GGRNA Home | Help | Advanced search

2019-03-23 03:43:00, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001040610            3532 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens elongation factor Tu GTP binding domain containing 1
            (EFTUD1), transcript variant 2, mRNA.
ACCESSION   NM_001040610
VERSION     NM_001040610.2  GI:111120340
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3532)
  AUTHORS   Dong,C., Beecham,A., Slifer,S., Wang,L., Blanton,S.H., Wright,C.B.,
            Rundek,T. and Sacco,R.L.
  TITLE     Genomewide linkage and peakwide association analyses of carotid
            plaque in Caribbean Hispanics
  JOURNAL   Stroke 41 (12), 2750-2756 (2010)
   PUBMED   20966410
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   2  (bases 1 to 3532)
  AUTHORS   Nicolas,E., Poitelon,Y., Chouery,E., Salem,N., Levy,N.,
            Megarbane,A. and Delague,V.
  TITLE     CAMOS, a nonprogressive, autosomal recessive, congenital cerebellar
            ataxia, is caused by a mutant zinc-finger protein, ZNF592
  JOURNAL   Eur. J. Hum. Genet. 18 (10), 1107-1113 (2010)
   PUBMED   20531441
REFERENCE   3  (bases 1 to 3532)
  AUTHORS   Harrington,J.J., Sherf,B., Rundlett,S., Jackson,P.D., Perry,R.,
            Cain,S., Leventhal,C., Thornton,M., Ramachandran,R.,
            Whittington,J., Lerner,L., Costanzo,D., McElligott,K., Boozer,S.,
            Mays,R., Smith,E., Veloso,N., Klika,A., Hess,J., Cothren,K., Lo,K.,
            Offenbacher,J., Danzig,J. and Ducar,M.
  TITLE     Creation of genome-wide protein expression libraries using random
            activation of gene expression
  JOURNAL   Nat. Biotechnol. 19 (5), 440-445 (2001)
   PUBMED   11329013
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC026624.8, BC014628.2 and AC026956.20.
            On Aug 3, 2006 this sequence version replaced gi:94966751.
            
            Transcript Variant: This variant (2) lacks two in-frame exons in
            the 5' coding region, compared to variant 1, which results in a
            shorter protein (isoform 2), compared to isoform 1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX538332.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-113               AC026624.8         24868-24980
            114-260             BC014628.2         1-147
            261-1449            BC014628.2         301-1489
            1450-1450           AC026624.8         67543-67543
            1451-2373           BC014628.2         1491-2413
            2374-2872           AC026956.20        208965-209463       c
            2873-3522           BC014628.2         2914-3563
            3523-3532           AC026956.20        187587-187596       c
FEATURES             Location/Qualifiers
     source          1..3532
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q25.2"
     gene            1..3532
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="elongation factor Tu GTP binding domain containing
                     1"
                     /db_xref="GeneID:79631"
                     /db_xref="HGNC:25789"
     exon            1..150
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     exon            151..260
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    161..163
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="upstream in-frame stop codon"
     CDS             170..3379
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="isoform 2 is encoded by transcript variant 2;
                     ribosome assembly 1 homolog; elongation factor Tu
                     GTP-binding domain-containing protein 1; elongation
                     factor-like 1"
                     /codon_start=1
