GGRNA Home | Help | Advanced search

2024-03-29 08:58:38, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001037333            6498 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens cytoplasmic FMR1 interacting protein 2 (CYFIP2),
            transcript variant 1, mRNA.
ACCESSION   NM_001037333
VERSION     NM_001037333.1  GI:82617633
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6498)
  AUTHORS   Lauc,G., Huffman,J.E., Pucic,M., Zgaga,L., Adamczyk,B., Muzinic,A.,
            Novokmet,M., Polasek,O., Gornik,O., Kristic,J., Keser,T.,
            Vitart,V., Scheijen,B., Uh,H.W., Molokhia,M., Patrick,A.L.,
            McKeigue,P., Kolcic,I., Lukic,I.K., Swann,O., van Leeuwen,F.N.,
            Ruhaak,L.R., Houwing-Duistermaat,J.J., Slagboom,P.E., Beekman,M.,
            de Craen,A.J., Deelder,A.M., Zeng,Q., Wang,W., Hastie,N.D.,
            Gyllensten,U., Wilson,J.F., Wuhrer,M., Wright,A.F., Rudd,P.M.,
            Hayward,C., Aulchenko,Y., Campbell,H. and Rudan,I.
  TITLE     Loci associated with N-glycosylation of human immunoglobulin G show
            pleiotropy with autoimmune diseases and haematological cancers
  JOURNAL   PLoS Genet. 9 (1), E1003225 (2013)
   PUBMED   23382691
REFERENCE   2  (bases 1 to 6498)
  AUTHORS   Hoeffer,C.A., Sanchez,E., Hagerman,R.J., Mu,Y., Nguyen,D.V.,
            Wong,H., Whelan,A.M., Zukin,R.S., Klann,E. and Tassone,F.
  TITLE     Altered mTOR signaling and enhanced CYFIP2 expression levels in
            subjects with fragile X syndrome
  JOURNAL   Genes Brain Behav. 11 (3), 332-341 (2012)
   PUBMED   22268788
  REMARK    GeneRIF: Increased expression of the cytoplasmic FMR1-interacting
            protein 2 (CYFIP2), a known FMRP interactor, is detected in fragile
            X syndrome.
REFERENCE   3  (bases 1 to 6498)
  AUTHORS   Nachmany,H., Wald,S., Abekasis,M., Bulvik,S. and Weil,M.
  TITLE     Two potential biomarkers identified in mesenchymal stem cells and
            leukocytes of patients with sporadic amyotrophic lateral sclerosis
  JOURNAL   Dis. Markers 32 (4), 211-220 (2012)
   PUBMED   22430187
  REMARK    GeneRIF: blood samples of lateral sclerosis patients were found to
            have significantly different levels of expression of CyFIP2 and
            RbBP9 compared to the levels of expression in control subjects.
REFERENCE   4  (bases 1 to 6498)
  AUTHORS   Mongroo,P.S., Noubissi,F.K., Cuatrecasas,M., Kalabis,J., King,C.E.,
            Johnstone,C.N., Bowser,M.J., Castells,A., Spiegelman,V.S. and
            Rustgi,A.K.
  TITLE     IMP-1 displays cross-talk with K-Ras and modulates colon cancer
            cell survival through the novel proapoptotic protein CYFIP2
  JOURNAL   Cancer Res. 71 (6), 2172-2182 (2011)
   PUBMED   21252116
  REMARK    GeneRIF: Studies identify a novel proapoptotic gene target, CYFIP2,
            which is downregulated by IMP-1, and mediates the regulation of
            cell survival and K-Ras expression in colon cancer cells.
REFERENCE   5  (bases 1 to 6498)
  AUTHORS   Anitei,M., Stange,C., Parshina,I., Baust,T., Schenck,A., Raposo,G.,
            Kirchhausen,T. and Hoflack,B.
  TITLE     Protein complexes containing CYFIP/Sra/PIR121 coordinate Arf1 and
            Rac1 signalling during clathrin-AP-1-coated carrier biogenesis at
            the TGN
  JOURNAL   Nat. Cell Biol. 12 (4), 330-340 (2010)
   PUBMED   20228810
  REMARK    GeneRIF: Protein complexes containing CYFIP/Sra/PIR121 coordinate
            Arf1 and Rac1 signalling during clathrin-AP-1-coated carrier
            biogenesis at the trans-golgi network.
