataacttgacacagtcaatagaatgaagaaaattagagtagttatgtgattatttcagctcttgacctgtcccctctggctgcctctgagtctgaatctcccaaagagagaaaccaatttctaagaggactggattgcagaagactcggggacaacatttgatccaagatcttaaatgttatattgataaccatgctcagcaatgagctattagattcattttgggaaatctccataatttcaatttgtaaactttgttaagacctgtctacattgttatatgtgtgtgacttgagtaatgttatcaacgtttttgtaaatatttactatgtttttctattagctaaattccaacaattttgtactttaataaaatgttctaaacattgcaaccca
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:7153 -> Molecular function: GO:0000287 [magnesium ion binding] evidence: IDA
GeneID:7153 -> Molecular function: GO:0003677 [DNA binding] evidence: IDA
GeneID:7153 -> Molecular function: GO:0003682 [chromatin binding] evidence: IDA
GeneID:7153 -> Molecular function: GO:0003918 [DNA topoisomerase type II (ATP-hydrolyzing) activity] evidence: IDA
GeneID:7153 -> Molecular function: GO:0005080 [protein kinase C binding] evidence: IPI
GeneID:7153 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:7153 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:7153 -> Molecular function: GO:0008022 [protein C-terminus binding] evidence: IPI
GeneID:7153 -> Molecular function: GO:0008094 [DNA-dependent ATPase activity] evidence: IDA
GeneID:7153 -> Molecular function: GO:0008144 [drug binding] evidence: IDA
GeneID:7153 -> Molecular function: GO:0008301 [DNA binding, bending] evidence: IDA
GeneID:7153 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
GeneID:7153 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
GeneID:7153 -> Molecular function: GO:0042826 [histone deacetylase binding] evidence: IPI
GeneID:7153 -> Molecular function: GO:0043130 [ubiquitin binding] evidence: IMP
GeneID:7153 -> Molecular function: GO:0046982 [protein heterodimerization activity] evidence: IPI
GeneID:7153 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:7153 -> Biological process: GO:0000712 [resolution of meiotic recombination intermediates] evidence: IBA
GeneID:7153 -> Biological process: GO:0000819 [sister chromatid segregation] evidence: IBA
GeneID:7153 -> Biological process: GO:0006260 [DNA replication] evidence: NAS
GeneID:7153 -> Biological process: GO:0006261 [DNA-dependent DNA replication] evidence: IBA
GeneID:7153 -> Biological process: GO:0006265 [DNA topological change] evidence: IBA
GeneID:7153 -> Biological process: GO:0006265 [DNA topological change] evidence: IDA
GeneID:7153 -> Biological process: GO:0006266 [DNA ligation] evidence: IDA
GeneID:7153 -> Biological process: GO:0006281 [DNA repair] evidence: NAS
GeneID:7153 -> Biological process: GO:0006312 [mitotic recombination] evidence: IBA
GeneID:7153 -> Biological process: GO:0006974 [response to DNA damage stimulus] evidence: IDA
GeneID:7153 -> Biological process: GO:0007059 [chromosome segregation] evidence: IMP
GeneID:7153 -> Biological process: GO:0030263 [apoptotic chromosome condensation] evidence: IDA
GeneID:7153 -> Biological process: GO:0040016 [embryonic cleavage] evidence: IEA
GeneID:7153 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IDA
GeneID:7153 -> Biological process: GO:0045070 [positive regulation of viral genome replication] evidence: IMP
GeneID:7153 -> Biological process: GO:0045870 [positive regulation of retroviral genome replication] evidence: IMP
GeneID:7153 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA
GeneID:7153 -> Biological process: GO:0048015 [phosphatidylinositol-mediated signaling] evidence: NAS
GeneID:7153 -> Cellular component: GO:0000228 [nuclear chromosome] evidence: IDA
GeneID:7153 -> Cellular component: GO:0000795 [synaptonemal complex] evidence: IBA
GeneID:7153 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:7153 -> Cellular component: GO:0005654 [nucleoplasm] evidence: IDA
GeneID:7153 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:7153 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:7153 -> Cellular component: GO:0005814 [centriole] evidence: IDA
GeneID:7153 -> Cellular component: GO:0009295 [nucleoid] evidence: IBA
GeneID:7153 -> Cellular component: GO:0009330 [DNA topoisomerase complex (ATP-hydrolyzing)] evidence: IDA
GeneID:7153 -> Cellular component: GO:0019035 [viral integration complex] evidence: NAS
GeneID:7153 -> Cellular component: GO:0043234 [protein complex] evidence: IPI
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001058 -> EC 5.99.1.3
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.