GGRNA Home | Help | Advanced search

2019-03-23 03:24:47, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001037341            4309 bp    mRNA    linear   PRI 14-JUL-2013
DEFINITION  Homo sapiens phosphodiesterase 4B, cAMP-specific (PDE4B),
            transcript variant d, mRNA.
ACCESSION   NM_001037341
VERSION     NM_001037341.1  GI:82799485
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4309)
  AUTHORS   Yang,J.J., Cheng,C., Devidas,M., Cao,X., Campana,D., Yang,W.,
            Fan,Y., Neale,G., Cox,N., Scheet,P., Borowitz,M.J., Winick,N.J.,
            Martin,P.L., Bowman,W.P., Camitta,B., Reaman,G.H., Carroll,W.L.,
            Willman,C.L., Hunger,S.P., Evans,W.E., Pui,C.H., Loh,M. and
            Relling,M.V.
  TITLE     Genome-wide association study identifies germline polymorphisms
            associated with relapse of childhood acute lymphoblastic leukemia
  JOURNAL   Blood 120 (20), 4197-4204 (2012)
   PUBMED   23007406
REFERENCE   2  (bases 1 to 4309)
  AUTHORS   Lee,J., Komatsu,K., Lee,B.C., Lim,J.H., Jono,H., Xu,H., Kai,H.,
            Zhang,Z.J., Yan,C. and Li,J.D.
  TITLE     Phosphodiesterase 4B mediates extracellular signal-regulated
            kinase-dependent up-regulation of mucin MUC5AC protein by
            Streptococcus pneumoniae by inhibiting cAMP-protein kinase
            A-dependent MKP-1 phosphatase pathway
  JOURNAL   J. Biol. Chem. 287 (27), 22799-22811 (2012)
   PUBMED   22610099
  REMARK    GeneRIF: PDE4B mediates ERK-dependent up-regulation of mucin MUC5AC
            by S. pneumoniae by inhibiting cAMP-PKA-dependent MKP-1 pathway.
REFERENCE   3  (bases 1 to 4309)
  AUTHORS   Benjamin,D.J., Cesarini,D., van der Loos,M.J., Dawes,C.T.,
            Koellinger,P.D., Magnusson,P.K., Chabris,C.F., Conley,D.,
            Laibson,D., Johannesson,M. and Visscher,P.M.
  TITLE     The genetic architecture of economic and political preferences
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 109 (21), 8026-8031 (2012)
   PUBMED   22566634
REFERENCE   4  (bases 1 to 4309)
  AUTHORS   Kashiwagi,E., Shiota,M., Yokomizo,A., Itsumi,M., Inokuchi,J.,
            Uchiumi,T. and Naito,S.
  TITLE     Downregulation of phosphodiesterase 4B (PDE4B) activates protein
            kinase A and contributes to the progression of prostate cancer
  JOURNAL   Prostate 72 (7), 741-751 (2012)
   PUBMED   22529021
  REMARK    GeneRIF: PDE4B was downregulated and the protein kinase A pathway
            was activated in castration-resistant LNCaP prostate cancer cells.
            PDE4B expression was reduced in advanced prostate cancer and PDE4B
            knockdown promoted castration-resistant growth of LNCaP cells.
REFERENCE   5  (bases 1 to 4309)
  AUTHORS   Newburn,E.N., Hyde,T.M., Ye,T., Morita,Y., Weinberger,D.R.,
            Kleinman,J.E. and Lipska,B.K.
  TITLE     Interactions of human truncated DISC1 proteins: implications for
            schizophrenia
  JOURNAL   Transl Psychiatry 1, E30 (2011)
   PUBMED   22832604
  REMARK    GeneRIF: Short Disrupted-in-Schizophrenia (DISC)1 splice variants
            show reduced or no binding to nudE nuclear distribution E homolog
            (NDEL)1 and PDE4B proteins but fully interact with
            fasciculation/elongation zeta (FEZ)1 and glycogen synthase kinase 3
            GSK3beta.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 4309)
  AUTHORS   Szpirer,C., Szpirer,J., Riviere,M., Swinnen,J., Vicini,E. and
            Conti,M.