            Erratum:[Nat Cell Biol. 2010 May;12(5):520]
REFERENCE   6  (bases 1 to 6498)
  AUTHORS   Eden,S., Rohatgi,R., Podtelejnikov,A.V., Mann,M. and Kirschner,M.W.
  TITLE     Mechanism of regulation of WAVE1-induced actin nucleation by Rac1
            and Nck
  JOURNAL   Nature 418 (6899), 790-793 (2002)
   PUBMED   12181570
REFERENCE   7  (bases 1 to 6498)
  AUTHORS   Schenck,A., Bardoni,B., Moro,A., Bagni,C. and Mandel,J.L.
  TITLE     A highly conserved protein family interacting with the fragile X
            mental retardation protein (FMRP) and displaying selective
            interactions with FMRP-related proteins FXR1P and FXR2P
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 98 (15), 8844-8849 (2001)
   PUBMED   11438699
REFERENCE   8  (bases 1 to 6498)
  AUTHORS   Saller,E., Tom,E., Brunori,M., Otter,M., Estreicher,A., Mack,D.H.
            and Iggo,R.
  TITLE     Increased apoptosis induction by 121F mutant p53
  JOURNAL   EMBO J. 18 (16), 4424-4437 (1999)
   PUBMED   10449408
REFERENCE   9  (bases 1 to 6498)
  AUTHORS   Witke,W., Podtelejnikov,A.V., Di Nardo,A., Sutherland,J.D.,
            Gurniak,C.B., Dotti,C. and Mann,M.
  TITLE     In mouse brain profilin I and profilin II associate with regulators
            of the endocytic pathway and actin assembly
  JOURNAL   EMBO J. 17 (4), 967-976 (1998)
   PUBMED   9463375
REFERENCE   10 (bases 1 to 6498)
  AUTHORS   Kitamura,T., Kitamura,Y., Yonezawa,K., Totty,N.F., Gout,I.,
            Hara,K., Waterfield,M.D., Sakaue,M., Ogawa,W. and Kasuga,M.
  TITLE     Molecular cloning of p125Nap1, a protein that associates with an
            SH3 domain of Nck
  JOURNAL   Biochem. Biophys. Res. Commun. 219 (2), 509-514 (1996)
   PUBMED   8605018
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL136549.1, BC011762.1 and AC008676.6.
            
            Transcript Variant: This variant (1) uses a different splice site
            in the 5' UTR, compared to variant 2. Variants 1, 2, and 3 all
            encode the same protein.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AL136549.1, AF160973.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025083 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1095              AL136549.1         1-1095
            1096-2449           BC011762.1         1223-2576
            2450-4124           AL136549.1         2450-4124
            4125-6498           AC008676.6         158750-161123       c
FEATURES             Location/Qualifiers
     source          1..6498
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q33.3"
     gene            1..6498
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /note="cytoplasmic FMR1 interacting protein 2"
                     /db_xref="GeneID:26999"
                     /db_xref="HGNC:13760"
                     /db_xref="HPRD:07556"
                     /db_xref="MIM:606323"
     exon            1..115
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       18
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:62383002"
     exon            116..255
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     CDS             139..3900
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /note="p53 inducible protein; p53-inducible protein 121"
                     /codon_start=1
                     /product="cytoplasmic FMR1-interacting protein 2"
                     /protein_id="NP_001032410.1"
                     /db_xref="GI:82617634"
                     /db_xref="GeneID:26999"
                     /db_xref="HGNC:13760"
                     /db_xref="HPRD:07556"
                     /db_xref="MIM:606323"
                     /translation="
MTTHVTLEDALSNVDLLEELPLPDQQPCIEPPPSSIMYQANFDTNFEDRNAFVTGIARYIEQATVHSSMNEMLEEGHEYAVMLYTWRSCSRAIPQVKCNEQPNRVEIYEKTVEVLEPEVTKLMKFMYFQRKAIERFCSEVKRLCHAERRKDFVSEAYLLTLGKFINMFAVLDELKNMKCSVKNDHSAYKRAAQFLRKMADPQSIQESQNLSMFLANHNRITQCLHQQLEVIPGYEELLADIVNICVDYYENKMYLTPSEKHMLLKVMGFGLYLMDGNVSNIYKLDAKKRINLSKIDKFFKQLQVVPLFGDMQIELARYIKTSAHYEENKSKWTCTQSSISPQYNICEQMVQIRDDHIRFISELARYSNSEVVTGSGLDSQKSDEEYRELFDLALRGLQLLSKWSAHVMEVYSWKLVHPTDKFCNKDCPGTAEEYERATRYNYTSEEKFAFVEVIAMIKGLQVLMGRMESVFNQAIRNTIYAALQDFAQVTLREPLRQAVRKKKNVLISVLQAIRKTICDWEGGREPPNDPCLRGEKDPKGGFDIKVPRRAVGPSSTQLYMVRTMLESLIADKSGSKKTLRSSLDGPIVLAIEDFHKQSFFFTHLLNISEALQQCCDLSQLWFREFFLELTMGRRIQFPIEMSMPWILTDHILETKEPSMMEYVLYPLDLYNDSAYYALTKFKKQFLYDEIEAEVNLCFDQFVYKLADQIFAYYKAMAGSVLLDKRFRAECKNYGVIIPYPPSNRYETLLKQRHVQLLGRSIDLNRLITQRISAAMYKSLDQAISRFESEDLTSIVELEWLLEINRLTHRLLCKHMTLDSFDAMFREANHNVSAPYGRITLHVFWELNFDFLPNYCYNGSTNRFVRTAIPFTQEPQRDKPANVQPYYLYGSKPLNIAYSHIYSSYRNFVGPPHFKTICRLLGYQGIAVVMEELLKIVKSLLQGTILQYVKTLIEVMPKICRLPRHEYGSPGILEFFHHQLKDIIEYAELKTDVFQSLREVGNAILFCLLIEQALSQEEVCDLLHAAPFQNILPRVYIKEGERLEVRMKRLEAKYAPLHLVPLIERLGTPQQIAIAREGDLLTKERLCCGLSMFEVILTRIRSYLQDPIWRGPPPTNGVMHVDECVEFHRLWSAMQFVYCIPVGTNEFTAEQCFGDGLNWAGCSIIVLLGQQRRFDLFDFCYHLLKVQRQDGKDEIIKNVPLKKMADRIRKYQILNNEVFAILNKYMKSVETDSSTVEHVRCFQPPIHQSLATTC
"
     misc_feature    1288..3807
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /note="Cytoplasmic Fragile-X interacting family; Region:
                     FragX_IP; pfam05994"
