GGRNA Home | Help | Advanced search

2024-03-29 15:34:53, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001037332            6791 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens cytoplasmic FMR1 interacting protein 2 (CYFIP2),
            transcript variant 2, mRNA.
ACCESSION   NM_001037332
VERSION     NM_001037332.2  GI:116805787
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6791)
  AUTHORS   Lauc,G., Huffman,J.E., Pucic,M., Zgaga,L., Adamczyk,B., Muzinic,A.,
            Novokmet,M., Polasek,O., Gornik,O., Kristic,J., Keser,T.,
            Vitart,V., Scheijen,B., Uh,H.W., Molokhia,M., Patrick,A.L.,
            McKeigue,P., Kolcic,I., Lukic,I.K., Swann,O., van Leeuwen,F.N.,
            Ruhaak,L.R., Houwing-Duistermaat,J.J., Slagboom,P.E., Beekman,M.,
            de Craen,A.J., Deelder,A.M., Zeng,Q., Wang,W., Hastie,N.D.,
            Gyllensten,U., Wilson,J.F., Wuhrer,M., Wright,A.F., Rudd,P.M.,
            Hayward,C., Aulchenko,Y., Campbell,H. and Rudan,I.
  TITLE     Loci associated with N-glycosylation of human immunoglobulin G show
            pleiotropy with autoimmune diseases and haematological cancers
  JOURNAL   PLoS Genet. 9 (1), E1003225 (2013)
   PUBMED   23382691
REFERENCE   2  (bases 1 to 6791)
  AUTHORS   Hoeffer,C.A., Sanchez,E., Hagerman,R.J., Mu,Y., Nguyen,D.V.,
            Wong,H., Whelan,A.M., Zukin,R.S., Klann,E. and Tassone,F.
  TITLE     Altered mTOR signaling and enhanced CYFIP2 expression levels in
            subjects with fragile X syndrome
  JOURNAL   Genes Brain Behav. 11 (3), 332-341 (2012)
   PUBMED   22268788
  REMARK    GeneRIF: Increased expression of the cytoplasmic FMR1-interacting
            protein 2 (CYFIP2), a known FMRP interactor, is detected in fragile
            X syndrome.
REFERENCE   3  (bases 1 to 6791)
  AUTHORS   Nachmany,H., Wald,S., Abekasis,M., Bulvik,S. and Weil,M.
  TITLE     Two potential biomarkers identified in mesenchymal stem cells and
            leukocytes of patients with sporadic amyotrophic lateral sclerosis
  JOURNAL   Dis. Markers 32 (4), 211-220 (2012)
   PUBMED   22430187
  REMARK    GeneRIF: blood samples of lateral sclerosis patients were found to
            have significantly different levels of expression of CyFIP2 and
            RbBP9 compared to the levels of expression in control subjects.
REFERENCE   4  (bases 1 to 6791)
  AUTHORS   Mongroo,P.S., Noubissi,F.K., Cuatrecasas,M., Kalabis,J., King,C.E.,
            Johnstone,C.N., Bowser,M.J., Castells,A., Spiegelman,V.S. and
            Rustgi,A.K.
  TITLE     IMP-1 displays cross-talk with K-Ras and modulates colon cancer
            cell survival through the novel proapoptotic protein CYFIP2
  JOURNAL   Cancer Res. 71 (6), 2172-2182 (2011)
   PUBMED   21252116
  REMARK    GeneRIF: Studies identify a novel proapoptotic gene target, CYFIP2,
            which is downregulated by IMP-1, and mediates the regulation of
            cell survival and K-Ras expression in colon cancer cells.
REFERENCE   5  (bases 1 to 6791)
  AUTHORS   Anitei,M., Stange,C., Parshina,I., Baust,T., Schenck,A., Raposo,G.,
            Kirchhausen,T. and Hoflack,B.
  TITLE     Protein complexes containing CYFIP/Sra/PIR121 coordinate Arf1 and
            Rac1 signalling during clathrin-AP-1-coated carrier biogenesis at
            the TGN
  JOURNAL   Nat. Cell Biol. 12 (4), 330-340 (2010)
   PUBMED   20228810
  REMARK    GeneRIF: Protein complexes containing CYFIP/Sra/PIR121 coordinate
            Arf1 and Rac1 signalling during clathrin-AP-1-coated carrier
            biogenesis at the trans-golgi network.