  TITLE     Chromosomal localization of the human and rat genes (PDE4D and
            PDE4B) encoding the cAMP-specific phosphodiesterases 3 and 4
  JOURNAL   Cytogenet. Cell Genet. 69 (1-2), 11-14 (1995)
   PUBMED   7835077
REFERENCE   7  (bases 1 to 4309)
  AUTHORS   Bolger,G.B., Rodgers,L. and Riggs,M.
  TITLE     Differential CNS expression of alternative mRNA isoforms of the
            mammalian genes encoding cAMP-specific phosphodiesterases
  JOURNAL   Gene 149 (2), 237-244 (1994)
   PUBMED   7958996
REFERENCE   8  (bases 1 to 4309)
  AUTHORS   Bolger,G., Michaeli,T., Martins,T., St John,T., Steiner,B.,
            Rodgers,L., Riggs,M., Wigler,M. and Ferguson,K.
  TITLE     A family of human phosphodiesterases homologous to the dunce
            learning and memory gene product of Drosophila melanogaster are
            potential targets for antidepressant drugs
  JOURNAL   Mol. Cell. Biol. 13 (10), 6558-6571 (1993)
   PUBMED   8413254
REFERENCE   9  (bases 1 to 4309)
  AUTHORS   Obernolte,R., Bhakta,S., Alvarez,R., Bach,C., Zuppan,P.,
            Mulkins,M., Jarnagin,K. and Shelton,E.R.
  TITLE     The cDNA of a human lymphocyte cyclic-AMP phosphodiesterase (PDE
            IV) reveals a multigene family
  JOURNAL   Gene 129 (2), 239-247 (1993)
   PUBMED   8392015
REFERENCE   10 (bases 1 to 4309)
  AUTHORS   McLaughlin,M.M., Cieslinski,L.B., Burman,M., Torphy,T.J. and
            Livi,G.P.
  TITLE     A low-Km, rolipram-sensitive, cAMP-specific phosphodiesterase from
            human brain. Cloning and expression of cDNA, biochemical
            characterization of recombinant protein, and tissue distribution of
            mRNA
  JOURNAL   J. Biol. Chem. 268 (9), 6470-6476 (1993)
   PUBMED   8384210
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA103627.1, BC071607.1,
            BC101480.1, BC046161.1 and AW519027.1.
            This sequence is a reference standard in the RefSeqGene project.
            
            Summary: This gene is a member of the type IV, cyclic AMP
            (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family.
            Cyclic nucleotides are important second messengers that regulate
            and mediate a number of cellular responses to extracellular
            signals, such as hormones, light, and neurotransmitters. The cyclic
            nucleotide phosphodiesterases (PDEs) regulate the cellular
            concentrations of cyclic nucleotides and thereby play a role in
            signal transduction. This gene encodes a protein that specifically
            hydrolyzes cAMP. Altered activity of this protein has been
            associated with schizophrenia and bipolar affective disorder.
            Alternate transcriptional splice variants, encoding different
            isoforms, have been characterized. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (d) has a 5' UTR that is further
            upstream than variant a. Both variants a and d encode the same
            isoform (1, also referred to as PDE4B1 or Tm72).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC071607.1 [ECO:0000332]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-4                 DA103627.1         1-4
            5-783               BC071607.1         1-779
            784-2499            BC101480.1         679-2394
            2500-3572           BC071607.1         2494-3566
            3573-4147           BC046161.1         615-1189
            4148-4309           AW519027.1         1-162               c
FEATURES             Location/Qualifiers
     source          1..4309
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p31"
     gene            1..4309
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="phosphodiesterase 4B, cAMP-specific"
                     /db_xref="GeneID:5142"
                     /db_xref="HGNC:8781"
                     /db_xref="MIM:600127"
     exon            1..121
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       90
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74085349"
     exon            122..233
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       164
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12038009"
     misc_feature    165..167
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="upstream in-frame stop codon"
     variation       181
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138598652"
     variation       185
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368045878"
     CDS             192..2402
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /EC_number="3.1.4.17"
                     /note="isoform 1 is encoded by transcript variant d;
                     phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4
                     dunce homolog, Drosophila); dunce-like phosphodiesterase
                     E4; cAMP-specific 3',5'-cyclic phosphodiesterase 4B;
                     cAMP-specific phosphodiesterase-4 B isoform; PDE32"
                     /codon_start=1
                     /product="cAMP-specific 3',5'-cyclic phosphodiesterase 4B
                     isoform 1"
                     /protein_id="NP_001032418.1"
                     /db_xref="GI:82799486"
                     /db_xref="CCDS:CCDS632.1"
                     /db_xref="GeneID:5142"
                     /db_xref="HGNC:8781"
                     /db_xref="MIM:600127"
                     /translation="