                     /db_xref="CDD:218846"
     misc_feature    3247..3249
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine; propagated from
                     UniProtKB/Swiss-Prot (Q96F07.2); acetylation site"
     variation       147
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371578292"
     variation       177
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376687042"
     variation       219
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367998009"
     variation       247
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371710290"
     variation       249
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369640959"
     exon            256..345
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       300
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375350435"
     variation       336
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369941644"
     exon            346..420
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       371
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373074465"
     variation       378
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376568198"
     variation       417..419
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:5872508"
     variation       417
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200051515"
     exon            421..525
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       432
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368093712"
     variation       435
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139530784"
     exon            526..707
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       537
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148895189"
     variation       576
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375762537"
     variation       635
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369872275"
     variation       672
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369062847"
     variation       678
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373151265"
     exon            708..804
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       735
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185022541"
     variation       759
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199855067"
     exon            805..933
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     exon            934..1038
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     exon            1039..1130
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1096
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3207362"
     exon            1131..1248
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1131
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376920120"
     variation       1136
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148350606"
     variation       1179
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373676501"
     variation       1191
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372848474"
     variation       1221
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376982797"
     exon            1249..1368
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1287
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368645883"
     variation       1308
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139943836"
     exon            1369..1494
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1425
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17054446"
     variation       1431
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369323669"
     variation       1437
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372259482"
     exon            1495..1661
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1500
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6885590"
     variation       1545
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377728487"
     variation       1618
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370137201"
     exon            1662..1809
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1662
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370084969"
     variation       1663
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372630008"
     variation       1668
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1823035"
     variation       1785
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185026624"
     exon            1810..1963
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1883
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370992962"
     variation       1893
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142973944"
     exon            1964..2120
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1989
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367974123"
     variation       2037
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372104693"
     variation       2043
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375426388"
     variation       2055
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369858004"
