2024-04-24 11:51:45, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001040056 1174 bp mRNA linear PRI 15-JUL-2013 DEFINITION Homo sapiens mitogen-activated protein kinase 3 (MAPK3), transcript variant 2, mRNA. ACCESSION NM_001040056 VERSION NM_001040056.2 GI:512749767 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1174) AUTHORS Piechota-Polanczyk,A., Demyanets,S., Nykonenko,O., Huk,I., Mittlboeck,M., Domenig,C.M., Neumayer,C., Wojta,J., Nanobachvili,J. and Klinger,M. TITLE Decreased tissue levels of cyclophilin A, a cyclosporine a target and phospho-ERK1/2 in simvastatin patients with abdominal aortic aneurysm JOURNAL Eur J Vasc Endovasc Surg 45 (6), 682-688 (2013) PUBMED 23558220 REMARK GeneRIF: Simvastatin-treated patients with abdominal aortic aneurysms exert lower CyPA mRNA/protein levels and a decreased amount of phospho-ERK1/2. REFERENCE 2 (bases 1 to 1174) AUTHORS Ruppert,C., Deiss,K., Herrmann,S., Vidal,M., Oezkur,M., Gorski,A., Weidemann,F., Lohse,M.J. and Lorenz,K. TITLE Interference with ERK(Thr188) phosphorylation impairs pathological but not physiological cardiac hypertrophy JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (18), 7440-7445 (2013) PUBMED 23589880 REMARK GeneRIF: Interference with ERK(Thr188) phosphorylation permits the impairment of ERK1/2-mediated cardiac hypertrophy without increasing cardiomyocyte death. REFERENCE 3 (bases 1 to 1174) AUTHORS Aguilera-Montilla,N., Chamorro,S., Nieto,C., Sanchez-Cabo,F., Dopazo,A., Fernandez-Salguero,P.M., Rodriguez-Fernandez,J.L., Pello,O.M., Andres,V., Cuenda,A., Alonso,B., Dominguez-Soto,A., Sanchez-Ramon,S. and Corbi,A.L. TITLE Aryl hydrocarbon receptor contributes to the MEK/ERK-dependent maintenance of the immature state of human dendritic cells JOURNAL Blood 121 (15), E108-E117 (2013) PUBMED 23430108 REMARK GeneRIF: Data indicate that the MEK-ERK signaling pathway contributes the maintenance of the immature state of monocyte-derived dendritic cells (MDDCs) is partly dependent on the activity of aryl hydrocarbon receptor (AhR). REFERENCE 4 (bases 1 to 1174) AUTHORS Tyagarajan,S.K., Ghosh,H., Yevenes,G.E., Imanishi,S.Y., Zeilhofer,H.U., Gerrits,B. and Fritschy,J.M. TITLE Extracellular signal-regulated kinase and glycogen synthase kinase 3beta regulate gephyrin postsynaptic aggregation and GABAergic synaptic function in a calpain-dependent mechanism JOURNAL J. Biol. Chem. 288 (14), 9634-9647 (2013) PUBMED 23408424 REMARK GeneRIF: Extracellular signal-regulated kinase and glycogen synthase kinase 3beta regulate gephyrin postsynaptic aggregation and GABAergic synaptic function in a calpain-dependent mechanism REFERENCE 5 (bases 1 to 1174) AUTHORS Ratajczak-Wrona,W., Jablonska,E., Garley,M., Jablonski,J. and Radziwon,P. TITLE Role of ERK1/2 kinase in the expression of iNOS by NDMA in human neutrophils JOURNAL Indian J. Exp. Biol. 51 (1), 73-80 (2013) PUBMED 23441482 REMARK GeneRIF: in human neutrophils, ERK1/2 kinase is not directly involved in the regulation of iNOS and NO production induced by NDMA; however, the kinase participates in superoxide anion production in these cells REFERENCE 6 (bases 1 to 1174) AUTHORS Guan,K.L. and Butch,E. TITLE Isolation and characterization of a novel dual specific phosphatase, HVH2, which selectively dephosphorylates the mitogen-activated protein kinase JOURNAL J. Biol. Chem. 270 (13), 7197-7203 (1995) PUBMED 7535768 REFERENCE 7 (bases 1 to 1174) AUTHORS Gonzalez,F.A., Raden,D.L., Rigby,M.R. and Davis,R.J. TITLE Heterogeneous expression of four MAP kinase isoforms in human tissues JOURNAL FEBS Lett. 304 (2-3), 170-178 (1992) PUBMED 1319925 REFERENCE 8 (bases 1 to 1174) AUTHORS Haycock,J.W., Ahn,N.G., Cobb,M.H. and Krebs,E.G. TITLE ERK1 and ERK2, two microtubule-associated protein 2 kinases, mediate the phosphorylation of tyrosine hydroxylase at serine-31 in situ JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (6), 2365-2369 (1992) PUBMED 1347949 REFERENCE 9 (bases 1 to 1174) AUTHORS Owaki,H., Makar,R., Boulton,T.G., Cobb,M.H. and Geppert,T.D. TITLE Extracellular signal-regulated kinases in T cells: characterization of human ERK1 and ERK2 cDNAs JOURNAL Biochem. Biophys. Res. Commun. 