                     /product="elongation factor Tu GTP-binding
                     domain-containing protein 1 isoform 2"
                     /protein_id="NP_001035700.1"
                     /db_xref="GI:94966752"
                     /db_xref="CCDS:CCDS42070.1"
                     /db_xref="GeneID:79631"
                     /db_xref="HGNC:25789"
                     /translation="
MVLNSLDKMIQLQKNTANIRNICVLAHVDHGNEEYLINLIDSPGHVDFSSEVSTAVRICDGCIIVVDAVEGVCPQTQAVLRQAWLENIRPVLVINKIDRLIVELKFTPQEAYSHLKNILEQINALTGTLFTSKVLEERAERETESQVNPNSEQGEQVYDWSTGLEDTDDSHLYFSPEQGNVVFTSAIDGWGFGIEHFARIYSQKIGIKKEVLMKTLWGDYYINMKAKKIMKGDQAKGKKPLFVQLILENIWSLYDAVLKKDKDKIDKIVTSLGLKIGAREARHSDPKVQINAICSQWLPISHAVLAMVCQKLPSPLDITAERVERLMCTGSQTFDSFPPETQALKAAFMKCGSEDTAPVIIFVSKMFAVDAKALPQNKPRPLTQEEIAQRRERARQRHAEKLAAAQGQAPLEPTQDGSAIETCPKGEEPRGDEQQVESMTPKPVLQEENNQESFIAFARVFSGVARRGKKIFVLGPKYSPLEFLRRVPLGFSAPPDGLPQVPHMAYCALENLYLLMGRELEYLEEVPPGNVLGIGGLQDFVLKSATLCSLPSCPPFIPLNFEATPIVRVAVEPKHPSEMPQLVKGMKLLNQADPCVQILIQETGEHVLVTAGEVHLQRCLDDLKERFAKIHISVSEPIIPFRETITKPPKVDMVNEEIGKQQKVAVIHQMKEDQSKIPEGIQVDSDGLITITTPNKLATLSVRAMPLPEEVTQILEENSDLIRSMEQLTSSLNEGENTHMIHQKTQEKIWEFKGKLEQHLTGRRWRNIVDQIWSFGPRKCGPNILVNKSEDFQNSVWTGPADKASKEASRYRDLGNSIVSGFQLATLSGPMCEEPLMGVCFVLEKWDLSKFEEQGASDLAKEGQEENETCSGGNENQELQDGCSEAFEKRTSQKGESPLTDCYGPFSGQLIATMKEACRYALQVKPQRLMAAMYTCDIMATGDVLGRVYAVLSKREGRVLQEEMKEGTDMFIIKAVLPVAESFGFADEIRKRTSGLASPQLVFSHWEIIPSDPFWVPTTEEEYLHFGEKADSENQARKYMNAVRKRKGLYVEEKIVEHAEKQRTLSKNK
"
     misc_feature    227..>262
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="P-loop containing Nucleoside Triphosphate
                     Hydrolases; Region: P-loop_NTPase; cl09099"
                     /db_xref="CDD:213113"
     misc_feature    245..262
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="G1 box; other site"
                     /db_xref="CDD:206648"
     misc_feature    <263..775
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="P-loop containing Nucleoside Triphosphate
                     Hydrolases; Region: P-loop_NTPase; cl09099"
                     /db_xref="CDD:213113"
     misc_feature    290..301
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="G3 box; other site"
                     /db_xref="CDD:206648"
     misc_feature    order(296..301,347..352)
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="Switch II region; other site"
                     /db_xref="CDD:206648"
     misc_feature    order(299..301,452..457,461..463,722..730)
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="GTP/Mg2+ binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:206648"
     misc_feature    452..463
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="G4 box; other site"
                     /db_xref="CDD:206648"
     misc_feature    722..730
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="G5 box; other site"
                     /db_xref="CDD:206648"
     misc_feature    1475..1819
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="EF2_snRNP_like_II: this subfamily represents domain
                     II of elongation factor (EF) EF-2 found eukaryotes and
                     archaea and, the C-terminal portion of the spliceosomal
                     human 116kD U5 small nuclear ribonucleoprotein (snRNP)
                     protein (U5-116 kD) and, its yeast...; Region:
                     eEF2_snRNP_like_II; cd03700"
                     /db_xref="CDD:58091"
     misc_feature    2075..2974
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="This family represents domain IV of archaeal and
                     eukaryotic elongation factor 2 (aeEF-2) and of an
                     evolutionarily conserved U5 snRNP-specific protein. U5
                     snRNP is a GTP-binding factor closely related to the
