GGRNA Home | Help | Advanced search

2020-10-26 19:22:42, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001042646            5231 bp    mRNA    linear   PRI 20-APR-2013
DEFINITION  Homo sapiens trafficking protein, kinesin binding 1 (TRAK1),
            transcript variant 1, mRNA.
ACCESSION   NM_001042646
VERSION     NM_001042646.2  GI:388490360
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5231)
  AUTHORS   van Spronsen,M., Mikhaylova,M., Lipka,J., Schlager,M.A., van den
            Heuvel,D.J., Kuijpers,M., Wulf,P.S., Keijzer,N., Demmers,J.,
            Kapitein,L.C., Jaarsma,D., Gerritsen,H.C., Akhmanova,A. and
            Hoogenraad,C.C.
  TITLE     TRAK/Milton motor-adaptor proteins steer mitochondrial trafficking
            to axons and dendrites
  JOURNAL   Neuron 77 (3), 485-502 (2013)
   PUBMED   23395375
  REMARK    GeneRIF: The results of this study established a key role for
            mammalian TRAK1 proteins in axonal and dendritic targeting of
            mitochondria.
REFERENCE   2  (bases 1 to 5231)
  AUTHORS   Fox,C.S., Liu,Y., White,C.C., Feitosa,M., Smith,A.V.,
            Heard-Costa,N., Lohman,K., Johnson,A.D., Foster,M.C.,
            Greenawalt,D.M., Griffin,P., Ding,J., Newman,A.B., Tylavsky,F.,
            Miljkovic,I., Kritchevsky,S.B., Launer,L., Garcia,M.,
            Eiriksdottir,G., Carr,J.J., Gudnason,V., Harris,T.B., Cupples,L.A.
            and Borecki,I.B.
  CONSRTM   GIANT Consortium; MAGIC Consortium; GLGC Consortium
  TITLE     Genome-wide association for abdominal subcutaneous and visceral
            adipose reveals a novel locus for visceral fat in women
  JOURNAL   PLoS Genet. 8 (5), E1002695 (2012)
   PUBMED   22589738
REFERENCE   3  (bases 1 to 5231)
  AUTHORS   An,Y., Zhou,Y., Ren,G., Tian,Q., Lu,Y., Li,H., Li,K., Su,T., Xu,B.,
            Chen,S., Wang,T., Zhang,X., Nie,Y., Wang,X. and Zhao,Q.
  TITLE     Elevated expression of MGb2-Ag/TRAK1 is correlated with poor
            prognosis in patients with colorectal cancer
  JOURNAL   Int J Colorectal Dis 26 (11), 1397-1404 (2011)
   PUBMED   21573901
  REMARK    GeneRIF: MGb2-Ag/TRAK1 may play an important role in the
            development of colorectal cancer (CRC) and may be a valuable
            prognostic indicator of CRC.
REFERENCE   4  (bases 1 to 5231)
  AUTHORS   Xu,B., Roos,J.L., Dexheimer,P., Boone,B., Plummer,B., Levy,S.,
            Gogos,J.A. and Karayiorgou,M.
  TITLE     Exome sequencing supports a de novo mutational paradigm for
            schizophrenia
  JOURNAL   Nat. Genet. 43 (9), 864-868 (2011)
   PUBMED   21822266
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 5231)
  AUTHORS   Koutsopoulos,O.S., Laine,D., Osellame,L., Chudakov,D.M.,
            Parton,R.G., Frazier,A.E. and Ryan,M.T.
  TITLE     Human Miltons associate with mitochondria and induce
            microtubule-dependent remodeling of mitochondrial networks
  JOURNAL   Biochim. Biophys. Acta 1803 (5), 564-574 (2010)
   PUBMED   20230862
REFERENCE   6  (bases 1 to 5231)
  AUTHORS   Ozyildirim,A.M., Wistow,G.J., Gao,J., Wang,J., Dickinson,D.P.,
            Frierson,H.F. Jr. and Laurie,G.W.
