GGRNA Home | Help | Advanced search

2019-03-25 14:28:43, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001037339            3882 bp    mRNA    linear   PRI 14-JUL-2013
DEFINITION  Homo sapiens phosphodiesterase 4B, cAMP-specific (PDE4B),
            transcript variant b, mRNA.
ACCESSION   NM_001037339
VERSION     NM_001037339.1  GI:82799481
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3882)
  AUTHORS   Yang,J.J., Cheng,C., Devidas,M., Cao,X., Campana,D., Yang,W.,
            Fan,Y., Neale,G., Cox,N., Scheet,P., Borowitz,M.J., Winick,N.J.,
            Martin,P.L., Bowman,W.P., Camitta,B., Reaman,G.H., Carroll,W.L.,
            Willman,C.L., Hunger,S.P., Evans,W.E., Pui,C.H., Loh,M. and
            Relling,M.V.
  TITLE     Genome-wide association study identifies germline polymorphisms
            associated with relapse of childhood acute lymphoblastic leukemia
  JOURNAL   Blood 120 (20), 4197-4204 (2012)
   PUBMED   23007406
REFERENCE   2  (bases 1 to 3882)
  AUTHORS   Lee,J., Komatsu,K., Lee,B.C., Lim,J.H., Jono,H., Xu,H., Kai,H.,
            Zhang,Z.J., Yan,C. and Li,J.D.
  TITLE     Phosphodiesterase 4B mediates extracellular signal-regulated
            kinase-dependent up-regulation of mucin MUC5AC protein by
            Streptococcus pneumoniae by inhibiting cAMP-protein kinase
            A-dependent MKP-1 phosphatase pathway
  JOURNAL   J. Biol. Chem. 287 (27), 22799-22811 (2012)
   PUBMED   22610099
  REMARK    GeneRIF: PDE4B mediates ERK-dependent up-regulation of mucin MUC5AC
            by S. pneumoniae by inhibiting cAMP-PKA-dependent MKP-1 pathway.
REFERENCE   3  (bases 1 to 3882)
  AUTHORS   Benjamin,D.J., Cesarini,D., van der Loos,M.J., Dawes,C.T.,
            Koellinger,P.D., Magnusson,P.K., Chabris,C.F., Conley,D.,
            Laibson,D., Johannesson,M. and Visscher,P.M.
  TITLE     The genetic architecture of economic and political preferences
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 109 (21), 8026-8031 (2012)
   PUBMED   22566634
REFERENCE   4  (bases 1 to 3882)
  AUTHORS   Kashiwagi,E., Shiota,M., Yokomizo,A., Itsumi,M., Inokuchi,J.,
            Uchiumi,T. and Naito,S.
  TITLE     Downregulation of phosphodiesterase 4B (PDE4B) activates protein
            kinase A and contributes to the progression of prostate cancer
  JOURNAL   Prostate 72 (7), 741-751 (2012)
   PUBMED   22529021
  REMARK    GeneRIF: PDE4B was downregulated and the protein kinase A pathway
            was activated in castration-resistant LNCaP prostate cancer cells.
            PDE4B expression was reduced in advanced prostate cancer and PDE4B
            knockdown promoted castration-resistant growth of LNCaP cells.
REFERENCE   5  (bases 1 to 3882)
  AUTHORS   Newburn,E.N., Hyde,T.M., Ye,T., Morita,Y., Weinberger,D.R.,
            Kleinman,J.E. and Lipska,B.K.
  TITLE     Interactions of human truncated DISC1 proteins: implications for
            schizophrenia
  JOURNAL   Transl Psychiatry 1, E30 (2011)
   PUBMED   22832604
  REMARK    GeneRIF: Short Disrupted-in-Schizophrenia (DISC)1 splice variants
            show reduced or no binding to nudE nuclear distribution E homolog
            (NDEL)1 and PDE4B proteins but fully interact with
            fasciculation/elongation zeta (FEZ)1 and glycogen synthase kinase 3
            GSK3beta.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 3882)
  AUTHORS   Szpirer,C., Szpirer,J., Riviere,M., Swinnen,J., Vicini,E. and
            Conti,M.