            Erratum:[Nat Cell Biol. 2010 May;12(5):520]
REFERENCE   6  (bases 1 to 6791)
  AUTHORS   Eden,S., Rohatgi,R., Podtelejnikov,A.V., Mann,M. and Kirschner,M.W.
  TITLE     Mechanism of regulation of WAVE1-induced actin nucleation by Rac1
            and Nck
  JOURNAL   Nature 418 (6899), 790-793 (2002)
   PUBMED   12181570
REFERENCE   7  (bases 1 to 6791)
  AUTHORS   Schenck,A., Bardoni,B., Moro,A., Bagni,C. and Mandel,J.L.
  TITLE     A highly conserved protein family interacting with the fragile X
            mental retardation protein (FMRP) and displaying selective
            interactions with FMRP-related proteins FXR1P and FXR2P
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 98 (15), 8844-8849 (2001)
   PUBMED   11438699
REFERENCE   8  (bases 1 to 6791)
  AUTHORS   Saller,E., Tom,E., Brunori,M., Otter,M., Estreicher,A., Mack,D.H.
            and Iggo,R.
  TITLE     Increased apoptosis induction by 121F mutant p53
  JOURNAL   EMBO J. 18 (16), 4424-4437 (1999)
   PUBMED   10449408
REFERENCE   9  (bases 1 to 6791)
  AUTHORS   Witke,W., Podtelejnikov,A.V., Di Nardo,A., Sutherland,J.D.,
            Gurniak,C.B., Dotti,C. and Mann,M.
  TITLE     In mouse brain profilin I and profilin II associate with regulators
            of the endocytic pathway and actin assembly
  JOURNAL   EMBO J. 17 (4), 967-976 (1998)
   PUBMED   9463375
REFERENCE   10 (bases 1 to 6791)
  AUTHORS   Kitamura,T., Kitamura,Y., Yonezawa,K., Totty,N.F., Gout,I.,
            Hara,K., Waterfield,M.D., Sakaue,M., Ogawa,W. and Kasuga,M.
  TITLE     Molecular cloning of p125Nap1, a protein that associates with an
            SH3 domain of Nck
  JOURNAL   Biochem. Biophys. Res. Commun. 219 (2), 509-514 (1996)
   PUBMED   8605018
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL559919.3, BG257432.1, AL136549.1, BC011762.1 and AC008676.6.
            On Oct 27, 2006 this sequence version replaced gi:82617635.
            
            Transcript Variant: This variant (2) represents the longest
            transcript. Variants 1, 2, and 3 all encode the same protein.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            CDS exon combination :: BC021008.1, AF160973.1 [ECO:0000331]
            RNAseq introns       :: single sample supports all introns
                                    ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-48                AL559919.3         4-51
            49-375              BG257432.1         17-343
            376-638             AL559919.3         380-642
            639-1388            AL136549.1         346-1095
            1389-2742           BC011762.1         1223-2576
            2743-4417           AL136549.1         2450-4124
            4418-6791           AC008676.6         158750-161123       c
FEATURES             Location/Qualifiers
     source          1..6791
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q33.3"
     gene            1..6791
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /note="cytoplasmic FMR1 interacting protein 2"
                     /db_xref="GeneID:26999"
                     /db_xref="HGNC:13760"
                     /db_xref="MIM:606323"
     exon            1..408
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       114
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370043679"
     variation       179
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11551377"
     misc_feature    342..344
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /note="upstream in-frame stop codon"
     variation       371
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11551376"
     variation       376
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187458"
     variation       402
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114654219"
     exon            409..548
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     CDS             432..4193
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /note="p53 inducible protein; p53-inducible protein 121"
                     /codon_start=1
                     /product="cytoplasmic FMR1-interacting protein 2"
                     /protein_id="NP_001032409.2"
                     /db_xref="GI:116805788"
                     /db_xref="GeneID:26999"
                     /db_xref="HGNC:13760"
                     /db_xref="MIM:606323"
                     /translation="
MTTHVTLEDALSNVDLLEELPLPDQQPCIEPPPSSIMYQANFDTNFEDRNAFVTGIARYIEQATVHSSMNEMLEEGHEYAVMLYTWRSCSRAIPQVKCNEQPNRVEIYEKTVEVLEPEVTKLMKFMYFQRKAIERFCSEVKRLCHAERRKDFVSEAYLLTLGKFINMFAVLDELKNMKCSVKNDHSAYKRAAQFLRKMADPQSIQESQNLSMFLANHNRITQCLHQQLEVIPGYEELLADIVNICVDYYENKMYLTPSEKHMLLKVMGFGLYLMDGNVSNIYKLDAKKRINLSKIDKFFKQLQVVPLFGDMQIELARYIKTSAHYEENKSKWTCTQSSISPQYNICEQMVQIRDDHIRFISELARYSNSEVVTGSGLDSQKSDEEYRELFDLALRGLQLLSKWSAHVMEVYSWKLVHPTDKFCNKDCPGTAEEYERATRYNYTSEEKFAFVEVIAMIKGLQVLMGRMESVFNQAIRNTIYAALQDFAQVTLREPLRQAVRKKKNVLISVLQAIRKTICDWEGGREPPNDPCLRGEKDPKGGFDIKVPRRAVGPSSTQLYMVRTMLESLIADKSGSKKTLRSSLDGPIVLAIEDFHKQSFFFTHLLNISEALQQCCDLSQLWFREFFLELTMGRRIQFPIEMSMPWILTDHILETKEPSMMEYVLYPLDLYNDSAYYALTKFKKQFLYDEIEAEVNLCFDQFVYKLADQIFAYYKAMAGSVLLDKRFRAECKNYGVIIPYPPSNRYETLLKQRHVQLLGRSIDLNRLITQRISAAMYKSLDQAISRFESEDLTSIVELEWLLEINRLTHRLLCKHMTLDSFDAMFREANHNVSAPYGRITLHVFWELNFDFLPNYCYNGSTNRFVRTAIPFTQEPQRDKPANVQPYYLYGSKPLNIAYSHIYSSYRNFVGPPHFKTICRLLGYQGIAVVMEELLKIVKSLLQGTILQYVKTLIEVMPKICRLPRHEYGSPGILEFFHHQLKDIIEYAELKTDVFQSLREVGNAILFCLLIEQALSQEEVCDLLHAAPFQNILPRVYIKEGERLEVRMKRLEAKYAPLHLVPLIERLGTPQQIAIAREGDLLTKERLCCGLSMFEVILTRIRSYLQDPIWRGPPPTNGVMHVDECVEFHRLWSAMQFVYCIPVGTNEFTAEQCFGDGLNWAGCSIIVLLGQQRRFDLFDFCYHLLKVQRQDGKDEIIKNVPLKKMADRIRKYQILNNEVFAILNKYMKSVETDSSTVEHVRCFQPPIHQSLATTC