  TITLE     The lacrimal gland transcriptome is an unusually rich source of
            rare and poorly characterized gene transcripts
  JOURNAL   Invest. Ophthalmol. Vis. Sci. 46 (5), 1572-1580 (2005)
   PUBMED   15851553
REFERENCE   7  (bases 1 to 5231)
  AUTHORS   Brickley,K., Smith,M.J., Beck,M. and Stephenson,F.A.
  TITLE     GRIF-1 and OIP106, members of a novel gene family of coiled-coil
            domain proteins: association in vivo and in vitro with kinesin
  JOURNAL   J. Biol. Chem. 280 (15), 14723-14732 (2005)
   PUBMED   15644324
  REMARK    GeneRIF: GRIF-1 and OIP106 have roles in protein and/or organelle
            transport in excitable cells in a manner analogous to glutamate
            receptor-interacting-protein 1
REFERENCE   8  (bases 1 to 5231)
  AUTHORS   Colland,F., Jacq,X., Trouplin,V., Mougin,C., Groizeleau,C.,
            Hamburger,A., Meil,A., Wojcik,J., Legrain,P. and Gauthier,J.M.
  TITLE     Functional proteomics mapping of a human signaling pathway
  JOURNAL   Genome Res. 14 (7), 1324-1332 (2004)
   PUBMED   15231748
REFERENCE   9  (bases 1 to 5231)
  AUTHORS   Iyer,S.P. and Hart,G.W.
  TITLE     Roles of the tetratricopeptide repeat domain in O-GlcNAc
            transferase targeting and protein substrate specificity
  JOURNAL   J. Biol. Chem. 278 (27), 24608-24616 (2003)
   PUBMED   12724313
REFERENCE   10 (bases 1 to 5231)
  AUTHORS   Iyer,S.P., Akimoto,Y. and Hart,G.W.
  TITLE     Identification and cloning of a novel family of coiled-coil domain
            proteins that interact with O-GlcNAc transferase
  JOURNAL   J. Biol. Chem. 278 (7), 5399-5409 (2003)
   PUBMED   12435728
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AB028965.1, AC018358.20 and H05058.1.
            On May 25, 2012 this sequence version replaced gi:111074531.
            
            Transcript Variant: This variant (1) represents the longest
            transcript and encodes the longest isoform (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB028965.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025083, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1310              AB028965.1         1-1310
            1311-1311           AC018358.20        74955-74955         c
            1312-1964           AB028965.1         1312-1964
            1965-2031           AC018358.20        60041-60107         c
            2032-4208           AB028965.1         2032-4208
            4209-5124           AC018358.20        44095-45010         c
            5125-5231           H05058.1           13-119              c
FEATURES             Location/Qualifiers
     source          1..5231
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3p22.1"
     gene            1..5231
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /note="trafficking protein, kinesin binding 1"
                     /db_xref="GeneID:22906"
                     /db_xref="HGNC:29947"
                     /db_xref="MIM:608112"
     exon            1..307
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    16..18
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /note="upstream in-frame stop codon"
     variation       51
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142994301"
     variation       92
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186605363"
     variation       115
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77837845"
     variation       152
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377715729"
     variation       161
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372672136"
     CDS             217..3078
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /note="isoform 1 is encoded by transcript variant 1;
                     OGT(O-Glc-NAc transferase)-interacting protein 106 KDa;
                     106 kDa O-GlcNAc transferase-interacting protein; milton
                     homolog 1; O-linked N-acetylglucosamine transferase
                     interacting protein 106"
                     /codon_start=1
                     /product="trafficking kinesin-binding protein 1 isoform 1"
                     /protein_id="NP_001036111.1"
                     /db_xref="GI:111074532"
                     /db_xref="CCDS:CCDS43072.1"
                     /db_xref="GeneID:22906"
                     /db_xref="HGNC:29947"
                     /db_xref="MIM:608112"
                     /translation="
MALVFQFGQPVRAQPLPGLCHGKLIRTNACDVCNSTDLPEVEIISLLEEQLPHYKLRADTIYGYDHDDWLHTPLISPDANIDLTTEQIEETLKYFLLCAERVGQMTKTYNDIDAVTRLLEEKERDLELAARIGQSLLKKNKTLTERNELLEEQVEHIREEVSQLRHELSMKDELLQFYTSAAEESEPESVCSTPLKRNESSSSVQNYFHLDSLQKKLKDLEEENVVLRSEASQLKTETITYEEKEQQLVNDCVKELRDANVQIASISEELAKKTEDAARQQEEITHLLSQIVDLQKKAKACAVENEELVQHLGAAKDAQRQLTAELRELEDKYAECMEMLHEAQEELKNLRNKTMPNTTSRRYHSLGLFPMDSLAAEIEGTMRKELQLEEAESPDITHQKRVFETVRNINQVVKQRSLTPSPMNIPGSNQSSAMNSLLSSCVSTPRSSFYGSDIGNVVLDNKTNSIILETEAADLGNDERSKKPGTPGTPGSHDLETALRRLSLRRENYLSERRFFEEEQERKLQELAEKGELRSGSLTPTESIMSLGTHSRFSEFTGFSGMSFSSRSYLPEKLQIVKPLEGSATLHHWQQLAQPHLGGILDPRPGVVTKGFRTLDVDLDEVYCLNDFEEDDTGDHISLPRLATSTPVQHPETSAHHPGKCMSQTNSTFTFTTCRILHPSDELTRVTPSLNSAPTPACGSTSHLKSTPVATPCTPRRLSLAESFTNTRESTTTMSTSLGLVWLLKERGISAAVYDPQSWDRAGRGSLLHSYTPKMAVIPSTPPNSPMQTPTSSPPSFEFKCTSPPYDNFLASKPASSILREVREKNVRSSESQTDVSVSNLNLVDKVRRFGVAKVVNSGRAHVPTLTEEQGPLLCGPPGPAPALVPRGLVPEGLPLRCPTVTSAIGGLQLNSGIRRNRSFPTMVGSSMQMKAPVTLTSGILMGAKLSKQTSLR
"
     misc_feature    355..1278
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /note="HAP1 N-terminal conserved region; Region: HAP1_N;
                     pfam04849"
                     /db_xref="CDD:191111"
     misc_feature    <1006..1284
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /note="ATP synthase B/B' CF(0); Region: ATP-synt_B;
                     cl07975"
                     /db_xref="CDD:212286"
