GGRNA Home | Help | Advanced search

2019-03-21 16:39:39, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001037340            4273 bp    mRNA    linear   PRI 14-JUL-2013
DEFINITION  Homo sapiens phosphodiesterase 4B, cAMP-specific (PDE4B),
            transcript variant c, mRNA.
ACCESSION   NM_001037340
VERSION     NM_001037340.1  GI:82799483
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4273)
  AUTHORS   Yang,J.J., Cheng,C., Devidas,M., Cao,X., Campana,D., Yang,W.,
            Fan,Y., Neale,G., Cox,N., Scheet,P., Borowitz,M.J., Winick,N.J.,
            Martin,P.L., Bowman,W.P., Camitta,B., Reaman,G.H., Carroll,W.L.,
            Willman,C.L., Hunger,S.P., Evans,W.E., Pui,C.H., Loh,M. and
            Relling,M.V.
  TITLE     Genome-wide association study identifies germline polymorphisms
            associated with relapse of childhood acute lymphoblastic leukemia
  JOURNAL   Blood 120 (20), 4197-4204 (2012)
   PUBMED   23007406
REFERENCE   2  (bases 1 to 4273)
  AUTHORS   Lee,J., Komatsu,K., Lee,B.C., Lim,J.H., Jono,H., Xu,H., Kai,H.,
            Zhang,Z.J., Yan,C. and Li,J.D.
  TITLE     Phosphodiesterase 4B mediates extracellular signal-regulated
            kinase-dependent up-regulation of mucin MUC5AC protein by
            Streptococcus pneumoniae by inhibiting cAMP-protein kinase
            A-dependent MKP-1 phosphatase pathway
  JOURNAL   J. Biol. Chem. 287 (27), 22799-22811 (2012)
   PUBMED   22610099
  REMARK    GeneRIF: PDE4B mediates ERK-dependent up-regulation of mucin MUC5AC
            by S. pneumoniae by inhibiting cAMP-PKA-dependent MKP-1 pathway.
REFERENCE   3  (bases 1 to 4273)
  AUTHORS   Benjamin,D.J., Cesarini,D., van der Loos,M.J., Dawes,C.T.,
            Koellinger,P.D., Magnusson,P.K., Chabris,C.F., Conley,D.,
            Laibson,D., Johannesson,M. and Visscher,P.M.
  TITLE     The genetic architecture of economic and political preferences
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 109 (21), 8026-8031 (2012)
   PUBMED   22566634
REFERENCE   4  (bases 1 to 4273)
  AUTHORS   Kashiwagi,E., Shiota,M., Yokomizo,A., Itsumi,M., Inokuchi,J.,
            Uchiumi,T. and Naito,S.
  TITLE     Downregulation of phosphodiesterase 4B (PDE4B) activates protein
            kinase A and contributes to the progression of prostate cancer
  JOURNAL   Prostate 72 (7), 741-751 (2012)
   PUBMED   22529021
  REMARK    GeneRIF: PDE4B was downregulated and the protein kinase A pathway
            was activated in castration-resistant LNCaP prostate cancer cells.
            PDE4B expression was reduced in advanced prostate cancer and PDE4B
            knockdown promoted castration-resistant growth of LNCaP cells.
REFERENCE   5  (bases 1 to 4273)
  AUTHORS   Newburn,E.N., Hyde,T.M., Ye,T., Morita,Y., Weinberger,D.R.,
            Kleinman,J.E. and Lipska,B.K.
  TITLE     Interactions of human truncated DISC1 proteins: implications for
            schizophrenia
  JOURNAL   Transl Psychiatry 1, E30 (2011)
   PUBMED   22832604
  REMARK    GeneRIF: Short Disrupted-in-Schizophrenia (DISC)1 splice variants
            show reduced or no binding to nudE nuclear distribution E homolog
            (NDEL)1 and PDE4B proteins but fully interact with
            fasciculation/elongation zeta (FEZ)1 and glycogen synthase kinase 3
            GSK3beta.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 4273)
  AUTHORS   Szpirer,C., Szpirer,J., Riviere,M., Swinnen,J., Vicini,E. and
            Conti,M.