"
     misc_feature    1581..4100
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /note="Cytoplasmic Fragile-X interacting family; Region:
                     FragX_IP; pfam05994"
                     /db_xref="CDD:218846"
     misc_feature    3540..3542
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine; propagated from
                     UniProtKB/Swiss-Prot (Q96F07.2); acetylation site"
     variation       440
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371578292"
     variation       470
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376687042"
     variation       512
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367998009"
     variation       540
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371710290"
     variation       542
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369640959"
     exon            549..638
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       593
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375350435"
     variation       629
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369941644"
     exon            639..713
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       664
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373074465"
     variation       671
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376568198"
     variation       710..712
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:5872508"
     variation       710
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200051515"
     exon            714..818
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       725
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368093712"
     variation       728
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139530784"
     exon            819..1000
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       830
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148895189"
     variation       869
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375762537"
     variation       928
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369872275"
     variation       965
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369062847"
     variation       971
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373151265"
     exon            1001..1097
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1028
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185022541"
     variation       1052
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199855067"
     exon            1098..1226
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     exon            1227..1331
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     exon            1332..1423
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1389
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3207362"
     exon            1424..1541
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1424
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376920120"
     variation       1429
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148350606"
     variation       1472
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373676501"
     variation       1484
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372848474"
     variation       1514
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376982797"
     exon            1542..1661
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1580
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368645883"
     variation       1601
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139943836"
     exon            1662..1787
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1718
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17054446"
     variation       1724
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369323669"
     variation       1730
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372259482"
     exon            1788..1954
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1793
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6885590"
     variation       1838
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377728487"
     variation       1911
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370137201"
     exon            1955..2102
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       1955
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370084969"
     variation       1956
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372630008"
     variation       1961
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1823035"
     variation       2078
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185026624"
     exon            2103..2256
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2176
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370992962"
     variation       2186
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142973944"
     exon            2257..2413
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2282