     exon            2121..2217
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2151
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199725246"
     variation       2157
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372517333"
     variation       2160
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375703811"
     variation       2199
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11551374"
     exon            2218..2294
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     exon            2295..2403
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2340
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374669553"
     variation       2351
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367713994"
     variation       2352
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141399379"
     variation       2361
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147011006"
     variation       2369
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376060688"
     variation       2379
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116817896"
     exon            2404..2523
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2415
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375270131"
     variation       2450
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17850790"
     variation       2485
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139353471"
     variation       2486
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373467559"
     variation       2511
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:13354242"
     exon            2524..2723
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2538
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377148423"
     variation       2539
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201559066"
     variation       2559
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369405267"
     variation       2561
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374132627"
     variation       2582
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377648376"
     variation       2586
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371132555"
     variation       2612
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:58005665"
     variation       2632
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11551375"
     variation       2634
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373107748"
     variation       2635
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377031549"
     exon            2724..2811
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2737
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371766099"
     variation       2758
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375088064"
     variation       2778
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7705781"
     variation       2797
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373799565"
     exon            2812..2955
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2847
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371615057"
     variation       2884
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9313557"
     variation       2913
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183570769"
     variation       2922
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186955009"
     exon            2956..3046
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3015
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373712469"
     exon            3047..3177
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3081
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372286637"
     variation       3093
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377070210"
     variation       3094
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377125065"
     variation       3144
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150652041"
     exon            3178..3250
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     STS             3189..3253
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /standard_name="STS-M62008"
                     /db_xref="UniSTS:55216"
     variation       3219
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372902849"
     exon            3251..3345
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3260
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368529367"
     variation       3276
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371277463"
     variation       3280
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374707103"
     variation       3291
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73307968"
     variation       3300
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372007539"
     variation       3333
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376770442"
     exon            3346..3584
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3363
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369693364"