MKKSRSVMTVMADDNVKDYFECSLSKSYSSSSNTLGIDLWRGRRCCSGNLQLPPLSQRQSERARTPEGDGISRPTTLPLTTLPSIAITTVSQECFDVENGPSPGRSPLDPQASSSAGLVLHATFPGHSQRRESFLYRSDSDYDLSPKAMSRNSSLPSEQHGDDLIVTPFAQVLASLRSVRNNFTILTNLHGTSNKRSPAASQPPVSRVNPQEESYQKLAMETLEELDWCLDQLETIQTYRSVSEMASNKFKRMLNRELTHLSEMSRSGNQVSEYISNTFLDKQNDVEIPSPTQKDREKKKKQQLMTQISGVKKLMHSSSLNNTSISRFGVNTENEDHLAKELEDLNKWGLNIFNVAGYSHNRPLTCIMYAIFQERDLLKTFRISSDTFITYMMTLEDHYHSDVAYHNSLHAADVAQSTHVLLSTPALDAVFTDLEILAAIFAAAIHDVDHPGVSNQFLINTNSELALMYNDESVLENHHLAVGFKLLQEEHCDIFMNLTKKQRQTLRKMVIDMVLATDMSKHMSLLADLKTMVETKKVTSSGVLLLDNYTDRIQVLRNMVHCADLSNPTKSLELYRQWTDRIMEEFFQQGDKERERGMEISPMCDKHTASVEKSQVGFIDYIVHPLWETWADLVQPDAQDILDTLEDNRNWYQSMIPQSPSPPLDEQNRDCQGLMEKFQFELTLDEEDSEGPEKEGEGHSYFSSTKTLCVIDPENRDSLGETDIDIATEDKSPVDT
"
     misc_feature    1404..1952
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Metal dependent phosphohydrolases with conserved
                     'HD' motif; Region: HDc; cd00077"
                     /db_xref="CDD:28958"
     misc_feature    order(1419..1421,1527..1532,1881..1883)
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Zn2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28958"
     misc_feature    1530..1532
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Mg2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28958"
     misc_feature    1890..1892
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="Binds AMP, but not cAMP (By similarity); propagated
                     from UniProtKB/Swiss-Prot (Q07343.1); other site"
     variation       218
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200612585"
     variation       226
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12038033"
     variation       230
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144957956"
     exon            234..472
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       266
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138030327"
     variation       347
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:79691733"
     variation       383
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147193846"
     variation       470
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367782903"
     exon            473..667
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       480
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374255487"
     variation       504
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367809652"
     variation       508
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145072153"
     variation       526
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75398902"
     variation       536
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143755153"
     variation       555
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375693073"
     variation       593
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201506484"
     variation       605
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:141704617"
     variation       611
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139030347"
     variation       640
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370994595"
     variation       641
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143872916"
     variation       662
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115853607"
     exon            668..704
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       671
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372187760"
     variation       673
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374832183"
     exon            705..775
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       737
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369969167"
     exon            776..825
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       779
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192869700"
     exon            826..938
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       849
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371423323"
     variation       888
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116739380"
     variation       908
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140500253"
     exon            939..1032
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       960
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376229903"
     variation       963
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145203756"
     variation       988
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199554373"
     variation       1021
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371297521"
     exon            1033..1211
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1074
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138828553"
     variation       1155
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369849443"
     variation       1158
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372730987"
     variation       1202
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377188281"
     variation       1211
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143554413"
     exon            1212..1310
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1213
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141692815"
     STS             1306..1412
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="RH64524"
                     /db_xref="UniSTS:59487"
     exon            1311..1475
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1328
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138407878"
     variation       1377
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4322205"
     variation       1415