     misc_feature    1291..1743
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9UPV9.1);
                     Region: Interaction with HGS"
     misc_feature    1447..1965
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /note="Kinesin associated protein; Region: Milton;
                     pfam12448"
                     /db_xref="CDD:152882"
     misc_feature    <2428..2784
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /note="Kinesin associated protein; Region: Milton;
                     pfam12448"
                     /db_xref="CDD:152882"
     variation       238
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116661356"
     variation       246
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200587226"
     variation       249
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201790561"
     variation       250
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201247968"
     variation       268
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200776452"
     variation       272
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371588367"
     variation       274
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369404508"
     variation       285
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373134176"
     variation       300
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148528673"
     exon            308..502
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       324
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35816590"
     variation       332
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199746888"
     variation       333
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149366200"
     variation       336
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374392581"
     variation       339
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61742102"
     variation       390
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370557370"
     variation       391
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201653558"
     variation       402
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201869432"
     variation       428
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201136046"
     variation       430
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200094446"
     variation       471
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144787494"
     variation       472
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368818504"
     variation       502
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148570524"
     exon            503..579
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       549
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368078209"
     variation       556
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113672596"
     exon            580..696
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       603
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377073086"
     variation       618
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138576547"
     variation       621
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141558684"
     variation       625
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369716330"
     variation       639
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145771761"
     variation       648
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11544368"
     variation       649
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376036345"
     variation       658
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373262345"
     exon            697..797
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       709
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200488500"
     variation       710
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139582244"
     variation       720
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377117839"
     variation       756
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41289564"
     variation       777
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368331030"
     exon            798..906
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       836
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145279682"
     variation       844
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144666749"
     variation       847
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371843104"
     variation       903
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141503991"
     exon            907..985
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       933
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375344264"
     variation       972
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151106971"
     exon            986..1116
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       993
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:150238883"
     variation       1031
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199959935"
     variation       1037
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368794100"
     variation       1074
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201576814"
     variation       1082
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145303759"
     variation       1103
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137886266"
     variation       1110
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188394460"
     exon            1117..1191
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       1119
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144162412"
     variation       1142
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376442996"
     variation       1146