  TITLE     Chromosomal localization of the human and rat genes (PDE4D and
            PDE4B) encoding the cAMP-specific phosphodiesterases 3 and 4
  JOURNAL   Cytogenet. Cell Genet. 69 (1-2), 11-14 (1995)
   PUBMED   7835077
REFERENCE   7  (bases 1 to 4273)
  AUTHORS   Bolger,G.B., Rodgers,L. and Riggs,M.
  TITLE     Differential CNS expression of alternative mRNA isoforms of the
            mammalian genes encoding cAMP-specific phosphodiesterases
  JOURNAL   Gene 149 (2), 237-244 (1994)
   PUBMED   7958996
REFERENCE   8  (bases 1 to 4273)
  AUTHORS   Bolger,G., Michaeli,T., Martins,T., St John,T., Steiner,B.,
            Rodgers,L., Riggs,M., Wigler,M. and Ferguson,K.
  TITLE     A family of human phosphodiesterases homologous to the dunce
            learning and memory gene product of Drosophila melanogaster are
            potential targets for antidepressant drugs
  JOURNAL   Mol. Cell. Biol. 13 (10), 6558-6571 (1993)
   PUBMED   8413254
REFERENCE   9  (bases 1 to 4273)
  AUTHORS   Obernolte,R., Bhakta,S., Alvarez,R., Bach,C., Zuppan,P.,
            Mulkins,M., Jarnagin,K. and Shelton,E.R.
  TITLE     The cDNA of a human lymphocyte cyclic-AMP phosphodiesterase (PDE
            IV) reveals a multigene family
  JOURNAL   Gene 129 (2), 239-247 (1993)
   PUBMED   8392015
REFERENCE   10 (bases 1 to 4273)
  AUTHORS   McLaughlin,M.M., Cieslinski,L.B., Burman,M., Torphy,T.J. and
            Livi,G.P.
  TITLE     A low-Km, rolipram-sensitive, cAMP-specific phosphodiesterase from
            human brain. Cloning and expression of cDNA, biochemical
            characterization of recombinant protein, and tissue distribution of
            mRNA
  JOURNAL   J. Biol. Chem. 268 (9), 6470-6476 (1993)
   PUBMED   8384210
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AB209081.1, BC101480.1,
            BC036108.1, BC046161.1 and AW519027.1.
            
            Summary: This gene is a member of the type IV, cyclic AMP
            (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family.
            Cyclic nucleotides are important second messengers that regulate
            and mediate a number of cellular responses to extracellular
            signals, such as hormones, light, and neurotransmitters. The cyclic
            nucleotide phosphodiesterases (PDEs) regulate the cellular
            concentrations of cyclic nucleotides and thereby play a role in
            signal transduction. This gene encodes a protein that specifically
            hydrolyzes cAMP. Altered activity of this protein has been
            associated with schizophrenia and bipolar affective disorder.
            Alternate transcriptional splice variants, encoding different
            isoforms, have been characterized. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (c) contains a distinct 5' UTR and
            lacks an in-frame portion of the 5' coding region, compared to
            variant a. The resulting isoform (3, also referred to as PDE4B3)
            has a shorter and distinct N-terminus when compared to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB209081.1, AK290006.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1459              AB209081.1         1-1459
            1460-2463           BC101480.1         1391-2394
            2464-2737           AB209081.1         2464-2737
            2738-3536           BC036108.1         2768-3566
            3537-4111           AB209081.1         3537-4111
            4112-4261           BC046161.1         1196-1345
            4262-4273           AW519027.1         1-12                c
FEATURES             Location/Qualifiers
     source          1..4273
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p31"
     gene            1..4273
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="phosphodiesterase 4B, cAMP-specific"
                     /db_xref="GeneID:5142"
                     /db_xref="HGNC:8781"
                     /db_xref="HPRD:02528"
                     /db_xref="MIM:600127"
     exon            1..436
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       43
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:185818584"
     variation       71
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191369542"
     variation       85
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138542591"
     variation       113
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183182898"
     variation       118
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187710915"
     variation       158
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370243912"
     misc_feature    183..185
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="upstream in-frame stop codon"
     CDS             201..2366
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /EC_number="3.1.4.17"
                     /note="isoform 3 is encoded by transcript variant c;
                     phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4
                     dunce homolog, Drosophila); dunce-like phosphodiesterase
                     E4; cAMP-specific 3',5'-cyclic phosphodiesterase 4B;
                     cAMP-specific phosphodiesterase-4 B isoform; PDE32"
                     /codon_start=1
                     /product="cAMP-specific 3',5'-cyclic phosphodiesterase 4B
                     isoform 3"
                     /protein_id="NP_001032417.1"
                     /db_xref="GI:82799484"
                     /db_xref="CCDS:CCDS30742.1"
                     /db_xref="GeneID:5142"
                     /db_xref="HGNC:8781"
                     /db_xref="HPRD:02528"