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146166974"
     variation       1418
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115052833"
     variation       1421
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368002134"
     variation       1435
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371715752"
     variation       1448
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202021123"
     exon            1476..1575
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1496
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:783036"
     variation       1524
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185687552"
     variation       1542
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116379917"
     exon            1576..1730
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1583
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144798451"
     exon            1731..1853
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1795
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151031090"
     variation       1812
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:34079300"
     variation       1831
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116816923"
     variation       1841
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373028719"
     variation       1845
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142379593"
     exon            1854..2036
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1860
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370349934"
     variation       1861
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116312841"
     variation       1871
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34492439"
     variation       1886
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367550787"
     variation       1931
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141437989"
     variation       1937
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200251647"
     variation       1958
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41286714"
     variation       1971
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201667673"
     variation       1979
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114211692"
     variation       1988
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370428408"
     variation       1994
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373800241"
     exon            2037..4303
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       2102
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149054617"
     variation       2111
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41286716"
     variation       2117
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79722858"
     variation       2118
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114393853"
     variation       2135
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139001333"
     variation       2146
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200211480"
     variation       2157
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371876952"
     variation       2174
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201727510"
     variation       2186
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139374179"
     variation       2187
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149588422"
     variation       2188
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144568843"
     variation       2231
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3181494"
     variation       2232
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042020"
     variation       2235
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34469235"
     variation       2243
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373468487"
     variation       2257
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370754936"
     variation       2285
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372714875"
     variation       2292
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150977853"
     variation       2298
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2227297"
     variation       2299
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375941228"
     variation       2311
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185910614"
     variation       2332
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370636828"
     variation       2346
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200854845"
     variation       2355
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114387631"
     STS             2420..3304
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="PDE4B_372"
                     /db_xref="UniSTS:277574"
     variation       2423
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374227067"
     variation       2442
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115922110"
     variation       2549
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376708525"
     variation       2605
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:57315098"
     variation       2641
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41286718"
     variation       2726
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371856307"
     variation       2774
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:783067"
     variation       2854
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138914808"
     variation       2869