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367974123"
     variation       2330
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372104693"
     variation       2336
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375426388"
     variation       2348
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369858004"
     exon            2414..2510
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2444
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199725246"
     variation       2450
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372517333"
     variation       2453
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375703811"
     variation       2492
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11551374"
     exon            2511..2587
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     exon            2588..2696
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2633
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374669553"
     variation       2644
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367713994"
     variation       2645
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141399379"
     variation       2654
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147011006"
     variation       2662
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376060688"
     variation       2672
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116817896"
     exon            2697..2816
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2708
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375270131"
     variation       2743
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17850790"
     variation       2778
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139353471"
     variation       2779
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373467559"
     variation       2804
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:13354242"
     exon            2817..3016
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       2831
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377148423"
     variation       2832
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201559066"
     variation       2852
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369405267"
     variation       2854
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374132627"
     variation       2875
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377648376"
     variation       2879
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371132555"
     variation       2905
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:58005665"
     variation       2925
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11551375"
     variation       2927
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373107748"
     variation       2928
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377031549"
     exon            3017..3104
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3030
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371766099"
     variation       3051
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375088064"
     variation       3071
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7705781"
     variation       3090
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373799565"
     exon            3105..3248
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3140
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371615057"
     variation       3177
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9313557"
     variation       3206
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183570769"
     variation       3215
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186955009"
     exon            3249..3339
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3308
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373712469"
     exon            3340..3470
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3374
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372286637"
     variation       3386
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377070210"
     variation       3387
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377125065"
     variation       3437
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150652041"
     exon            3471..3543
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     STS             3482..3546
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /standard_name="STS-M62008"
                     /db_xref="UniSTS:55216"
     variation       3512
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372902849"
     exon            3544..3638
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3553
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368529367"
     variation       3569
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371277463"
     variation       3573
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374707103"
     variation       3584
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73307968"
     variation       3593
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372007539"
     variation       3626
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376770442"
     exon            3639..3877