  TITLE     Chromosomal localization of the human and rat genes (PDE4D and
            PDE4B) encoding the cAMP-specific phosphodiesterases 3 and 4
  JOURNAL   Cytogenet. Cell Genet. 69 (1-2), 11-14 (1995)
   PUBMED   7835077
REFERENCE   7  (bases 1 to 3882)
  AUTHORS   Bolger,G.B., Rodgers,L. and Riggs,M.
  TITLE     Differential CNS expression of alternative mRNA isoforms of the
            mammalian genes encoding cAMP-specific phosphodiesterases
  JOURNAL   Gene 149 (2), 237-244 (1994)
   PUBMED   7958996
REFERENCE   8  (bases 1 to 3882)
  AUTHORS   Bolger,G., Michaeli,T., Martins,T., St John,T., Steiner,B.,
            Rodgers,L., Riggs,M., Wigler,M. and Ferguson,K.
  TITLE     A family of human phosphodiesterases homologous to the dunce
            learning and memory gene product of Drosophila melanogaster are
            potential targets for antidepressant drugs
  JOURNAL   Mol. Cell. Biol. 13 (10), 6558-6571 (1993)
   PUBMED   8413254
REFERENCE   9  (bases 1 to 3882)
  AUTHORS   Obernolte,R., Bhakta,S., Alvarez,R., Bach,C., Zuppan,P.,
            Mulkins,M., Jarnagin,K. and Shelton,E.R.
  TITLE     The cDNA of a human lymphocyte cyclic-AMP phosphodiesterase (PDE
            IV) reveals a multigene family
  JOURNAL   Gene 129 (2), 239-247 (1993)
   PUBMED   8392015
REFERENCE   10 (bases 1 to 3882)
  AUTHORS   McLaughlin,M.M., Cieslinski,L.B., Burman,M., Torphy,T.J. and
            Livi,G.P.
  TITLE     A low-Km, rolipram-sensitive, cAMP-specific phosphodiesterase from
            human brain. Cloning and expression of cDNA, biochemical
            characterization of recombinant protein, and tissue distribution of
            mRNA
  JOURNAL   J. Biol. Chem. 268 (9), 6470-6476 (1993)
   PUBMED   8384210
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from M97515.1, L20971.1, BC046161.1
            and AW519027.1.
            
            Summary: This gene is a member of the type IV, cyclic AMP
            (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family.
            Cyclic nucleotides are important second messengers that regulate
            and mediate a number of cellular responses to extracellular
            signals, such as hormones, light, and neurotransmitters. The cyclic
            nucleotide phosphodiesterases (PDEs) regulate the cellular
            concentrations of cyclic nucleotides and thereby play a role in
            signal transduction. This gene encodes a protein that specifically
            hydrolyzes cAMP. Altered activity of this protein has been
            associated with schizophrenia and bipolar affective disorder.