     variation       3464
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200428535"
     variation       3467
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374666951"
     variation       3474
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114967929"
     variation       3489
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373142413"
     variation       3501
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199725841"
     variation       3520
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376484231"
     variation       3526
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199945789"
     variation       3529
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201475685"
     variation       3532
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369611074"
     variation       3550
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148677157"
     variation       3582
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377656882"
     exon            3585..3732
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3597
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368047583"
     variation       3666
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200774279"
     exon            3733..6498
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3783
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375350614"
     STS             3823..4106
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /standard_name="RH18378"
                     /db_xref="UniSTS:21434"
     variation       3830
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182717318"
     variation       3836
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370184404"
     variation       3853
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371399881"
     variation       3854
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201882855"
     variation       3864
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1803834"
     STS             3870..4000
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /standard_name="RH15890"
                     /db_xref="UniSTS:66388"
     variation       3891
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375865980"
     variation       3924
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150599988"
     variation       3946
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373854212"
     variation       3952
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199652534"
     variation       3959
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:13174378"
     variation       4049
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73307980"
     variation       4084
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188974329"
     variation       4108..4109
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:33954943"
     variation       4108
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:3052310"
     variation       4121..4124
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="aaaa"
                     /db_xref="dbSNP:77677846"
     variation       4161
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367860573"
     variation       4319
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73309941"
     variation       4327
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368328314"
     variation       4347
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62387481"
     variation       4395
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149305788"
     variation       4444..4445
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:201743820"
     variation       4445..4446
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="tggcttcccaaagccccattcta"
                     /db_xref="dbSNP:372558922"
     variation       4450
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:199925015"
     variation       4470
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147411422"
     variation       4492
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140777310"
     variation       4493
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:375776712"
     variation       4493
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144727795"
     variation       4558
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192134177"
     variation       4576
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147444680"
     STS             4601..4812
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /standard_name="A006W02"
                     /db_xref="UniSTS:11242"
     variation       4714
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:182865053"
     variation       4777
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6555991"
     variation       4849
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6555992"
     variation       4864
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367959403"
     variation       5020
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376881838"
     variation       5060
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148519938"
     variation       5109