182 (3), 1416-1422 (1992) PUBMED 1540184 REFERENCE 10 (bases 1 to 1174) AUTHORS Pulverer,B.J., Kyriakis,J.M., Avruch,J., Nikolakaki,E. and Woodgett,J.R. TITLE Phosphorylation of c-jun mediated by MAP kinases JOURNAL Nature 353 (6345), 670-674 (1991) PUBMED 1922387 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA351318.1, DQ399291.1 and AY033607.1. On Jun 18, 2013 this sequence version replaced gi:91718896. Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2, also known as ERK1c) lacks several exons and its 3'-terminal exon extends past a splice site that is used in variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AY033607.1, BM548079.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-100 DA351318.1 1-100 101-875 DQ399291.1 1-775 876-1174 AY033607.1 776-1074 FEATURES Location/Qualifiers source 1..1174 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="16" /map="16p11.2" gene 1..1174 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /note="mitogen-activated protein kinase 3" /db_xref="GeneID:5595" /db_xref="HGNC:6877" /db_xref="MIM:601795" exon 1..270 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /inference="alignment:Splign:1.39.8" misc_feature 23..25 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /note="upstream in-frame stop codon" CDS 101..1174 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /EC_number="2.7.11.24" /note="isoform 2 is encoded by transcript variant 2; extracellular signal-regulated kinase 1; extracellular signal-related kinase 1; MAPK 1; MAP kinase isoform p44; insulin-stimulated MAP2 kinase; microtubule-associated protein 2 kinase" /codon_start=1 /product="mitogen-activated protein kinase 3 isoform 2" /protein_id="NP_001035145.1" /db_xref="GI:91718897" /db_xref="CCDS:CCDS42149.1" /db_xref="GeneID:5595" /db_xref="HGNC:6877" /db_xref="MIM:601795" /translation="
MAAAAAQGGGGGEPRRTEGVGPGVPGEVEMVKGQPFDVGPRYTQLQYIGEGAYGMVSSAYDHVRKTRVAIKKISPFEHQTYCQRTLREIQILLRFRHENVIGIRDILRASTLEAMRDVYIVQDLMETDLYKLLKSQQLSNDHICYFLYQILRGLKYIHSANVLHRDLKPSNLLINTTCDLKICDFGLARIADPEHDHTGFLTEYVATRWYRAPEIMLNSKGYTKSIDIWSVGCILAEMLSNRPIFPGKHYLDQLNHILGILGSPSQEDLNCIINMKARNYLQSLPSKTKVAWAKLFPKSDSKALDLLDRMLTFNPNKRITVEEALAHPYLEQYYDPTDEVGQSPAAVGLGAGEQGGT
" misc_feature 206..1132 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /note="Catalytic domain of Extracellular signal-Regulated Kinase 1 and 2-like Serine/Threonine Kinases; Region: STKc_ERK1_2_like; cd07849" /db_xref="CDD:143354" misc_feature 224..1090 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /note="Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220" /db_xref="CDD:197582" misc_feature order(242..253,257..262,266..268,305..307,311..313, 359..361,401..403,464..475,482..484,488..493,596..598, 602..604,608..613,617..619,647..652,659..661,704..706, 710..721,725..727,839..841) /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /note="active site" /db_xref="CDD:143354" misc_feature order(242..253,257..262,266..268,305..307,311..313, 401..403,464..475,482..484,491..493,608..613,617..619, 647..652) /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:143354" misc_feature order(359..361,488..490,596..598,602..604,659..661, 704..706,710..721,725..727,839..841) /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:143354" misc_feature order(392..394,476..481,491..496,503..508,521..526, 533..535,542..544,554..556,620..637,1097..1099,1103..1105, 1112..1114) /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /note="KIM docking site [polypeptide binding]; other site" /db_xref="CDD:143354" misc_feature 647..727 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /note="activation loop (A-loop); other site" /db_xref="CDD:143354" misc_feature 704..706 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:03479" misc_feature 710..712 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" exon 271..453 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /inference="alignment:Splign:1.39.8" exon 454..643 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /inference="alignment:Splign:1.39.8" exon 644..760 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /inference="alignment:Splign:1.39.8" exon 761..875 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /inference="alignment:Splign:1.39.8" exon 876..1007 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /inference="alignment:Splign:1.39.8" exon 1008..1174 /gene="MAPK3" /gene_synonym="ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3" /inference="alignment:Splign:1.39.8" ORIGIN