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60098029"
     variation       1152
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369469560"
     variation       1158
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201397120"
     exon            1192..1329
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       1247
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144731827"
     variation       1267
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370668547"
     variation       1289
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139261502"
     variation       1310
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374334482"
     variation       1311
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9851455"
     variation       1327
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144710739"
     exon            1330..1406
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       1347
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376778379"
     variation       1364
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370150047"
     variation       1378
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146849711"
     variation       1389
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140638437"
     variation       1390
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200860677"
     variation       1394
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372269973"
     exon            1407..1643
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       1418
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371113304"
     variation       1460
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137919210"
     variation       1474
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374216835"
     variation       1494
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376316651"
     variation       1499
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370414753"
     variation       1506
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201859615"
     variation       1511
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138673537"
     variation       1515
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41289572"
     variation       1518
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:71315528"
     variation       1539
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368017667"
     variation       1540
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200470888"
     variation       1549
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148528290"
     variation       1566
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374390537"
     variation       1580
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77593921"
     variation       1588
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368474947"
     variation       1593
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34458401"
     variation       1632
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201574981"
     variation       1635
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143049389"
     variation       1636
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148568284"
     variation       1637
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376148227"
     exon            1644..1960
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       1655
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370817285"
     variation       1657
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377190225"
     variation       1667
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138190882"
     variation       1671
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367869302"
     variation       1677
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370176823"
     variation       1709
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143656268"
     variation       1731
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138239150"
     variation       1748
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148722617"
     variation       1749
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201849317"
     variation       1765
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146404227"
     variation       1767
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139748722"
     variation       1800
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369449368"
     variation       1810
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151087421"
     variation       1816
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372408014"
     variation       1819
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372066516"
     variation       1821
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375194394"
     variation       1822
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369505744"
     variation       1850
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199801758"
     variation       1852
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372573676"
     variation       1862
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377046178"
     variation       1871
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149693845"
     variation       1885
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116570962"
     variation       1888
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112579771"
     variation       1890
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146070004"
     variation       1900
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372868771"
     exon            1961..2179
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       1965
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2290134"