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3734034"
     variation       5205
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6862302"
     variation       5217
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187411866"
     variation       5246
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1058517"
     variation       5296
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61736011"
     variation       5381
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142969781"
     variation       5514..5515
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="gc"
                     /replace="tt"
                     /db_xref="dbSNP:377513219"
     variation       5514
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6880851"
     variation       5515
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6882097"
     variation       5542
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76594372"
     variation       5546..5547
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:370196582"
     variation       5577
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141032109"
     variation       5636
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375360183"
     variation       5660
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184072551"
     variation       5790
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11545337"
     variation       5840
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:80098745"
     variation       5895
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113243312"
     variation       5981
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143764472"
     variation       6022
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146850512"
     variation       6041
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140263633"
     variation       6072
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:111840775"
     variation       6088
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3087968"
     variation       6122
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10073822"
     variation       6188
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115781943"
     variation       6346
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375053822"
     variation       6347
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186546184"
     variation       6373
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145397143"
     variation       6436
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371519970"
ORIGIN      
cggggccggggcggggccgagcgcggcgcagcggagcggggcagagcatcctgcgccccggcgcggggccctgcggtagcctcaggcccctcccctggacccgccgcagagccagtgcagaatacagaaactgcagccatgaccacgcacgtcaccctggaagatgccctgtccaacgtggacctgcttgaagagcttcccctccccgaccagcagccatgcatcgagcctccaccttcctccatcatgtaccaggctaactttgacacaaactttgaggacaggaatgcatttgtcacgggcattgcaaggtacattgagcaggctacagtccactccagcatgaatgagatgctggaggaaggacatgagtatgcggtcatgctgtacacctggcgcagctgttcccgggccattccccaggtgaaatgcaacgagcagcccaaccgagtagagatctatgagaagacagtagaggtgctggagccggaggtcaccaagctcatgaagttcatgtattttcagcgcaaggccatcgagcggttctgcagcgaggtgaagcggctgtgccatgccgagcgcaggaaggactttgtctctgaggcctacctcctgacccttggcaagttcatcaacatgtttgctgtcctggatgagctaaagaacatgaagtgcagcgtcaagaatgaccactctgcctacaagagggcagcacagttcctgcggaagatggcagatccccagtctatccaggagtcgcagaacctttccatgttcctggccaaccacaacaggatcacccagtgtctccaccagcaacttgaagtgatcccaggctatgaggagctgctggctgacattgtcaacatctgtgtggattactacgagaacaagatgtacctgactcccagtgagaaacatatgctcctcaaggtgatgggctttggcctctacctaatggatggaaatgtcagtaacatttacaaactggatgccaagaagagaattaatcttagcaaaattgataaattctttaagcagctgcaggtggtgccccttttcggcgacatgcagatagagctggccagatacattaagaccagtgctcactatgaagagaacaagtccaagtggacgtgcacccagagcagcatcagcccccagtacaatatctgcgagcagatggttcagatccgggatgaccacatccgcttcatctccgagctcgctcgctacagcaacagtgaggtggtgacgggctcagggctggacagccagaagtcagacgaggagtatcgcgagctcttcgacctagccctgcggggtctgcagcttctatccaagtggagcgcccacgtcatggaggtgtactcttggaagctggttcatcccacagacaagttctgcaacaaggactgtcctggcaccgcggaggaatatgagagagccacacgctacaattacaccagtgaggaaaaatttgccttcgttgaggtgatcgccatgatcaaaggcctgcaggtgctcatgggcaggatggagagcgtcttcaaccaggccatcaggaacaccatctacgcggcattgcaggacttcgcccaggtgacgctgcgtgagcccctgcggcaggcggtacggaagaagaagaatgtcctcatcagcgtcctacaggcaattcgaaagaccatctgtgactgggagggagggcgagagccccctaatgacccatgcttgagaggggagaaggaccccaaaggtggatttgatatcaaggtgccccggcgtgctgtggggccatccagcacacagctgtacatggtgcggaccatgcttgaatcactcattgcagacaaaagcggctccaagaagaccctgaggagcagcctggatggacccattgtcctcgccatagaggactttcacaaacagtccttcttcttcacacatctgctcaacatcagtgaagccctgcagcagtgttgtgacctctcccagctctggttccgagaattcttcctggagttaaccatgggccgacgaatccagttccccatcgagatgtccatgccctggattctaacggaccatatcctggaaaccaaagaaccttccatgatggagtatgtcctctaccctctggatctgtacaacgacagcgcctactatgctctgaccaagtttaaaaagcagttcctgtacgatgagatagaagctgaggtgaacctgtgttttgatcagtttgtctacaagctggcagaccagatctttgcttactacaaagccatggctggcagtgtcctgttggataaacgttttcgagctgagtgtaagaattatggcgtcatcattccgtatccaccgtccaatcgctatgaaacactgctgaagcagagacacgtccagctgttgggtagatcaattgacttgaacagactcattacccagcgcatctctgccgccatgtataaatccttggaccaagctatcagccgctttgagagtgaggacctgacctccattgtggagctggagtggctgctggagattaaccggctcacgcatcggctgctctgtaagcatatgacgctggacagcttcgatgccatgttccgagaggccaatcacaatgtgtccgccccctatggccgtatcaccctgcatgtcttctgggaactgaactttgactttctccccaactactgctacaatgggtccactaaccgttttgtgcggactgccattcctttcacccaagaaccacaacgagacaaacctgccaacgtccagccttattacctctatggatccaagcctctcaacattgcctacagccacatctacagctcctacaggaatttcgtggggccacctcatttcaagactatctgcagactcctgggttatcagggcatcgctgtggtcatggaggaactgctaaagattgtgaagagcttgctccaaggaaccattctccagtatgtgaaaacactgatagaggtgatgcccaagatatgccgcttgccccgacatgagtatggctccccagggatcctggagttcttccaccaccagctgaaggacatcattgagtacgcagagctcaaaacagacgtgttccagagcctgagggaagtgggcaatgccatcctcttctgcctcctcatagagcaagctctgtctcaggaggaggtctgcgatttgctccatgccgcacccttccaaaacatcttgcctagagtctacatcaaagagggggagcgcctggaggtccggatgaaacgtctggaagccaagtatgccccgctccacctggtccctctgatcgagcggctggggacccctcagcaaatcgccattgctcgcgagggtgacctcctgaccaaggagcggctgtgctgtggcctgtccatgttcgaggtcatcctgacccgcattcggagctacctgcaggaccccatctggcggggcccaccgcccaccaatggcgtcatgcacgtcgatgagtgtgtggagttccaccggctgtggagcgccatgcagttcgtgtactgcatccctgtgggaaccaacgagttcacagctgagcagtgtttcggcgatggcttgaactgggctggttgctccatcattgtcctgctgggccagcagcgtcgctttgacctgttcgacttctgttaccacctgctaaaagtgcagaggcaggacgggaaggatgaaatcattaagaatgtgcccctgaagaagatggccgaccggatcaggaagtatcagatcttgaacaatgaggtttttgccatcctgaacaaatacatgaagtccgtggagacagacagttccactgtggagcatgtgcgctgcttccagccacccatccaccagtccttggccaccacttgctaagcagaagatcctgcagacccttatctggaggaggaagagaagcaggagagagaaagccacagccagcctgccataggatccaactggacaacgtgtgggatggacctggaaacaagcacctccccaaacacatcaccactccctagggcggggcctgtgcatgctctcccatgacatctccatgctggtttctccatagcataaatgaaaaaaaaaaaaaaaaagtaaacagggcagtgtgtgctttttcttttctcccccctcaactatattaagaactcctagtttcaccctttctccatcccatcatcccacctatctgtggttgcttcccaagacctcctcccaagatagacatctcctacccagtgcccttgtgtgaccccaggactcaagtctcagactgtgaacagatgtggccatgcccagagacgccagcctggccagaagggcatgcctcagcttactacttcatctctcctggttccctccctgcagtgccccgggtgtcatcttctcccactctgggtaccagggattctaccacataggcttcccaaagccccattctaactcccctctctcagggaagccctagagagaggtccaaaaagcattcacagctgtatcacactctatgcaggtggggtaggagactgatcaggcctgctgtggggaagcagtatgtatgaacacagccagaaatgtcatagtccaaacaggatgctttcaggccatctcagctgcttgatggtgagatggttcccttattccttcaggaaaggcttagcattgggccacataggggaagcagctttgaacaaatcagtcatagcactgcctatagcattagccagtgaccaaattagggacaacgtcttggcacagaattgcttatcaaggaacatttccacaagaaagaaaatattaaggggttatttccacagaagcccaaaacgtcttggaaacacagaggtgaggaggaggaatagtaattgtcaatgagcttttaataccaagatacaccccctgcccccaaagaagagtcctcttttagggaatcagaaccttcattgtcctagaagctgaaagattcttggaacattttagcttttactctcaacttgctgttctctttacattccttaagttagactttcgggtgtggcttctctcccaggggtaacatttacttccattttctagactgaaccaaaagtcttctgcagaatctcccaccgagtgtggtaagaaggaaggacaaaaggctttaggatataaatttcatgttacagagcatgtcattgtcaaaggaaatctgtggccctgagattttaagaacataaaatgtgacatttgatatttctccagcccagggaagtaagatggttagcaatggttgccttaatcaaatggtcccatttttaaccccaaaggaagtgcccacagcaagaggtttgtgtgatgcacttatgtcctccggtgaggaaagggggccacatatgaaaggccccttaggtcagatcctgagagtagcacatttgagtgcagattcctgggccccacctcaaacctactaattctgaatctctgggaatagggccaggaaatctgccctttctacaaactacccaagttgttctgttgcacatcaatgtttgggaaccactgctgtaagggaatcattctggtcaccttgagctttgagctaccactaagccatgaaagaaaatacatcatacagggaagagagaagggaggaggttccaagtagtaactggcagatcctcctgtctggaggtaccaccttctattctggtttctgacttttccttcttgatgaccatagatgtgttccagaggcaaaagagacacattatcccagatggcagaacatgctttcaaaacatataaaatgtcaaagttccagatccttctacatctttagtcctgtctgaggatggtagctggctctctgtagctgatagatggctagagttccatccaaatccttgaccacgacttcatggagatttgaataatctatttgatgagatttctatttcaataacccacctctctcaccccacattcatatccctaaatttgaccctctgggccgagtcacattaccttcaggagacttgatcccagtagactgaggtcttccctttcagcagaaagatttcatttccctggcttgccagtggcactgatttccgaacacccaatgagtttaatattctttcctccttggcattactgccccagcctctttttattttttttgtgtgtgtctaataaccaggaaaaaaataaagcttaggttttaaaaagttttaaaaataatctgtttcagaaactgtcaaatgtaccatatttgtattaagagttgttgggaatttttgtacaatgaatttacatttatttatggtgacatatttacgcttgtgatcaaataatgatgttaaattcttaaatcatatttgctatgcagctgaagatgatattttgatttgtattttgggggtacctgtgttgagttgataaacatttccatcttcattaaaactgcttccaaactagtaaaaccagcaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:26999 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:26999 -> Biological process: GO:0006915 [apoptotic process] evidence: IDA
            GeneID:26999 -> Biological process: GO:0016337 [cell-cell adhesion] evidence: IDA
            GeneID:26999 -> Biological process: GO:0038096 [Fc-gamma receptor signaling pathway involved in phagocytosis] evidence: TAS
            GeneID:26999 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
            GeneID:26999 -> Biological process: GO:0045862 [positive regulation of proteolysis] evidence: IDA
            GeneID:26999 -> Biological process: GO:0097202 [activation of cysteine-type endopeptidase activity] evidence: IDA
            GeneID:26999 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:26999 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:26999 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
            GeneID:26999 -> Cellular component: GO:0043005 [neuron projection] evidence: IEA
            GeneID:26999 -> Cellular component: GO:0045202 [synapse] evidence: IDA
            GeneID:26999 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.