                     /db_xref="MIM:600127"
                     /translation="
MTAKDSSKELTASEPEVCIKTFKEQMHLELELPRLPGNRPTSPKISPRSSPRNSPCFFRKLLVNKSIRQRRRFTVAHTCFDVENGPSPGRSPLDPQASSSAGLVLHATFPGHSQRRESFLYRSDSDYDLSPKAMSRNSSLPSEQHGDDLIVTPFAQVLASLRSVRNNFTILTNLHGTSNKRSPAASQPPVSRVNPQEESYQKLAMETLEELDWCLDQLETIQTYRSVSEMASNKFKRMLNRELTHLSEMSRSGNQVSEYISNTFLDKQNDVEIPSPTQKDREKKKKQQLMTQISGVKKLMHSSSLNNTSISRFGVNTENEDHLAKELEDLNKWGLNIFNVAGYSHNRPLTCIMYAIFQERDLLKTFRISSDTFITYMMTLEDHYHSDVAYHNSLHAADVAQSTHVLLSTPALDAVFTDLEILAAIFAAAIHDVDHPGVSNQFLINTNSELALMYNDESVLENHHLAVGFKLLQEEHCDIFMNLTKKQRQTLRKMVIDMVLATDMSKHMSLLADLKTMVETKKVTSSGVLLLDNYTDRIQVLRNMVHCADLSNPTKSLELYRQWTDRIMEEFFQQGDKERERGMEISPMCDKHTASVEKSQVGFIDYIVHPLWETWADLVQPDAQDILDTLEDNRNWYQSMIPQSPSPPLDEQNRDCQGLMEKFQFELTLDEEDSEGPEKEGEGHSYFSSTKTLCVIDPENRDSLGETDIDIATEDKSPVDT
"
     misc_feature    1368..1916
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Metal dependent phosphohydrolases with conserved
                     'HD' motif; Region: HDc; cd00077"
                     /db_xref="CDD:28958"
     misc_feature    order(1383..1385,1491..1496,1845..1847)
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Zn2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28958"
     misc_feature    1494..1496
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Mg2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28958"
     variation       225
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142761289"
     variation       230
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:116566645"
     variation       272
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115074556"
     variation       294
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369469512"
     variation       299
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139413416"
     variation       323
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116785815"
     variation       338
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141279762"
     variation       342
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201170908"
     variation       373
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144055593"
     variation       381
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372397597"
     variation       389
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374443084"
     exon            437..631
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       444
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374255487"
     variation       468
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367809652"
     variation       472
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145072153"
     variation       490
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75398902"
     variation       500
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143755153"
     variation       519
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375693073"
     variation       557
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201506484"
     variation       569
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:141704617"
     variation       575
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139030347"
     variation       604
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370994595"
     variation       605
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143872916"
     variation       626
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115853607"
     exon            632..668
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       635
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372187760"
     variation       637
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374832183"
     exon            669..739
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       701
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369969167"
     exon            740..789
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       743
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192869700"
     exon            790..902
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       813
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371423323"
     variation       852
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116739380"
     variation       872
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140500253"
     exon            903..996
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       924
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376229903"
     variation       927
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145203756"
     variation       952
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199554373"
     variation       985
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371297521"
     exon            997..1175
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1038
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138828553"
     variation       1119
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369849443"
     variation       1122
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372730987"
     variation       1166
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377188281"
     variation       1175
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143554413"
     exon            1176..1274
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1177
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141692815"
     STS             1270..1376
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="RH64524"
                     /db_xref="UniSTS:59487"
     exon            1275..1439