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1804141"
     variation       2942
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141470428"
     variation       3109
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:377201462"
     variation       3119
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181156834"
     variation       3132
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200935637"
     variation       3146
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78315788"
     variation       3366
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150394636"
     variation       3382
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4655837"
     variation       3425..3426
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="aaca"
                     /db_xref="dbSNP:199875231"
     variation       3446
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186227828"
     variation       3546
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190701813"
     STS             3604..3936
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="D1S2393"
                     /db_xref="UniSTS:66663"
     variation       3637
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371829302"
     variation       3682
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:76335673"
     variation       3684
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112424842"
     variation       3698
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3176927"
     variation       3727
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138156061"
     variation       3769
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149577217"
     variation       3798
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144286936"
     variation       3822
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183451410"
     STS             3850..3950
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="SGC30670"
                     /db_xref="UniSTS:79282"
     variation       3894
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186230480"
     variation       3910
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190745276"
     variation       3925
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377465393"
     variation       3933
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377626847"
     polyA_signal    3977..3982
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
     variation       3999
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182887410"
     polyA_site      4011
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /experiment="experimental evidence, no additional details
                     recorded"
     variation       4028
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374581239"
     variation       4145..4146
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="tgggtt"
                     /db_xref="dbSNP:368800294"
     variation       4145
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="aaccca"
                     /db_xref="dbSNP:16354"
     variation       4146..4147
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="gg"
                     /replace="tgggtt"
                     /db_xref="dbSNP:71807410"
     variation       4147..4148
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="ggtttg"
                     /db_xref="dbSNP:141736339"
     variation       4148..4149
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="ggtttg"
                     /db_xref="dbSNP:71682925"
     variation       4148
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368211356"
     variation       4149
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371168935"
     variation       4151
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374364770"
     variation       4200
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376802391"
     variation       4211
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138911836"
     variation       4222..4223
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="tat"
                     /db_xref="dbSNP:202242622"
     polyA_signal    4279..4284
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
     polyA_site      4303
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
ORIGIN      
gtgcgtaatccttcagctctggtggtaagggagatgcagtgagctcccggctgggagagagggttattttgcaaaactcccctggtaccgtgcccgcggaatattgcaggaggtctgtgaggtattaaaaagtgtcagcaaactgcattgaataacagacatcctaagaggggatattttccacctctataatgaagaaaagcaggagtgtgatgacggtgatggctgatgataatgttaaagattattttgaatgtagcttgagtaaatcctacagttcttccagtaacacacttgggatcgacctctggagagggagaaggtgttgctcaggaaacttacagttaccaccactgtctcaaagacagagtgaaagggcaaggactcctgagggagatggtatttccaggccgaccacactgcctttgacaacgcttccaagcattgctattacaactgtaagccaggagtgctttgatgtggaaaatggcccttccccaggtcggagtccactggatccccaggccagctcttccgctgggctggtacttcacgccacctttcctgggcacagccagcgcagagagtcatttctctacagatcagacagcgactatgacttgtcaccaaaggcgatgtcgagaaactcttctcttccaagcgagcaacacggcgatgacttgattgtaactccttttgcccaggtccttgccagcttgcgaagtgtgagaaacaacttcactatactgacaaaccttcatggtacatctaacaagaggtccccagctgctagtcagcctcctgtctccagagtcaacccacaagaagaatcttatcaaaaattagcaatggaaacgctggaggaattagactggtgtttagaccagctagagaccatacagacctaccggtctgtcagtgagatggcttctaacaagttcaaaagaatgctgaaccgggagctgacacacctctcagagatgagccgatcagggaaccaggtgtctgaatacatttcaaatactttcttagacaagcagaatgatgtggagatcccatctcctacccagaaagacagggagaaaaagaaaaagcagcagctcatgacccagataagtggagtgaagaaattaatgcatagttcaagcctaaacaatacaagcatctcacgctttggagtcaacactgaaaatgaagatcacctggccaaggagctggaagacctgaacaaatggggtcttaacatctttaatgtggctggatattctcacaatagacccctaacatgcatcatgtatgctatattccaggaaagagacctcctaaagacattcagaatctcatctgacacatttataacctacatgatgactttagaagaccattaccattctgacgtggcatatcacaacagcctgcacgctgctgatgtagcccagtcgacccatgttctcctttctacaccagcattagacgctgtcttcacagatttggagatcctggctgccatttttgcagctgccatccatgacgttgatcatcctggagtctccaatcagtttctcatcaacacaaattcagaacttgctttgatgtataatgatgaatctgtgttggaaaatcatcaccttgctgtgggtttcaaactgctgcaagaagaacactgtgacatcttcatgaatctcaccaagaagcagcgtcagacactcaggaagatggttattgacatggtgttagcaactgatatgtctaaacatatgagcctgctggcagacctgaagacaatggtagaaacgaagaaagttacaagttcaggcgttcttctcctagacaactataccgatcgcattcaggtccttcgcaacatggtacactgtgcagacctgagcaaccccaccaagtccttggaattgtatcggcaatggacagaccgcatcatggaggaatttttccagcagggagacaaagagcgggagaggggaatggaaattagcccaatgtgtgataaacacacagcttctgtggaaaaatcccaggttggtttcatcgactacattgtccatccattgtgggagacatgggcagatttggtacagcctgatgctcaggacattctcgataccttagaagataacaggaactggtatcagagcatgatacctcaaagtccctcaccaccactggacgagcagaacagggactgccagggtctgatggagaagtttcagtttgaactgactctcgatgaggaagattctgaaggacctgagaaggagggagagggacacagctatttcagcagcacaaagacgctttgtgtgattgatccagaaaacagagattccctgggagagactgacatagacattgcaacagaagacaagtcccccgtggatacataatccccctctccctgtggagatgaacattctatccttgatgagcatgccagctatgtggtagggccagcccaccatgggggccaagacctgcacaggacaagggccacctggcctttcagttacttgagtttggagtcagaaagcaagaccaggaagcaaatagcagctcaggaaatcccacggttgacttgccttgatggcaagcttggtggagagggctgaagctgttgctgggggccgattctgatcaagacacatggcttgaaaatggaagacacaaaactgagagatcattctgcactaagtttcgggaacttatccccgacagtgactgaactcactgactaataacttcatttatgaatcttctcacttgtccctttgtctgccaacctgtgtgccttttttgtaaaacattttcatgtctttaaaatgcctgttgaatacctggagtttagtatcaacttctacacagataagctttcaaagttgacaaacttttttgactctttctggaaaagggaaagaaaatagtcttccttctttcttgggcaatatccttcactttactacagttacttttgcaaacagacagaaaggatacacttctaaccacattttacttccttcccctgttgtccagtccaactccacagtcactcttaaaacttctctctgtttgcctgcctccaacagtacttttaactttttgctgtaaacagaataaaattgaacaaattagggggtagaaaggagcagtggtgtcgttcaccgtgagagtctgcatagaactcagcagtgtgccctgctgtgtcttggaccctgccccccacaggagttgtacagtccctggccctgttccctacctcctctcttcaccccgttaggctgttttcaatgtaatgctgccgtccttctcttgcactgccttctgcgctaacacctccattcctgtttataaccgtgtatttattacttaatgtatataatgtaatgttttgtaagttattaatttatatatctaacattgcctgccaatggtggtgttaaatttgtgtagaaaactctgcctaagagttacgactttttcttgtaatgttttgtattgtgtattatataacccaaacgtcacttagtagagacatatggcccccttggcagagaggacaggggtgggcttttgttcaaagggtctgccctttccctgcctgagttgctacttctgcacaacccctttatgaaccagttttggaaacaatattctcacattagatactaaatggtttatactgagcttttacttttgtatagcttgataggggcagggggcaatgggatgtagtttttacccaggttctatccaaatctatgtgggcatgagttgggttataactggatcctactatcattgtggctttggttcaaaaggaaacactacatttgctcacagatgattcttctgaatgctcccgaactactgactttgaagaggtagcctcctgcctgccattaagcaggaatgtcatgttccagttcattacaaaagaaaacaataaaacaatgtgaatttttataataaaatgtgaactgatgtagcaaattacgcaaatgtgaagcctcttctgataacacttgttaggcctcttactgatgtcagtttcagtttgtaaaatatgtttcatgctttcagttcagcattgtgactcagtaattacagaaaatggcacaaatgtgcatgaccaatgtatgtctatgaacactgcattgtttcaggtggacattttatcattttcaaatgtttctcacaatgtatgttatagtattattattatatattgtgttcaaatgcattctaaagagacttttatatgaggtgaataaagaaaagcatgattagattaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5142 -> Molecular function: GO:0004114 [3',5'-cyclic-nucleotide phosphodiesterase activity] evidence: ISS
            GeneID:5142 -> Molecular function: GO:0004115 [3',5'-cyclic-AMP phosphodiesterase activity] evidence: IDA
            GeneID:5142 -> Molecular function: GO:0004115 [3',5'-cyclic-AMP phosphodiesterase activity] evidence: IGI
            GeneID:5142 -> Molecular function: GO:0030552 [cAMP binding] evidence: IGI
            GeneID:5142 -> Molecular function: GO:0044325 [ion channel binding] evidence: ISS
            GeneID:5142 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:5142 -> Biological process: GO:0001780 [neutrophil homeostasis] evidence: ISS
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IDA
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IEA
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IGI
            GeneID:5142 -> Biological process: GO:0030593 [neutrophil chemotaxis] evidence: ISS
            GeneID:5142 -> Biological process: GO:0032729 [positive regulation of interferon-gamma production] evidence: IMP
            GeneID:5142 -> Biological process: GO:0032743 [positive regulation of interleukin-2 production] evidence: IMP
            GeneID:5142 -> Biological process: GO:0035690 [cellular response to drug] evidence: ISS
            GeneID:5142 -> Biological process: GO:0050852 [T cell receptor signaling pathway] evidence: IMP
            GeneID:5142 -> Biological process: GO:0050900 [leukocyte migration] evidence: ISS
            GeneID:5142 -> Biological process: GO:0071222 [cellular response to lipopolysaccharide] evidence: ISS
            GeneID:5142 -> Biological process: GO:0071872 [cellular response to epinephrine stimulus] evidence: ISS
            GeneID:5142 -> Biological process: GO:0086004 [regulation of cardiac muscle cell contraction] evidence: ISS
            GeneID:5142 -> Biological process: GO:1901841 [regulation of high voltage-gated calcium channel activity] evidence: ISS
            GeneID:5142 -> Biological process: GO:1901898 [negative regulation of relaxation of cardiac muscle] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
            GeneID:5142 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:5142 -> Cellular component: GO:0005891 [voltage-gated calcium channel complex] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0030018 [Z disc] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001032418 -> EC 3.1.4.17

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.