            Alternate transcriptional splice variants, encoding different
            isoforms, have been characterized. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (b) contains a distinct 5' UTR and
            lacks an in-frame portion of the 5' coding region, compared to
            variant a. The resulting isoform (2, also referred to as PDE4B2 or
            PDE32) has a shorter and distinct N-terminus when compared to
            isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: M97515.1, L12686.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025082 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-3                 M97515.1           3-5
            4-2816              L20971.1           489-3301
            2817-2833           M97515.1           2817-2833
            2834-2838           L20971.1           3321-3325
            2839-3239           M97515.1           2839-3239
            3240-3269           L20971.1           3726-3755
            3270-3310           M97515.1           3271-3311
            3311-3438           L20971.1           3797-3924
            3439-3686           M97515.1           3439-3686
            3687-3720           BC046161.1         1156-1189
            3721-3762           M97515.1           3721-3762
            3763-3871           BC046161.1         1238-1346
            3872-3882           AW519027.1         1-11                c
FEATURES             Location/Qualifiers
     source          1..3882
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p31"
     gene            1..3882
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="phosphodiesterase 4B, cAMP-specific"
                     /db_xref="GeneID:5142"
                     /db_xref="HGNC:8781"
                     /db_xref="MIM:600127"
     exon            1..511
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       39..42
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="agag"
                     /db_xref="dbSNP:17101822"
     variation       124
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369060694"
     misc_feature    152..154
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="upstream in-frame stop codon"
     variation       272
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376078522"
     CDS             281..1975
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /EC_number="3.1.4.17"
                     /note="isoform 2 is encoded by transcript variant b;
                     phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4
                     dunce homolog, Drosophila); dunce-like phosphodiesterase
                     E4; cAMP-specific 3',5'-cyclic phosphodiesterase 4B;
                     cAMP-specific phosphodiesterase-4 B isoform; PDE32"
                     /codon_start=1
                     /product="cAMP-specific 3',5'-cyclic phosphodiesterase 4B
                     isoform 2"
                     /protein_id="NP_001032416.1"
                     /db_xref="GI:82799482"
                     /db_xref="CCDS:CCDS30743.1"
                     /db_xref="GeneID:5142"
                     /db_xref="HGNC:8781"
                     /db_xref="MIM:600127"
                     /translation="
MKEHGGTFSSTGISGGSGDSAMDSLQPLQPNYMPVCLFAEESYQKLAMETLEELDWCLDQLETIQTYRSVSEMASNKFKRMLNRELTHLSEMSRSGNQVSEYISNTFLDKQNDVEIPSPTQKDREKKKKQQLMTQISGVKKLMHSSSLNNTSISRFGVNTENEDHLAKELEDLNKWGLNIFNVAGYSHNRPLTCIMYAIFQERDLLKTFRISSDTFITYMMTLEDHYHSDVAYHNSLHAADVAQSTHVLLSTPALDAVFTDLEILAAIFAAAIHDVDHPGVSNQFLINTNSELALMYNDESVLENHHLAVGFKLLQEEHCDIFMNLTKKQRQTLRKMVIDMVLATDMSKHMSLLADLKTMVETKKVTSSGVLLLDNYTDRIQVLRNMVHCADLSNPTKSLELYRQWTDRIMEEFFQQGDKERERGMEISPMCDKHTASVEKSQVGFIDYIVHPLWETWADLVQPDAQDILDTLEDNRNWYQSMIPQSPSPPLDEQNRDCQGLMEKFQFELTLDEEDSEGPEKEGEGHSYFSSTKTLCVIDPENRDSLGETDIDIATEDKSPVDT
"
     misc_feature    977..1525
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Metal dependent phosphohydrolases with conserved
                     'HD' motif; Region: HDc; cd00077"
                     /db_xref="CDD:28958"
     misc_feature    order(992..994,1100..1105,1454..1456)
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Zn2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28958"
     misc_feature    1103..1105
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Mg2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28958"
     variation       290
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146117440"
     variation       305
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201181666"
     variation       313
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151263754"
     variation       314
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370407084"
     variation       332
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200202611"
     variation       339
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375930120"
     variation       349
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368502825"
     variation       367
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140445791"
     variation       374
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200929311"
     variation       422
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371423323"
     variation       461
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116739380"
     variation       481
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140500253"
     exon            512..605
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       533
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376229903"
     variation       536
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145203756"
     variation       561
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199554373"
     variation       594