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1292
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138407878"
     variation       1341
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4322205"
     variation       1379
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146166974"
     variation       1382
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115052833"
     variation       1385
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368002134"
     variation       1399
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371715752"
     variation       1412
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202021123"
     exon            1440..1539
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1460
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:783036"
     variation       1488
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185687552"
     variation       1506
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116379917"
     exon            1540..1694
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1547
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144798451"
     exon            1695..1817
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1759
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151031090"
     variation       1776
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:34079300"
     variation       1795
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116816923"
     variation       1805
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373028719"
     variation       1809
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142379593"
     exon            1818..2000
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1824
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370349934"
     variation       1825
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116312841"
     variation       1835
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34492439"
     variation       1850
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367550787"
     variation       1895
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141437989"
     variation       1901
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200251647"
     variation       1922
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41286714"
     variation       1935
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201667673"
     variation       1943
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114211692"
     variation       1952
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370428408"
     variation       1958
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373800241"
     exon            2001..4267
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       2066
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149054617"
     variation       2075
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41286716"
     variation       2081
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79722858"
     variation       2082
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114393853"
     variation       2099
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139001333"
     variation       2110
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200211480"
     variation       2121
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371876952"
     variation       2138
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201727510"
     variation       2150
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139374179"
     variation       2151
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149588422"
     variation       2152
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144568843"
     variation       2195
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3181494"
     variation       2196
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042020"
     variation       2199
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34469235"
     variation       2207
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373468487"
     variation       2221
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370754936"
     variation       2249
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372714875"
     variation       2256
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150977853"
     variation       2262
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2227297"
     variation       2263
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375941228"
     variation       2275
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185910614"
     variation       2296
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370636828"
     variation       2310
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200854845"
     variation       2319
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114387631"
     STS             2384..3268
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="PDE4B_372"
                     /db_xref="UniSTS:277574"
     variation       2387
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374227067"
     variation       2406
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115922110"
     variation       2513
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376708525"
     variation       2569
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:57315098"
     variation       2605
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41286718"
     variation       2690
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371856307"
     variation       2738