                     ribosomal translocase EF-2. In complex with GTP; Region:
                     aeEF2_snRNP_like_IV; cd01681"
                     /db_xref="CDD:58276"
     misc_feature    2963..3199
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /note="eEF2_snRNP_like_C: this family represents a
                     C-terminal domain of eukaryotic elongation factor 2
                     (eEF-2) and a homologous domain of the spliceosomal human
                     116kD U5 small nuclear ribonucleoprotein (snRNP) protein
                     (U5-116 kD) and, its yeast counterpart...; Region:
                     eEF2_snRNP_like_C; cd04096"
                     /db_xref="CDD:58066"
     exon            261..394
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     variation       319
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11548681"
     exon            395..532
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     exon            533..747
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     exon            748..871
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     exon            872..948
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     exon            949..1085
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     exon            1086..1208
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     exon            1209..1308
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     variation       1249
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2651721"
     exon            1309..1460
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     variation       1450
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2292189"
     exon            1461..1627
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     exon            1628..1766
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     exon            1767..1898
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     variation       1865
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1128431"
     exon            1899..2046
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     exon            2047..3005
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     STS             2134..2223
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /standard_name="1990"
                     /db_xref="UniSTS:69585"
     STS             2821..2941
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /standard_name="G54067"
                     /db_xref="UniSTS:109449"
     variation       2872
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4725"
     exon            3006..3190
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     exon            3191..3532
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /inference="alignment:Splign:1.39.8"
     STS             3365..3486
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /standard_name="A007G38"
                     /db_xref="UniSTS:16322"
     STS             3378..3505
                     /gene="EFTUD1"
                     /gene_synonym="FAM42A; HsT19294; RIA1"
                     /standard_name="SGC30254"
                     /db_xref="UniSTS:19780"
ORIGIN      