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371297521"
     exon            606..784
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       647
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138828553"
     variation       728
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369849443"
     variation       731
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372730987"
     variation       775
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377188281"
     variation       784
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143554413"
     exon            785..883
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       786
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141692815"
     STS             879..985
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="RH64524"
                     /db_xref="UniSTS:59487"
     exon            884..1048
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       901
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138407878"
     variation       950
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4322205"
     variation       988
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146166974"
     variation       991
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115052833"
     variation       994
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368002134"
     variation       1008
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371715752"
     variation       1021
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202021123"
     exon            1049..1148
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1069
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:783036"
     variation       1097
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185687552"
     variation       1115
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116379917"
     exon            1149..1303
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1156
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144798451"
     exon            1304..1426
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1368
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151031090"
     variation       1385
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:34079300"
     variation       1404
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116816923"
     variation       1414
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373028719"
     variation       1418
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142379593"
     exon            1427..1609
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1433
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370349934"
     variation       1434
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116312841"
     variation       1444
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34492439"
     variation       1459
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367550787"
     variation       1504
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141437989"
     variation       1510
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200251647"
     variation       1531
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41286714"
     variation       1544
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201667673"
     variation       1552
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114211692"
     variation       1561
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370428408"
     variation       1567
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373800241"
     exon            1610..3876
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1675
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149054617"
     variation       1684
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41286716"
     variation       1690
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79722858"
     variation       1691
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114393853"
     variation       1708
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139001333"
     variation       1719
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200211480"
     variation       1730
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371876952"
     variation       1747
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201727510"
     variation       1759
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139374179"
     variation       1760
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149588422"
     variation       1761
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144568843"
     variation       1804
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3181494"
     variation       1805
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042020"
     variation       1808
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34469235"
     variation       1816
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373468487"
     variation       1830
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370754936"
     variation       1858
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372714875"
     variation       1865
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150977853"
     variation       1871
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2227297"
     variation       1872
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375941228"
     variation       1884
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185910614"
     variation       1905
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370636828"
     variation       1919
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200854845"
     variation       1928
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114387631"