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3656
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369693364"
     variation       3757
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200428535"
     variation       3760
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374666951"
     variation       3767
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114967929"
     variation       3782
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373142413"
     variation       3794
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199725841"
     variation       3813
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376484231"
     variation       3819
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199945789"
     variation       3822
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201475685"
     variation       3825
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369611074"
     variation       3843
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148677157"
     variation       3875
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377656882"
     exon            3878..4025
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       3890
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368047583"
     variation       3959
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200774279"
     exon            4026..6791
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /inference="alignment:Splign:1.39.8"
     variation       4076
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375350614"
     STS             4116..4399
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /standard_name="RH18378"
                     /db_xref="UniSTS:21434"
     variation       4123
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182717318"
     variation       4129
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370184404"
     variation       4146
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371399881"
     variation       4147
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201882855"
     variation       4157
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1803834"
     STS             4163..4293
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /standard_name="RH15890"
                     /db_xref="UniSTS:66388"
     variation       4184
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375865980"
     variation       4217
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150599988"
     variation       4239
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373854212"
     variation       4245
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199652534"
     variation       4252
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:13174378"
     variation       4342
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73307980"
     variation       4377
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188974329"
     variation       4401..4402
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:33954943"
     variation       4401
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:3052310"
     variation       4414..4417
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="aaaa"
                     /db_xref="dbSNP:77677846"
     variation       4454
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367860573"
     variation       4612
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73309941"
     variation       4620
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368328314"
     variation       4640
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62387481"
     variation       4688
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149305788"
     variation       4737..4738
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:201743820"
     variation       4738..4739
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="tggcttcccaaagccccattcta"
                     /db_xref="dbSNP:372558922"
     variation       4743
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:199925015"
     variation       4763
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147411422"
     variation       4785
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140777310"
     variation       4786
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:375776712"
     variation       4786
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144727795"
     variation       4851
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192134177"
     variation       4869
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147444680"
     STS             4894..5105
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /standard_name="A006W02"
                     /db_xref="UniSTS:11242"
     variation       5007
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:182865053"
     variation       5070
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6555991"
     variation       5142
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6555992"
     variation       5157
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367959403"
     variation       5313
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376881838"
     variation       5353
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148519938"