     variation       1998
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141984215"
     variation       2022
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370602561"
     variation       2023
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375255978"
     variation       2027
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376391168"
     variation       2031
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2290133"
     variation       2053
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200328694"
     variation       2076
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146401885"
     variation       2077
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148776693"
     variation       2138
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139555217"
     variation       2167
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370872544"
     exon            2180..2282
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       2180
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201054735"
     variation       2204
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4429604"
     variation       2244
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373148776"
     variation       2259
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375948939"
     variation       2270
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149186690"
     variation       2272
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200620651"
     exon            2283..5231
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /inference="alignment:Splign:1.39.8"
     variation       2317
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201591385"
     variation       2336
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367557305"
     variation       2352
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371347127"
     variation       2353
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34658873"
     variation       2398
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375388142"
     variation       2408
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369981537"
     variation       2436
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373074795"
     variation       2455
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376571547"
     variation       2473
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369637350"
     variation       2478
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199845964"
     variation       2532
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200326631"
     variation       2535
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377574781"
     variation       2556
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370271663"
     variation       2561
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112854798"
     variation       2564
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143591096"
     variation       2565
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371605989"
     variation       2570
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201913227"
     variation       2575
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370814776"
     variation       2587
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370449306"
     variation       2601
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368156482"
     variation       2629
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201202052"
     variation       2637
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371310346"
     variation       2644
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374797269"
     variation       2652
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368581162"
     variation       2694
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372654773"
     variation       2715
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146801161"
     variation       2718
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139506181"
     variation       2719
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373263839"
     variation       2721
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376836539"
     variation       2722
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369311365"
     variation       2726
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373182393"
     variation       2727
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377344183"
     variation       2728
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200189533"
     variation       2749
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201083471"
     variation       2755
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199940168"
     variation       2785
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374632575"
     variation       2791
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201359425"
     variation       2795
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144331199"
     variation       2797
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151056622"
     variation       2838
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374417967"
     variation       2849
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367958964"
     variation       2850
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370538765"
     variation       2854
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374048059"
     variation       2893
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367607651"
     variation       2948
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114355738"
     variation       2963
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375498931"
     variation       2995