     STS             1993..2877
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="PDE4B_372"
                     /db_xref="UniSTS:277574"
     variation       1996
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374227067"
     variation       2015
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115922110"
     variation       2122
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376708525"
     variation       2178
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:57315098"
     variation       2214
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41286718"
     variation       2299
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371856307"
     variation       2347
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:783067"
     variation       2427
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138914808"
     variation       2442
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1804141"
     variation       2515
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141470428"
     variation       2682
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:377201462"
     variation       2692
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181156834"
     variation       2705
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200935637"
     variation       2719
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78315788"
     variation       2939
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150394636"
     variation       2955
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4655837"
     variation       2998..2999
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="aaca"
                     /db_xref="dbSNP:199875231"
     variation       3019
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186227828"
     variation       3119
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190701813"
     STS             3177..3509
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="D1S2393"
                     /db_xref="UniSTS:66663"
     variation       3210
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371829302"
     variation       3255
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:76335673"
     variation       3257
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112424842"
     variation       3271
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3176927"
     variation       3300
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138156061"
     variation       3342
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149577217"
     variation       3371
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144286936"
     variation       3395
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183451410"
     STS             3423..3523
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="SGC30670"
                     /db_xref="UniSTS:79282"
     variation       3467
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186230480"
     variation       3483
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190745276"
     variation       3498
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377465393"
     variation       3506
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377626847"
     polyA_signal    3550..3555
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
     variation       3572
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182887410"
     polyA_site      3584
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /experiment="experimental evidence, no additional details
                     recorded"
     variation       3601
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374581239"
     variation       3718..3719
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="tgggtt"
                     /db_xref="dbSNP:368800294"
     variation       3718
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="aaccca"
                     /db_xref="dbSNP:16354"
     variation       3719..3720
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="gg"
                     /replace="tgggtt"
                     /db_xref="dbSNP:71807410"
     variation       3720..3721
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="ggtttg"
                     /db_xref="dbSNP:141736339"
     variation       3721..3722
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="ggtttg"
                     /db_xref="dbSNP:71682925"
     variation       3721
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368211356"
     variation       3722
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371168935"
     variation       3724
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374364770"
     variation       3773
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376802391"
     variation       3784
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138911836"
     variation       3795..3796
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="tat"
                     /db_xref="dbSNP:202242622"
     polyA_signal    3852..3857
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
     polyA_site      3876
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
ORIGIN      