     variation       5402
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3734034"
     variation       5498
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6862302"
     variation       5510
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187411866"
     variation       5539
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1058517"
     variation       5589
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61736011"
     variation       5674
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142969781"
     variation       5807..5808
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="gc"
                     /replace="tt"
                     /db_xref="dbSNP:377513219"
     variation       5807
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6880851"
     variation       5808
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6882097"
     variation       5835
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76594372"
     variation       5839..5840
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:370196582"
     variation       5870
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141032109"
     variation       5929
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375360183"
     variation       5953
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184072551"
     variation       6083
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11545337"
     variation       6133
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:80098745"
     variation       6188
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113243312"
     variation       6274
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143764472"
     variation       6315
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146850512"
     variation       6334
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140263633"
     variation       6365
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:111840775"
     variation       6381
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3087968"
     variation       6415
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10073822"
     variation       6481
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115781943"
     variation       6639
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375053822"
     variation       6640
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186546184"
     variation       6666
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145397143"
     variation       6729
                     /gene="CYFIP2"
                     /gene_synonym="PIR121"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371519970"
ORIGIN      
ggacccgccgcagagccaggtaagcggccctcgcaggcctcgggccgggcacggggactaggatgccgccggggacggggatgaggccgtgaggatgcgcgaagggccgccccctctcccggcccgcggggggcgctcggcgctgtgcccgggctagcccgaggcccggcctcaggccccacgcggcccctttccccctcggacccaccgtgcgtcccgcggcacggaccctctgcccgggaggcgcgggcacatcgcggagctccggcgcggcggcgggggagccgcagcagcaggtgcgcggcctgggccggagccgccagcccgggaggaggcggtgctaatctcagggaccggagacacctgcagcggccgcgagcccggcagcggcgacatcctcgagtccagtgcagaatacagaaactgcagccatgaccacgcacgtcaccctggaagatgccctgtccaacgtggacctgcttgaagagcttcccctccccgaccagcagccatgcatcgagcctccaccttcctccatcatgtaccaggctaactttgacacaaactttgaggacaggaatgcatttgtcacgggcattgcaaggtacattgagcaggctacagtccactccagcatgaatgagatgctggaggaaggacatgagtatgcggtcatgctgtacacctggcgcagctgttcccgggccattccccaggtgaaatgcaacgagcagcccaaccgagtagagatctatgagaagacagtagaggtgctggagccggaggtcaccaagctcatgaagttcatgtattttcagcgcaaggccatcgagcggttctgcagcgaggtgaagcggctgtgccatgccgagcgcaggaaggactttgtctctgaggcctacctcctgacccttggcaagttcatcaacatgtttgctgtcctggatgagctaaagaacatgaagtgcagcgtcaagaatgaccactctgcctacaagagggcagcacagttcctgcggaagatggcagatccccagtctatccaggagtcgcagaacctttccatgttcctggccaaccacaacaggatcacccagtgtctccaccagcaacttgaagtgatcccaggctatgaggagctgctggctgacattgtcaacatctgtgtggattactacgagaacaagatgtacctgactcccagtgagaaacatatgctcctcaaggtgatgggctttggcctctacctaatggatggaaatgtcagtaacatttacaaactggatgccaagaagagaattaatcttagcaaaattgataaattctttaagcagctgcaggtggtgccccttttcggcgacatgcagatagagctggccagatacattaagaccagtgctcactatgaagagaacaagtccaagtggacgtgcacccagagcagcatcagcccccagtacaatatctgcgagcagatggttcagatccgggatgaccacatccgcttcatctccgagctcgctcgctacagcaacagtgaggtggtgacgggctcagggctggacagccagaagtcagacgaggagtatcgcgagctcttcgacctagccctgcggggtctgcagcttctatccaagtggagcgcccacgtcatggaggtgtactcttggaagctggttcatcccacagacaagttctgcaacaaggactgtcctggcaccgcggaggaatatgagagagccacacgctacaattacaccagtgaggaaaaatttgccttcgttgaggtgatcgccatgatcaaaggcctgcaggtgctcatgggcaggatggagagcgtcttcaaccaggccatcaggaacaccatctacgcggcattgcaggacttcgcccaggtgacgctgcgtgagcccctgcggcaggcggtacggaagaagaagaatgtcctcatcagcgtcctacaggcaattcgaaagaccatctgtgactgggagggagggcgagagccccctaatgacccatgcttgagaggggagaaggaccccaaaggtggatttgatatcaaggtgccccggcgtgctgtggggccatccagcacacagctgtacatggtgcggaccatgcttgaatcactcattgcagacaaaagcggctccaagaagaccctgaggagcagcctggatggacccattgtcctcgccatagaggactttcacaaacagtccttcttcttcacacatctgctcaacatcagtgaagccctgcagcagtgttgtgacctctcccagctctggttccgagaattcttcctggagttaaccatgggccgacgaatccagttccccatcgagatgtccatgccctggattctaacggaccatatcctggaaaccaaagaaccttccatgatggagtatgtcctctaccctctggatctgtacaacgacagcgcctactatgctctgaccaagtttaaaaagcagttcctgtacgatgagatagaagctgaggtgaacctgtgttttgatcagtttgtctacaagctggcagaccagatctttgcttactacaaagccatggctggcagtgtcctgttggataaacgttttcgagctgagtgtaagaattatggcgtcatcattccgtatccaccgtccaatcgctatgaaacactgctgaagcagagacacgtccagctgttgggtagatcaattgacttgaacagactcattacccagcgcatctctgccgccatgtataaatccttggaccaagctatcagccgctttgagagtgaggacctgacctccattgtggagctggagtggctgctggagattaaccggctcacgcatcggctgctctgtaagcatatgacgctggacagcttcgatgccatgttccgagaggccaatcacaatgtgtccgccccctatggccgtatcaccctgcatgtcttctgggaactgaactttgactttctccccaactactgctacaatgggtccactaaccgttttgtgcggactgccattcctttcacccaagaaccacaacgagacaaacctgccaacgtccagccttattacctctatggatccaagcctctcaacattgcctacagccacatctacagctcctacaggaatttcgtggggccacctcatttcaagactatctgcagactcctgggttatcagggcatcgctgtggtcatggaggaactgctaaagattgtgaagagcttgctccaaggaaccattctccagtatgtgaaaacactgatagaggtgatgcccaagatatgccgcttgccccgacatgagtatggctccccagggatcctggagttcttccaccaccagctgaaggacatcattgagtacgcagagctcaaaacagacgtgttccagagcctgagggaagtgggcaatgccatcctcttctgcctcctcatagagcaagctctgtctcaggaggaggtctgcgatttgctccatgccgcacccttccaaaacatcttgcctagagtctacatcaaagagggggagcgcctggaggtccggatgaaacgtctggaagccaagtatgccccgctccacctggtccctctgatcgagcggctggggacccctcagcaaatcgccattgctcgcgagggtgacctcctgaccaaggagcggctgtgctgtggcctgtccatgttcgaggtcatcctgacccgcattcggagctacctgcaggaccccatctggcggggcccaccgcccaccaatggcgtcatgcacgtcgatgagtgtgtggagttccaccggctgtggagcgccatgcagttcgtgtactgcatccctgtgggaaccaacgagttcacagctgagcagtgtttcggcgatggcttgaactgggctggttgctccatcattgtcctgctgggccagcagcgtcgctttgacctgttcgacttctgttaccacctgctaaaagtgcagaggcaggacgggaaggatgaaatcattaagaatgtgcccctgaagaagatggccgaccggatcaggaagtatcagatcttgaacaatgaggtttttgccatcctgaacaaatacatgaagtccgtggagacagacagttccactgtggagcatgtgcgctgcttccagccacccatccaccagtccttggccaccacttgctaagcagaagatcctgcagacccttatctggaggaggaagagaagcaggagagagaaagccacagccagcctgccataggatccaactggacaacgtgtgggatggacctggaaacaagcacctccccaaacacatcaccactccctagggcggggcctgtgcatgctctcccatgacatctccatgctggtttctccatagcataaatgaaaaaaaaaaaaaaaaagtaaacagggcagtgtgtgctttttcttttctcccccctcaactatattaagaactcctagtttcaccctttctccatcccatcatcccacctatctgtggttgcttcccaagacctcctcccaagatagacatctcctacccagtgcccttgtgtgaccccaggactcaagtctcagactgtgaacagatgtggccatgcccagagacgccagcctggccagaagggcatgcctcagcttactacttcatctctcctggttccctccctgcagtgccccgggtgtcatcttctcccactctgggtaccagggattctaccacataggcttcccaaagccccattctaactcccctctctcagggaagccctagagagaggtccaaaaagcattcacagctgtatcacactctatgcaggtggggtaggagactgatcaggcctgctgtggggaagcagtatgtatgaacacagccagaaatgtcatagtccaaacaggatgctttcaggccatctcagctgcttgatggtgagatggttcccttattccttcaggaaaggcttagcattgggccacataggggaagcagctttgaacaaatcagtcatagcactgcctatagcattagccagtgaccaaattagggacaacgtcttggcacagaattgcttatcaaggaacatttccacaagaaagaaaatattaaggggttatttccacagaagcccaaaacgtcttggaaacacagaggtgaggaggaggaatagtaattgtcaatgagcttttaataccaagatacaccccctgcccccaaagaagagtcctcttttagggaatcagaaccttcattgtcctagaagctgaaagattcttggaacattttagcttttactctcaacttgctgttctctttacattccttaagttagactttcgggtgtggcttctctcccaggggtaacatttacttccattttctagactgaaccaaaagtcttctgcagaatctcccaccgagtgtggtaagaaggaaggacaaaaggctttaggatataaatttcatgttacagagcatgtcattgtcaaaggaaatctgtggccctgagattttaagaacataaaatgtgacatttgatatttctccagcccagggaagtaagatggttagcaatggttgccttaatcaaatggtcccatttttaaccccaaaggaagtgcccacagcaagaggtttgtgtgatgcacttatgtcctccggtgaggaaagggggccacatatgaaaggccccttaggtcagatcctgagagtagcacatttgagtgcagattcctgggccccacctcaaacctactaattctgaatctctgggaatagggccaggaaatctgccctttctacaaactacccaagttgttctgttgcacatcaatgtttgggaaccactgctgtaagggaatcattctggtcaccttgagctttgagctaccactaagccatgaaagaaaatacatcatacagggaagagagaagggaggaggttccaagtagtaactggcagatcctcctgtctggaggtaccaccttctattctggtttctgacttttccttcttgatgaccatagatgtgttccagaggcaaaagagacacattatcccagatggcagaacatgctttcaaaacatataaaatgtcaaagttccagatccttctacatctttagtcctgtctgaggatggtagctggctctctgtagctgatagatggctagagttccatccaaatccttgaccacgacttcatggagatttgaataatctatttgatgagatttctatttcaataacccacctctctcaccccacattcatatccctaaatttgaccctctgggccgagtcacattaccttcaggagacttgatcccagtagactgaggtcttccctttcagcagaaagatttcatttccctggcttgccagtggcactgatttccgaacacccaatgagtttaatattctttcctccttggcattactgccccagcctctttttattttttttgtgtgtgtctaataaccaggaaaaaaataaagcttaggttttaaaaagttttaaaaataatctgtttcagaaactgtcaaatgtaccatatttgtattaagagttgttgggaatttttgtacaatgaatttacatttatttatggtgacatatttacgcttgtgatcaaataatgatgttaaattcttaaatcatatttgctatgcagctgaagatgatattttgatttgtattttgggggtacctgtgttgagttgataaacatttccatcttcattaaaactgcttccaaactagtaaaaccagcaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:26999 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:26999 -> Biological process: GO:0006915 [apoptotic process] evidence: IDA
            GeneID:26999 -> Biological process: GO:0016337 [cell-cell adhesion] evidence: IDA
            GeneID:26999 -> Biological process: GO:0038096 [Fc-gamma receptor signaling pathway involved in phagocytosis] evidence: TAS
            GeneID:26999 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
            GeneID:26999 -> Biological process: GO:0045862 [positive regulation of proteolysis] evidence: IDA
            GeneID:26999 -> Biological process: GO:0097202 [activation of cysteine-type endopeptidase activity] evidence: IDA
            GeneID:26999 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:26999 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:26999 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
            GeneID:26999 -> Cellular component: GO:0043005 [neuron projection] evidence: IEA
            GeneID:26999 -> Cellular component: GO:0045202 [synapse] evidence: IDA
            GeneID:26999 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.