ctggcgcgcgcggccctgcgggtgacaggcaggcgggaaggggcggggcctcgggcggggccgccgtggggaggagggcggtgggaggggaggagtggagatggcggcggcggcggctcaggggggcgggggcggggagccccgtagaaccgagggggtcggcccgggggtcccgggggaggtggagatggtgaaggggcagccgttcgacgtgggcccgcgctacacgcagttgcagtacatcggcgagggcgcgtacggcatggtcagctcggcctatgaccacgtgcgcaagactcgcgtggccatcaagaagatcagccccttcgaacatcagacctactgccagcgcacgctccgggagatccagatcctgctgcgcttccgccatgagaatgtcatcggcatccgagacattctgcgggcgtccaccctggaagccatgagagatgtctacattgtgcaggacctgatggagactgacctgtacaagttgctgaaaagccagcagctgagcaatgaccatatctgctacttcctctaccagatcctgcggggcctcaagtacatccactccgccaacgtgctccaccgagatctaaagccctccaacctgctcatcaacaccacctgcgaccttaagatttgtgatttcggcctggcccggattgccgatcctgagcatgaccacaccggcttcctgacggagtatgtggctacgcgctggtaccgggccccagagatcatgctgaactccaagggctataccaagtccatcgacatctggtctgtgggctgcattctggctgagatgctctctaaccggcccatcttccctggcaagcactacctggatcagctcaaccacattctgggcatcctgggctccccatcccaggaggacctgaattgtatcatcaacatgaaggcccgaaactacctacagtctctgccctccaagaccaaggtggcttgggccaagcttttccccaagtcagactccaaagcccttgacctgctggaccggatgttaacctttaaccccaataaacggatcacagtggaggaagcgctggctcacccctacctggagcagtactatgacccgacggatgaggtgggccagtccccagcagcagtggggctgggggcaggggagcaggggggcacgtag
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5595 -> Molecular function: GO:0001784 [phosphotyrosine binding] evidence: IEA GeneID:5595 -> Molecular function: GO:0004707 [MAP kinase activity] evidence: IDA GeneID:5595 -> Molecular function: GO:0004707 [MAP kinase activity] evidence: NAS GeneID:5595 -> Molecular function: GO:0004707 [MAP kinase activity] evidence: TAS GeneID:5595 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:5595 -> Molecular function: GO:0005524 [ATP binding] evidence: NAS GeneID:5595 -> Molecular function: GO:0019902 [phosphatase binding] evidence: IPI GeneID:5595 -> Biological process: GO:0000165 [MAPK cascade] evidence: NAS GeneID:5595 -> Biological process: GO:0000165 [MAPK cascade] evidence: TAS GeneID:5595 -> Biological process: GO:0000186 [activation of MAPKK activity] evidence: TAS GeneID:5595 -> Biological process: GO:0000187 [activation of MAPK activity] evidence: TAS GeneID:5595 -> Biological process: GO:0001934 [positive regulation of protein phosphorylation] evidence: IMP GeneID:5595 -> Biological process: GO:0002224 [toll-like receptor signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0002755 [MyD88-dependent toll-like receptor signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0002756 [MyD88-independent toll-like receptor signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0006360 [transcription from RNA polymerase I promoter] evidence: TAS GeneID:5595 -> Biological process: GO:0006361 [transcription initiation from RNA polymerase I promoter] evidence: TAS GeneID:5595 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA GeneID:5595 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:5595 -> Biological process: GO:0006974 [response to DNA damage stimulus] evidence: IEA GeneID:5595 -> Biological process: GO:0007049 [cell cycle] evidence: IEA GeneID:5595 -> Biological process: GO:0007173 [epidermal growth factor receptor signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0007264 [small GTPase mediated signal transduction] evidence: TAS GeneID:5595 -> Biological process: GO:0007265 [Ras protein signal transduction] evidence: TAS GeneID:5595 -> Biological process: GO:0007411 [axon guidance] evidence: TAS GeneID:5595 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS GeneID:5595 -> Biological process: GO:0008286 [insulin receptor signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0008543 [fibroblast growth factor receptor signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0009887 [organ morphogenesis] evidence: IEA GeneID:5595 -> Biological process: GO:0010467 [gene expression] evidence: TAS GeneID:5595 -> Biological process: GO:0016310 [phosphorylation] evidence: IDA GeneID:5595 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA GeneID:5595 -> Biological process: GO:0019221 [cytokine-mediated signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0019233 [sensory perception of pain] evidence: IEA GeneID:5595 -> Biological process: GO:0030168 [platelet activation] evidence: TAS GeneID:5595 -> Biological process: GO:0030509 [BMP signaling pathway] evidence: IMP GeneID:5595 -> Biological process: GO:0031663 [lipopolysaccharide-mediated signaling pathway] evidence: IEA GeneID:5595 -> Biological process: GO:0032872 [regulation of stress-activated MAPK cascade] evidence: TAS GeneID:5595 -> Biological process: GO:0033129 [positive regulation of histone phosphorylation] evidence: IMP GeneID:5595 -> Biological process: GO:0034134 [toll-like receptor 2 signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0034138 [toll-like receptor 3 signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0034142 [toll-like receptor 4 signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0034146 [toll-like receptor 5 signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0034162 [toll-like receptor 9 signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0034166 [toll-like receptor 10 signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0035066 [positive regulation of histone acetylation] evidence: IMP GeneID:5595 -> Biological process: GO:0035666 [TRIF-dependent toll-like receptor signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0038083 [peptidyl-tyrosine autophosphorylation] evidence: IDA GeneID:5595 -> Biological process: GO:0038095 [Fc-epsilon receptor signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0038096 [Fc-gamma receptor signaling pathway involved in phagocytosis] evidence: TAS GeneID:5595 -> Biological process: GO:0038123 [toll-like receptor TLR1:TLR2 signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0038124 [toll-like receptor TLR6:TLR2 signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0043330 [response to exogenous dsRNA] evidence: IEA GeneID:5595 -> Biological process: GO:0045087 [innate immune response] evidence: TAS GeneID:5595 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IMP GeneID:5595 -> Biological process: GO:0048011 [neurotrophin TRK receptor signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0051090 [regulation of sequence-specific DNA binding transcription factor activity] evidence: TAS GeneID:5595 -> Biological process: GO:0051216 [cartilage development] evidence: IEA GeneID:5595 -> Biological process: GO:0051403 [stress-activated MAPK cascade] evidence: TAS GeneID:5595 -> Biological process: GO:0051493 [regulation of cytoskeleton organization] evidence: TAS GeneID:5595 -> Biological process: GO:0060397 [JAK-STAT cascade involved in growth hormone signaling pathway] evidence: TAS GeneID:5595 -> Biological process: GO:0070374 [positive regulation of ERK1 and ERK2 cascade] evidence: IMP GeneID:5595 -> Biological process: GO:0070498 [interleukin-1-mediated signaling pathway] evidence: IMP GeneID:5595 -> Biological process: GO:0070849 [response to epidermal growth factor stimulus] evidence: IDA GeneID:5595 -> Biological process: GO:0071260 [cellular response to mechanical stimulus] evidence: IEP GeneID:5595 -> Biological process: GO:0072584 [caveolin-mediated endocytosis] evidence: TAS GeneID:5595 -> Biological process: GO:0090170 [regulation of Golgi inheritance] evidence: TAS GeneID:5595 -> Biological process: GO:2000641 [regulation of early endosome to late endosome transport] evidence: TAS GeneID:5595 -> Biological process: GO:2000657 [negative regulation of apolipoprotein binding] evidence: IEA GeneID:5595 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:5595 -> Cellular component: GO:0005634 [nucleus] evidence: TAS GeneID:5595 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS GeneID:5595 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA GeneID:5595 -> Cellular component: GO:0005739 [mitochondrion] evidence: TAS GeneID:5595 -> Cellular component: GO:0005769 [early endosome] evidence: TAS GeneID:5595 -> Cellular component: GO:0005770 [late endosome] evidence: TAS GeneID:5595 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: TAS GeneID:5595 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:5595 -> Cellular component: GO:0005856 [cytoskeleton] evidence: TAS GeneID:5595 -> Cellular component: GO:0005901 [caveola] evidence: TAS GeneID:5595 -> Cellular component: GO:0005925 [focal adhesion] evidence: TAS GeneID:5595 -> Cellular component: GO:0015630 [microtubule cytoskeleton] evidence: IDA GeneID:5595 -> Cellular component: GO:0031143 [pseudopodium] evidence: IEA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_001035145 -> EC 2.7.11.24
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.