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368843163"
     variation       3011
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372377789"
     variation       3015
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12487911"
     variation       3023
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202108921"
     variation       3030
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201359747"
     variation       3037
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186854113"
     variation       3058
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62257356"
     variation       3063
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190393094"
     variation       3067
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371966020"
     variation       3072
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376851043"
     variation       3073
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141054486"
     variation       3091
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369012054"
     variation       3095
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372698529"
     variation       3119..3121
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace=""
                     /replace="tct"
                     /db_xref="dbSNP:201567210"
     variation       3120..3122
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace=""
                     /replace="ctc"
                     /db_xref="dbSNP:3836498"
     variation       3157
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3774390"
     variation       3194
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:182223148"
     variation       3218
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3774391"
     variation       3219
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62257357"
     variation       3261
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368713549"
     variation       3341
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115538454"
     variation       3365
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377557230"
     variation       3445
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187148600"
     variation       3474
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141809893"
     variation       3483
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043610"
     variation       3485
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147114011"
     variation       3490
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137952046"
     variation       3517
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2029123"
     variation       3530
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189889969"
     variation       3583
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115020478"
     variation       3667
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182119823"
     variation       3799..3808
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace=""
                     /replace="gcagcccctc"
                     /db_xref="dbSNP:376261412"
     variation       3988
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141944781"
     variation       3989
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72871324"
     variation       4049
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:12554"
     variation       4122..4123
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:370994960"
     variation       4195
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043621"
     variation       4198
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1043622"
     variation       4209
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3755809"
     STS             4219..4467
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /standard_name="SHGC-53801"
                     /db_xref="UniSTS:67406"
     variation       4268
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143094407"
     variation       4293
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373494129"
     variation       4470
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4478056"
     variation       4565
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185598185"
     variation       4597
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369710307"
     variation       4682
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9156"
     variation       4704
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148443014"
     variation       4812
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148213056"
     variation       4869
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141267646"
     STS             4883..5021
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /standard_name="RH12755"
                     /db_xref="UniSTS:79757"
     variation       4930
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77412900"
     variation       4989
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9852424"
     STS             5000..5166
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /standard_name="D3S3827"
                     /db_xref="UniSTS:67486"
     variation       5039
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150758926"
     variation       5160
                     /gene="TRAK1"
                     /gene_synonym="MILT1; OIP106"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189985113"
ORIGIN      