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:783067"
     variation       2818
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138914808"
     variation       2833
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1804141"
     variation       2906
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141470428"
     variation       3073
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:377201462"
     variation       3083
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181156834"
     variation       3096
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200935637"
     variation       3110
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78315788"
     variation       3330
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150394636"
     variation       3346
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4655837"
     variation       3389..3390
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="aaca"
                     /db_xref="dbSNP:199875231"
     variation       3410
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186227828"
     variation       3510
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190701813"
     STS             3568..3900
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="D1S2393"
                     /db_xref="UniSTS:66663"
     variation       3601
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371829302"
     variation       3646
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:76335673"
     variation       3648
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112424842"
     variation       3662
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3176927"
     variation       3691
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138156061"
     variation       3733
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149577217"
     variation       3762
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144286936"
     variation       3786
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183451410"
     STS             3814..3914
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="SGC30670"
                     /db_xref="UniSTS:79282"
     variation       3858
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186230480"
     variation       3874
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190745276"
     variation       3889
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377465393"
     variation       3897
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377626847"
     polyA_signal    3941..3946
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
     variation       3963
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182887410"
     polyA_site      3975
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /experiment="experimental evidence, no additional details
                     recorded"
     variation       3992
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374581239"
     variation       4109..4110
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="tgggtt"
                     /db_xref="dbSNP:368800294"
     variation       4109
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="aaccca"
                     /db_xref="dbSNP:16354"
     variation       4110..4111
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="gg"
                     /replace="tgggtt"
                     /db_xref="dbSNP:71807410"
     variation       4111..4112
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="ggtttg"
                     /db_xref="dbSNP:141736339"
     variation       4112..4113
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="ggtttg"
                     /db_xref="dbSNP:71682925"
     variation       4112
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368211356"
     variation       4113
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371168935"
     variation       4115
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374364770"
     variation       4164
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376802391"
     variation       4175
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138911836"
     variation       4186..4187
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="tat"
                     /db_xref="dbSNP:202242622"
     polyA_signal    4243..4248
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
     polyA_site      4267
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
ORIGIN      
aaagctccttgtgacagcctgacttgctattcttcgagtatgctgctcttgctctaagacgctcatacattggagtcacagcttcgtaaattaaactggaaatagtttgcagacttatcagtcttctgacctgcagcagtgtctctgctatgtttgagatttttgttttggatggtgaaagctagcactccttacaagacatgacagcaaaagattcttcaaaggaacttactgcttctgaacctgaggtttgcataaagactttcaaggagcaaatgcatttagaacttgagcttccgagattaccaggaaacagacctacatctcctaaaatttctccacgcagttcaccaaggaactcaccatgctttttcagaaagttgctggtgaataaaagcattcggcagcgtcgtcgcttcactgtggctcatacatgctttgatgtggaaaatggcccttccccaggtcggagtccactggatccccaggccagctcttccgctgggctggtacttcacgccacctttcctgggcacagccagcgcagagagtcatttctctacagatcagacagcgactatgacttgtcaccaaaggcgatgtcgagaaactcttctcttccaagcgagcaacacggcgatgacttgattgtaactccttttgcccaggtccttgccagcttgcgaagtgtgagaaacaacttcactatactgacaaaccttcatggtacatctaacaagaggtccccagctgctagtcagcctcctgtctccagagtcaacccacaagaagaatcttatcaaaaattagcaatggaaacgctggaggaattagactggtgtttagaccagctagagaccatacagacctaccggtctgtcagtgagatggcttctaacaagttcaaaagaatgctgaaccgggagctgacacacctctcagagatgagccgatcagggaaccaggtgtctgaatacatttcaaatactttcttagacaagcagaatgatgtggagatcccatctcctacccagaaagacagggagaaaaagaaaaagcagcagctcatgacccagataagtggagtgaagaaattaatgcatagttcaagcctaaacaatacaagcatctcacgctttggagtcaacactgaaaatgaagatcacctggccaaggagctggaagacctgaacaaatggggtcttaacatctttaatgtggctggatattctcacaatagacccctaacatgcatcatgtatgctatattccaggaaagagacctcctaaagacattcagaatctcatctgacacatttataacctacatgatgactttagaagaccattaccattctgacgtggcatatcacaacagcctgcacgctgctgatgtagcccagtcgacccatgttctcctttctacaccagcattagacgctgtcttcacagatttggagatcctggctgccatttttgcagctgccatccatgacgttgatcatcctggagtctccaatcagtttctcatcaacacaaattcagaacttgctttgatgtataatgatgaatctgtgttggaaaatcatcaccttgctgtgggtttcaaactgctgcaagaagaacactgtgacatcttcatgaatctcaccaagaagcagcgtcagacactcaggaagatggttattgacatggtgttagcaactgatatgtctaaacatatgagcctgctggcagacctgaagacaatggtagaaacgaagaaagttacaagttcaggcgttcttctcctagacaactataccgatcgcattcaggtccttcgcaacatggtacactgtgcagacctgagcaaccccaccaagtccttggaattgtatcggcaatggacagaccgcatcatggaggaatttttccagcagggagacaaagagcgggagaggggaatggaaattagcccaatgtgtgataaacacacagcttctgtggaaaaatcccaggttggtttcatcgactacattgtccatccattgtgggagacatgggcagatttggtacagcctgatgctcaggacattctcgataccttagaagataacaggaactggtatcagagcatgatacctcaaagtccctcaccaccactggacgagcagaacagggactgccagggtctgatggagaagtttcagtttgaactgactctcgatgaggaagattctgaaggacctgagaaggagggagagggacacagctatttcagcagcacaaagacgctttgtgtgattgatccagaaaacagagattccctgggagagactgacatagacattgcaacagaagacaagtcccccgtggatacataatccccctctccctgtggagatgaacattctatccttgatgagcatgccagctatgtggtagggccagcccaccatgggggccaagacctgcacaggacaagggccacctggcctttcagttacttgagtttggagtcagaaagcaagaccaggaagcaaatagcagctcaggaaatcccacggttgacttgccttgatggcaagcttggtggagagggctgaagctgttgctgggggccgattctgatcaagacacatggcttgaaaatggaagacacaaaactgagagatcattctgcactaagtttcgggaacttatccccgacagtgactgaactcactgactaataacttcatttatgaatcttctcacttgtccctttgtctgccaacctgtgtgccttttttgtaaaacattttcatgtctttaaaatgcctgttgaatacctggagtttagtatcaacttctacacagataagctttcaaagttgacaaacttttttgactctttctggaaaagggaaagaaaatagtcttccttctttcttgggcaatatccttcactttactacagttacttttgcaaacagacagaaaggatacacttctaaccacattttacttccttcccctgttgtccagtccaactccacagtcactcttaaaacttctctctgtttgcctgcctccaacagtacttttaactttttgctgtaaacagaataaaattgaacaaattagggggtagaaaggagcagtggtgtcgttcaccgtgagagtctgcatagaactcagcagtgtgccctgctgtgtcttggaccctgccccccacaggagttgtacagtccctggccctgttccctacctcctctcttcaccccgttaggctgttttcaatgtaatgctgccgtccttctcttgcactgccttctgcgctaacacctccattcctgtttataaccgtgtatttattacttaatgtatataatgtaatgttttgtaagttattaatttatatatctaacattgcctgccaatggtggtgttaaatttgtgtagaaaactctgcctaagagttacgactttttcttgtaatgttttgtattgtgtattatataacccaaacgtcacttagtagagacatatggcccccttggcagagaggacaggggtgggcttttgttcaaagggtctgccctttccctgcctgagttgctacttctgcacaacccctttatgaaccagttttggaaacaatattctcacattagatactaaatggtttatactgagcttttacttttgtatagcttgataggggcagggggcaatgggatgtagtttttacccaggttctatccaaatctatgtgggcatgagttgggttataactggatcctactatcattgtggctttggttcaaaaggaaacactacatttgctcacagatgattcttctgaatgctcccgaactactgactttgaagaggtagcctcctgcctgccattaagcaggaatgtcatgttccagttcattacaaaagaaaacaataaaacaatgtgaatttttataataaaatgtgaactgatgtagcaaattacgcaaatgtgaagcctcttctgataacacttgttaggcctcttactgatgtcagtttcagtttgtaaaatatgtttcatgctttcagttcagcattgtgactcagtaattacagaaaatggcacaaatgtgcatgaccaatgtatgtctatgaacactgcattgtttcaggtggacattttatcattttcaaatgtttctcacaatgtatgttatagtattattattatatattgtgttcaaatgcattctaaagagacttttatatgaggtgaataaagaaaagcatgattagattaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5142 -> Molecular function: GO:0004114 [3',5'-cyclic-nucleotide phosphodiesterase activity] evidence: ISS
            GeneID:5142 -> Molecular function: GO:0004115 [3',5'-cyclic-AMP phosphodiesterase activity] evidence: IDA
            GeneID:5142 -> Molecular function: GO:0004115 [3',5'-cyclic-AMP phosphodiesterase activity] evidence: IGI
            GeneID:5142 -> Molecular function: GO:0030552 [cAMP binding] evidence: IGI
            GeneID:5142 -> Molecular function: GO:0044325 [ion channel binding] evidence: ISS
            GeneID:5142 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:5142 -> Biological process: GO:0001780 [neutrophil homeostasis] evidence: ISS
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IDA
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IEA
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IGI
            GeneID:5142 -> Biological process: GO:0030593 [neutrophil chemotaxis] evidence: ISS
            GeneID:5142 -> Biological process: GO:0032729 [positive regulation of interferon-gamma production] evidence: IMP
            GeneID:5142 -> Biological process: GO:0032743 [positive regulation of interleukin-2 production] evidence: IMP
            GeneID:5142 -> Biological process: GO:0035690 [cellular response to drug] evidence: ISS
            GeneID:5142 -> Biological process: GO:0050852 [T cell receptor signaling pathway] evidence: IMP
            GeneID:5142 -> Biological process: GO:0050900 [leukocyte migration] evidence: ISS
            GeneID:5142 -> Biological process: GO:0071222 [cellular response to lipopolysaccharide] evidence: ISS
            GeneID:5142 -> Biological process: GO:0071872 [cellular response to epinephrine stimulus] evidence: ISS
            GeneID:5142 -> Biological process: GO:0086004 [regulation of cardiac muscle cell contraction] evidence: ISS
            GeneID:5142 -> Biological process: GO:1901841 [regulation of high voltage-gated calcium channel activity] evidence: ISS
            GeneID:5142 -> Biological process: GO:1901898 [negative regulation of relaxation of cardiac muscle] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
            GeneID:5142 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:5142 -> Cellular component: GO:0005891 [voltage-gated calcium channel complex] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0030018 [Z disc] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001032417 -> EC 3.1.4.17

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.