cacataccctaaagaaccctgggatgactaaggcagagagagtctgagaaaactctttggtgcttctgcctttagttttaggacacatttatgcagatgagcttataagagaccgttccctccgccttcttcctcagaggaagtttcttggtagatcaccgacacctcatccaggcggggggttggggggaaacttggcaccagccatcccaggcagagcaccactgtgatttgttctcctggtggagagagctggaaggaaggagccagcgtgcaaataatgaaggagcacgggggcaccttcagtagcaccggaatcagcggtggtagcggtgactctgctatggacagcctgcagccgctccagcctaactacatgcctgtgtgtttgtttgcagaagaatcttatcaaaaattagcaatggaaacgctggaggaattagactggtgtttagaccagctagagaccatacagacctaccggtctgtcagtgagatggcttctaacaagttcaaaagaatgctgaaccgggagctgacacacctctcagagatgagccgatcagggaaccaggtgtctgaatacatttcaaatactttcttagacaagcagaatgatgtggagatcccatctcctacccagaaagacagggagaaaaagaaaaagcagcagctcatgacccagataagtggagtgaagaaattaatgcatagttcaagcctaaacaatacaagcatctcacgctttggagtcaacactgaaaatgaagatcacctggccaaggagctggaagacctgaacaaatggggtcttaacatctttaatgtggctggatattctcacaatagacccctaacatgcatcatgtatgctatattccaggaaagagacctcctaaagacattcagaatctcatctgacacatttataacctacatgatgactttagaagaccattaccattctgacgtggcatatcacaacagcctgcacgctgctgatgtagcccagtcgacccatgttctcctttctacaccagcattagacgctgtcttcacagatttggagatcctggctgccatttttgcagctgccatccatgacgttgatcatcctggagtctccaatcagtttctcatcaacacaaattcagaacttgctttgatgtataatgatgaatctgtgttggaaaatcatcaccttgctgtgggtttcaaactgctgcaagaagaacactgtgacatcttcatgaatctcaccaagaagcagcgtcagacactcaggaagatggttattgacatggtgttagcaactgatatgtctaaacatatgagcctgctggcagacctgaagacaatggtagaaacgaagaaagttacaagttcaggcgttcttctcctagacaactataccgatcgcattcaggtccttcgcaacatggtacactgtgcagacctgagcaaccccaccaagtccttggaattgtatcggcaatggacagaccgcatcatggaggaatttttccagcagggagacaaagagcgggagaggggaatggaaattagcccaatgtgtgataaacacacagcttctgtggaaaaatcccaggttggtttcatcgactacattgtccatccattgtgggagacatgggcagatttggtacagcctgatgctcaggacattctcgataccttagaagataacaggaactggtatcagagcatgatacctcaaagtccctcaccaccactggacgagcagaacagggactgccagggtctgatggagaagtttcagtttgaactgactctcgatgaggaagattctgaaggacctgagaaggagggagagggacacagctatttcagcagcacaaagacgctttgtgtgattgatccagaaaacagagattccctgggagagactgacatagacattgcaacagaagacaagtcccccgtggatacataatccccctctccctgtggagatgaacattctatccttgatgagcatgccagctatgtggtagggccagcccaccatgggggccaagacctgcacaggacaagggccacctggcctttcagttacttgagtttggagtcagaaagcaagaccaggaagcaaatagcagctcaggaaatcccacggttgacttgccttgatggcaagcttggtggagagggctgaagctgttgctgggggccgattctgatcaagacacatggcttgaaaatggaagacacaaaactgagagatcattctgcactaagtttcgggaacttatccccgacagtgactgaactcactgactaataacttcatttatgaatcttctcacttgtccctttgtctgccaacctgtgtgccttttttgtaaaacattttcatgtctttaaaatgcctgttgaatacctggagtttagtatcaacttctacacagataagctttcaaagttgacaaacttttttgactctttctggaaaagggaaagaaaatagtcttccttctttcttgggcaatatccttcactttactacagttacttttgcaaacagacagaaaggatacacttctaaccacattttacttccttcccctgttgtccagtccaactccacagtcactcttaaaacttctctctgtttgcctgcctccaacagtacttttaactttttgctgtaaacagaataaaattgaacaaattagggggtagaaaggagcagtggtgtcgttcaccgtgagagtctgcatagaactcagcagtgtgccctgctgtgtcttggaccctgccccccacaggagttgtacagtccctggccctgttccctacctcctctcttcaccccgttaggctgttttcaatgtaatgctgccgtccttctcttgcactgccttctgcgctaacacctccattcctgtttataaccgtgtatttattacttaatgtatataatgtaatgttttgtaagttattaatttatatatctaacattgcctgccaatggtggtgttaaatttgtgtagaaaactctgcctaagagttacgactttttcttgtaatgttttgtattgtgtattatataacccaaacgtcacttagtagagacatatggcccccttggcagagaggacaggggtgggcttttgttcaaagggtctgccctttccctgcctgagttgctacttctgcacaacccctttatgaaccagttttggaaacaatattctcacattagatactaaatggtttatactgagcttttacttttgtatagcttgataggggcagggggcaatgggatgtagtttttacccaggttctatccaaatctatgtgggcatgagttgggttataactggatcctactatcattgtggctttggttcaaaaggaaacactacatttgctcacagatgattcttctgaatgctcccgaactactgactttgaagaggtagcctcctgcctgccattaagcaggaatgtcatgttccagttcattacaaaagaaaacaataaaacaatgtgaatttttataataaaatgtgaactgatgtagcaaattacgcaaatgtgaagcctcttctgataacacttgttaggcctcttactgatgtcagtttcagtttgtaaaatatgtttcatgctttcagttcagcattgtgactcagtaattacagaaaatggcacaaatgtgcatgaccaatgtatgtctatgaacactgcattgtttcaggtggacattttatcattttcaaatgtttctcacaatgtatgttatagtattattattatatattgtgttcaaatgcattctaaagagacttttatatgaggtgaataaagaaaagcatgattagattaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5142 -> Molecular function: GO:0004114 [3',5'-cyclic-nucleotide phosphodiesterase activity] evidence: ISS
            GeneID:5142 -> Molecular function: GO:0004115 [3',5'-cyclic-AMP phosphodiesterase activity] evidence: IDA
            GeneID:5142 -> Molecular function: GO:0004115 [3',5'-cyclic-AMP phosphodiesterase activity] evidence: IGI
            GeneID:5142 -> Molecular function: GO:0030552 [cAMP binding] evidence: IGI
            GeneID:5142 -> Molecular function: GO:0044325 [ion channel binding] evidence: ISS
            GeneID:5142 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:5142 -> Biological process: GO:0001780 [neutrophil homeostasis] evidence: ISS
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IDA
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IEA
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IGI
            GeneID:5142 -> Biological process: GO:0030593 [neutrophil chemotaxis] evidence: ISS
            GeneID:5142 -> Biological process: GO:0032729 [positive regulation of interferon-gamma production] evidence: IMP
            GeneID:5142 -> Biological process: GO:0032743 [positive regulation of interleukin-2 production] evidence: IMP
            GeneID:5142 -> Biological process: GO:0035690 [cellular response to drug] evidence: ISS
            GeneID:5142 -> Biological process: GO:0050852 [T cell receptor signaling pathway] evidence: IMP
            GeneID:5142 -> Biological process: GO:0050900 [leukocyte migration] evidence: ISS
            GeneID:5142 -> Biological process: GO:0071222 [cellular response to lipopolysaccharide] evidence: ISS
            GeneID:5142 -> Biological process: GO:0071872 [cellular response to epinephrine stimulus] evidence: ISS
            GeneID:5142 -> Biological process: GO:0086004 [regulation of cardiac muscle cell contraction] evidence: ISS
            GeneID:5142 -> Biological process: GO:1901841 [regulation of high voltage-gated calcium channel activity] evidence: ISS
            GeneID:5142 -> Biological process: GO:1901898 [negative regulation of relaxation of cardiac muscle] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
            GeneID:5142 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:5142 -> Cellular component: GO:0005891 [voltage-gated calcium channel complex] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0030018 [Z disc] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001032416 -> EC 3.1.4.17

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.