aacaagatgagctgatagggttcccaggctgcctggagttacataacccattgtgcttccaggacagctcacaatcttaggatttgccctaacaagcaaactcagaaaactgctgaggaaggcacgggagggtggctgtgcgaggtactgccggggctgagctctcatggaggctctctctgttctctgaagtgcctttggagtttatgtctgcacatggcattggtttttcaattcgggcagcccgtcagggctcagcctctgccaggactctgccacggcaagctcattcggacaaacgcctgtgatgtgtgcaacagcaccgatcttccggaagtcgagatcattagcctgctggaggagcagctgccccattataagttaagagccgacaccatctacggttatgaccacgacgactggctccatacacctctcatttctccagatgccaacattgacctcacaaccgagcaaattgaagagacgttaaaatacttccttttatgtgctgaaagagttggccagatgactaagacatataatgacatagatgctgtcactcggcttcttgaggagaaagagcgggatttagaattggccgctcgcatcggccagtcgttgttgaagaagaacaagaccctaaccgagaggaacgagctgctggaggagcaggtggaacacatcagggaggaggtgtctcagctccggcatgagctgtccatgaaggatgagctgcttcagttctacaccagcgctgcggaggagagtgagcccgagtccgtttgctcaaccccgttgaagaggaatgagtcgtcctcctcagtccagaattactttcatttggattctcttcaaaagaagctgaaagaccttgaagaggagaatgttgtacttcgatccgaggccagccagctgaagacagagaccatcacctatgaggagaaggagcagcagctggtcaatgactgcgtgaaggagctgagggatgccaatgtccagattgctagtatctcagaggaactggccaagaagacggaagatgctgcccgccagcaagaggagatcacacacctgctatcgcaaatagttgatttgcagaaaaaggcaaaagcttgcgcagtggaaaatgaagaacttgtccagcatctgggggctgctaaggatgcccagcggcagctcacagccgagctgcgtgagctggaggacaagtacgcagagtgcatggagatgctgcatgaggcgcaggaggagctgaagaacctccggaacaaaaccatgcccaataccacgtctcggcgctaccactcactgggcctgtttcccatggattccttggcagcagagattgagggaacgatgcgcaaggagctgcagttggaagaggccgagtctccagacatcactcaccagaagcgtgtctttgagacagtaagaaacatcaaccaggttgtcaagcagagatctctgaccccttctcccatgaacatccccggctccaaccagtcctcggccatgaactccctcctgtccagctgcgtcagcaccccccggtccagcttctacggcagcgacataggcaacgtcgtcctcgacaacaagaccaacagcatcattctggaaacagaggcagccgacctgggaaacgatgagcggagtaagaagccggggacgccgggcaccccaggctcccacgacctggagacggcgctgaggcggctgtccctgcgccgggagaactacctctcggagaggaggttctttgaggaggagcaagagaggaagctccaggagctggcggagaagggcgagctgcgcagcggctccctcacacccactgagagcatcatgtccctgggcacgcactcccgcttctccgagttcaccggcttctctggcatgtccttcagcagccgctcctacctgcctgagaagctccagatcgtgaagccgctggaaggttccgccacacttcaccactggcagcagttggcccaacctcaccttgggggcatcctggacccccggcccggtgtggtcaccaagggcttccggacgctggatgttgacctggacgaagtgtactgccttaacgactttgaagaagatgacacaggtgaccacatttctctcccacgcctagctacctccactccagttcagcacccagagacctcagcgcaccatcctgggaagtgcatgtctcagaccaactccaccttcaccttcaccacctgtcgcatcctgcatccttcagatgagctcactcgggtcacaccaagccttaactcagccccaactccagcttgtggcagcaccagccacttgaaatccacgccggtggccacaccatgcactccacggagactgagcctggctgagtccttcactaacacccgtgagtccacgaccaccatgagcacatccctggggctcgtgtggctgttgaaggagcggggcatttctgctgccgtgtacgacccccagagctgggacagggccggccggggctccctcctgcactcctacacgcccaagatggctgtgatcccctctactccgccgaactcgcctatgcagacacccacatcctccccaccctcctttgagttcaagtgcacgagccctccctacgacaatttcctggcttccaagccagccagctccatcctgagggaagtgagagaaaagaacgtccgcagcagcgagagccagaccgacgtgtccgtctccaacctcaacctcgtggacaaagtcaggaggtttggggtggccaaagtggtgaactcagggcgagcccatgtccccaccttgactgaggagcagggacccctcctctgtgggcccccggggccagcaccagcccttgttcccagaggcctggtacctgagggcctgcccctcagatgccccactgtcaccagtgccatcggtgggctgcagctcaatagtggcatccggcggaatcgcagcttccccaccatggtgggatctagcatgcagatgaaagctcctgtgactctcacctcgggcatcttgatgggtgctaagctctccaaacaaactagcttacggtgaggactggaggggggccggttgccctagaggagacccacgttctcctctcttgctcccacctccctctcttccccccacagtgcactccctccctctgcccttctctgtccaccccctcctaagctagacaaatcaacctcgtgcctaatggaggaagtgtggaaactttgtaaaatgtgtacataggacttggagaccttgtgtccgccctgctctttcttccgatcccacaggaagtgcccctgcactgtcatcactctcacgaggacgtcacctgtgctaacctgggggaaggtggggtcctttcttctttccttttgagaagcactgaaactcccaagtgtgttcttatcccatggataggaaaccagtgaattccgtggctggcacaccacgagctgtcacgcggcacgggtcataacacatctgggtgtcatcggacacctcacctcgcccaccctgtaggagcgtaaggagcctccatcctcagccacgtgcagctgacgtggctttcctgatcggagggcttttcttttatgggtggcccagcttcttcaagaccttcactgctctgcctcagtggacagtcgtttcttttttgaggtgtgaccttttgttttcatgccttccccttgaagtcatcctgtgttttgtaatcagctgtcaggccaaatgtctgacccgaaagagaatgtatttacactcatgctgcgttgttcagcagcccctctgtgttctgtgtgatttgttttatttttccttttttttacatatatatgcagggaagtaatggtactggtagtgtatgttttctatgtggttcaaatatgaatttcgaacacaccaagccgctaatgagatagcagcttttttctgggacccagagtcacaaccaaattgatttaagaccggacccaagacacctttaacaataggactgaaaggaaaaaggatagggaaaaagcttattaaagaaatgtgtcaacaccaaatgtagaggggaagaaccacaaccaggcataataccaaaccggttccagggggaaacaaggctttggtattccgctggctccagcgctttttctgaaacccgaggctggccagggtgctgtcaccatgcggtctttgattgcagccattcaatgcccacatgcttttccttcttgtttcagaacagcacatggtcacaacaagatattttctttccctccaaagccttttgtctccttgtgcctctttttatccttaggaaaagatccaggtgcttgtgaaaagaatcatgaatgcaacaagggaggctggtcctgttgctgtcgccgattaagttttaaacttttatttattatttatgtctgccgtattttaaataaacattctcgttccttccagtttcagtcatagtgtgtctgtggcattccagtccaaccatgtgacttatttattctaatttgagggctgcactgtacaccatggtgtcctgtgacaccgtgttccagacatttatggaaggaaaacatcccatataaatgaaactgtcatgctgtgtcctccccggcagcagaagatgtgtccttccattgagtgagggtaaccttatgtccaccaaggatactttgagaaagcccctaaggaacaagcctcagtcccacggtttcagactatttattctctgaacacaagagtattggttaattatgttctcagctctccctgctgttgtatgtgtgcattcactgcaagtaacttatatctttttatttgaatgtattttaaagcagtagatagaataacaaaggaatatgaaaaccatggactgaatggaccattttatgtattcagagagagaagccactcatcattgccagaaataccatgtaaaaattggcagttcagaggttgcaatacttagtatagtaaataaataaacggtcaacattgtgcaaccactaccaaaaagtgtgttgtaatgcatcaaaaatcaacacaattttattcactaatgagtatcaataaaataagttcaaatgatggaaaccacactggtattctgatttgtattttgtttttatcttttcatcaaggagacgatctctttatgtaagacttgaaagtgtttagctctttgcaaaattaaatgaaaggcatatacttca
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:22906 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:22906 -> Molecular function: GO:0050811 [GABA receptor binding] evidence: IEA
            GeneID:22906 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: ISS
            GeneID:22906 -> Biological process: GO:0006493 [protein O-linked glycosylation] evidence: ISS
            GeneID:22906 -> Biological process: GO:0006605 [protein targeting] evidence: ISS
            GeneID:22906 -> Biological process: GO:0008333 [endosome to lysosome transport] evidence: IDA
            GeneID:22906 -> Cellular component: GO:0005634 [nucleus] evidence: ISS
            GeneID:22906 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:22906 -> Cellular component: GO:0005739 [mitochondrion] evidence: IDA
            GeneID:22906 -> Cellular component: GO:0005769 [early endosome] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.