agagacgtgcgggtgaaaggtcgagcgacagccggccccgccccctggcgcgcgggcgtgtcggacccgcagagctctcggactttcggaagctctcggtgtgggtgcgacccgagagaaggagcggggctggtggggctgctgcagccgtcacaggaaataagtaatcatggtgctcaacagtttggataagatgattcaactccagaaaaacactgccaacatcaggaatatttgtgttttggctcatgttgaccatggtaatgaggagtacctgatcaatctgatagactctccaggacacgtggacttttcctcagaagtatcaaccgctgttcgcatttgtgatggatgcatcattgtggtagatgctgtggaaggagtctgtccacagacacaggcagttctgcgacaagcttggcttgaaaacatccgtccggttttagtgattaataagattgatcgcttgatagtggaactgaaattcaccccacaagaggcctattctcacctcaagaatattttagaacagattaatgcgctcacagggactctttttacttctaaagtcctagaagaaagagcagagagggagactgaatcccaagtgaatccaaattctgaacaaggagagcaagtatatgactggagcactggcttggaggacacagatgattctcacctttacttctctccagaacagggaaatgtggtgtttaccagtgcaatagatgggtggggctttggaattgagcacttcgccagaatctacagtcaaaaaattggcatcaaaaaggaagttcttatgaaaaccttgtggggagattactatataaatatgaaggctaaaaagatcatgaagggtgatcaggccaaaggaaagaaacctttatttgtacagttgatcctggaaaatatatggagtttgtatgatgctgttttgaaaaaggacaaagacaaaattgataaaatagtgacttctttaggattaaaaattggagcccgggaggcacgacattcagaccctaaagttcagatcaacgccatttgcagtcagtggctacccatatcccatgctgttcttgctatggtgtgtcagaaacttcctagtccccttgatattacagctgagagagtggagagactgatgtgcacaggatcacaaacttttgactcttttccaccagaaactcaagcactgaaagcagcttttatgaaatgtggaagtgaggacactgctccagttattatatttgtttccaaaatgtttgcagttgatgctaaggccttgcctcagaataagccaaggcctctcactcaagaagaaattgctcagagacgtgagcgtgcaagacaaaggcatgcagagaagcttgcagcagcacagggacaggcacccttggagcccacccaagatgggagtgccattgaaacatgtccaaaaggagaggagccaagaggtgacgagcaacaggtggaaagtatgacccctaaacctgtgctccaggaagaaaacaaccaagagtcttttattgcatttgctcgggtgttcagtggtgtggctcgaagaggaaagaaaatttttgtcttggggcccaaatacagtcctcttgagtttttacgaagggtaccattaggcttctcagctccaccagatggcctcccccaagtcccccacatggcatactgtgctctggaaaacctgtatcttctgatgggaagggaactggaatatctagaggaggtacctccaggaaatgtgctaggaataggaggccttcaagattttgtgctgaaatctgcaacactgtgtagcctgccatcctgcccaccatttataccactcaacttcgaagccactcctattgtgagagttgctgttgaaccaaaacatccaagtgaaatgcctcagctcgtaaaaggaatgaaactgttaaaccaggctgatccctgtgtccagattttaattcaggaaacgggagagcacgttttagtcacagcaggagaagtccaccttcagcgatgcctggatgacttaaaagaaaggtttgcaaagattcatatcagtgtatctgaacctattattccattcagagaaacaatcacaaaacccccaaaagttgacatggtcaatgaagaaataggcaaacagcaaaaagttgcagtcatacaccaaatgaaagaagatcaaagcaaaatccctgaaggaatccaagttgactctgacgggctaatcaccataacaactcccaataaacttgccacgctcagtgttcgagccatgccccttccagaagaagtcacccagattctggaagaaaatagtgatttgattcgttctatggagcagttgacatcctctttgaatgagggtgaaaatactcacatgattcatcagaagacccaagagaaaatttgggaattcaaaggaaaactggagcaacacctaacagggagaagatggaggaacattgttgaccaaatctggtcatttggcccaagaaaatgtgggcccaacatactagtcaataaaagtgaagattttcagaactcagtatggacaggtccagctgacaaagcttcaaaagaagccagtagataccgagatttgggcaatagcattgtgagtggcttccaactagcaaccctctctggccccatgtgtgaggagcctctcatgggtgtctgttttgttctggaaaaatgggacctaagtaaatttgaggaacaaggagcaagtgatctggcaaaagagggacaggaggaaaatgaaacctgttctggtggaaatgaaaaccaagagctacaagatggctgctctgaggcctttgagaagaggacatcacagaaaggagaatctccactcactgactgctatggacctttctcaggacagctaattgccaccatgaaagaagcatgtcgctatgcactgcaagtgaaacctcagcgcctgatggcagctatgtacacatgtgacatcatggccactggtgatgttctcggtcgagtctatgctgtcttgtcaaagagagaaggtcgggtacttcaagaagaaatgaaagaagggacagacatgttcatcatcaaggctgtgctgcctgttgctgaaagctttggttttgctgatgaaatcaggaagaggacaagtggcctggccagcccacaactagtattcagccattgggagatcattcccagtgaccccttctgggtgccaactactgaggaggaatacttgcactttggggagaaggctgactctgagaaccaagcccggaagtacatgaacgcagtacgaaagcggaaggggctttatgtggaagaaaagattgtggagcatgcagaaaagcagaggacactcagcaaaaataagtagctacctactactggtggattcttttccttatagtgaatttaaaagtatcatcaagggtttaatattgggaaaatttctttttgccacattatctctgtttattcactttcaataaagttgatccatataaatattttaaagaggatgttagag
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:79631 -> Molecular function: GO:0003746 [translation elongation factor activity] evidence: IEA
            GeneID:79631 -> Molecular function: GO:0003924 [GTPase activity] evidence: IDA
            GeneID:79631 -> Molecular function: GO:0005525 [GTP binding] evidence: IEA
            GeneID:79631 -> Molecular function: GO:0043022 [ribosome binding] evidence: IMP
            GeneID:79631 -> Biological process: GO:0006184 [GTP catabolic process] evidence: IDA
            GeneID:79631 -> Biological process: GO:0042256 [mature ribosome assembly] evidence: IMP

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.