Home |
Help |
Advanced search
2024-04-18 15:19:41, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001024957 1360 bp mRNA linear PRI 26-MAY-2013
DEFINITION Homo sapiens breast cancer metastasis suppressor 1 (BRMS1),
transcript variant 2, mRNA.
ACCESSION NM_001024957
VERSION NM_001024957.1 GI:68348701
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1360)
AUTHORS Liu,Y., Mayo,M.W., Nagji,A.S., Hall,E.H., Shock,L.S., Xiao,A.,
Stelow,E.B. and Jones,D.R.
TITLE BRMS1 suppresses lung cancer metastases through an E3 ligase
function on histone acetyltransferase p300
JOURNAL Cancer Res. 73 (4), 1308-1317 (2013)
PUBMED 23269275
REMARK GeneRIF: Data indicate that mutation of E3 ligase motif not only
abolishes BRMS1-induced p300 polyubiquitination and degradation,
but importantly, dramatically reduces the metastasis suppressor
function of BRMS1.
REFERENCE 2 (bases 1 to 1360)
AUTHORS Li,X., Wu,Y., Sun,Y., Huang,M., Ma,D., Xu,J., Guo,X., Jiang,X.,
Guan,C. and Li,F.
TITLE [The study of expression of BRMS1 gene protein and the expression
of BRMS1 gene promotor area methylation in supraglottic laryngeal
carcinoma and its clinical significance]
JOURNAL Lin Chung Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 26 (15), 701-703
(2012)
PUBMED 23167184
REMARK GeneRIF: The expression of BRMS1 protein in supraglottic cancer is
significantly decreased. BRMS1 gene promotor methylation is related
with down-expression of BRMS1 protein.
REFERENCE 3 (bases 1 to 1360)
AUTHORS Cui,R.X., Liu,N., He,Q.M., Li,W.F., Huang,B.J., Sun,Y., Tang,L.L.,
Chen,M., Jiang,N., Chen,L., Yun,J.P., Zeng,J., Guo,Y., Wang,H.Y.
and Ma,J.
TITLE Low BRMS1 expression promotes nasopharyngeal carcinoma metastasis
in vitro and in vivo and is associated with poor patient survival
JOURNAL BMC Cancer 12, 376 (2012)
PUBMED 22931099
REMARK GeneRIF: Data suggest that low expression of the metastasis
suppressor BRMS1 may be an independent prognostic factor for poor
prognosis in nasopharyngeal carcinoma (NPC) patients.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 1360)
AUTHORS Wu,Y., Jiang,W., Wang,Y., Wu,J., Saiyin,H., Qiao,X., Mei,X.,
Guo,B., Fang,X., Zhang,L., Lou,H., Wu,C. and Qiao,S.
TITLE Breast cancer metastasis suppressor 1 regulates hepatocellular
carcinoma cell apoptosis via suppressing osteopontin expression
JOURNAL PLoS ONE 7 (8), E42976 (2012)
PUBMED 22927944
REMARK GeneRIF: BRMS1 sensitizes HCC cells to apoptosis through
suppressing OPN expression
REFERENCE 5 (bases 1 to 1360)
AUTHORS Wang,Y., Zhao,Z., Chen,L., Cong,L. and Zhang,J.
TITLE [Expression of BRMS1 gene protein in nasal and paranasal sinus
carcinomas]
JOURNAL Lin Chung Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 25 (20), 920-921
(2011)
PUBMED 22239051
REMARK GeneRIF: The loss of BRMS1 expression may be involved in the
development and progression of nasal and paranasal sinus
carcinomas.
REFERENCE 6 (bases 1 to 1360)
AUTHORS Meehan,W.J. and Welch,D.R.
TITLE Breast cancer metastasis suppressor 1: update
JOURNAL Clin. Exp. Metastasis 20 (1), 45-50 (2003)
PUBMED 12650606
REMARK GeneRIF: BRMS1 has subsequently been shown to suppress metastasis,
but not tumorigenicity of human melanoma cells.
Review article
REFERENCE 7 (bases 1 to 1360)
AUTHORS Janneau,J.L., Maldonado-Estrada,J., Tachdjian,G., Miran,I.,
Motte,N., Saulnier,P., Sabourin,J.C., Cote,J.F., Simon,B.,
Frydman,R., Chaouat,G. and Bellet,D.
TITLE Transcriptional expression of genes involved in cell invasion and
migration by normal and tumoral trophoblast cells
JOURNAL J. Clin. Endocrinol. Metab. 87 (11), 5336-5339 (2002)
PUBMED 12414911
REFERENCE 8 (bases 1 to 1360)
AUTHORS Shevde,L.A., Samant,R.S., Goldberg,S.F., Sikaneta,T.,
Alessandrini,A., Donahue,H.J., Mauger,D.T. and Welch,D.R.
TITLE Suppression of human melanoma metastasis by the metastasis
suppressor gene, BRMS1
JOURNAL Exp. Cell Res. 273 (2), 229-239 (2002)
PUBMED 11822878
REMARK GeneRIF: BRMS1 functions as a metastasis suppressor in more than
one tumor type(i.e., breast carcinoma and cutaneous melanoma)by
modifying several metastasis-associated phenotypes.
REFERENCE 9 (bases 1 to 1360)
AUTHORS Samant,R.S., Debies,M.T., Shevde,L.A., Verderame,M.F. and
Welch,D.R.
TITLE Identification and characterization of the murine ortholog (brms1)
of breast-cancer metastasis suppressor 1 (BRMS1)
JOURNAL Int. J. Cancer 97 (1), 15-20 (2002)
PUBMED 11774238
REFERENCE 10 (bases 1 to 1360)
AUTHORS Seraj,M.J., Samant,R.S., Verderame,M.F. and Welch,D.R.
TITLE Functional evidence for a novel human breast carcinoma metastasis
suppressor, BRMS1, encoded at chromosome 11q13
JOURNAL Cancer Res. 60 (11), 2764-2769 (2000)
PUBMED 10850410
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from CB130346.1, AP001107.5,
CB529276.1 and BM312965.1.
Summary: This gene reduces the metastatic potential, but not the
tumorogenicity, of human breast cancer and melanoma cell lines. The
protein encoded by this gene localizes primarily to the nucleus and
is a component of the mSin3a family of histone deacetylase
complexes (HDAC). The protein contains two coiled-coil motifs and
several imperfect leucine zipper motifs. Alternative splicing
results in two transcript variants encoding different isoforms.
[provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) uses an alternate splice site
in the 3' terminal exon which results in the use of a downstream
stop codon, compared to variant 1. The encoded protein (isoform 2)
has a longer and distinct C-terminus, compared to isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BU158550.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025088, ERS025098 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-22 CB130346.1 7-28
23-140 AP001107.5 85228-85345 c
141-286 AP001107.5 82352-82497 c
287-377 AP001107.5 81789-81879 c
378-505 AP001107.5 81462-81589 c
506-585 AP001107.5 81223-81302 c
586-682 AP001107.5 81030-81126 c
683-775 AP001107.5 80377-80469 c
776-840 AP001107.5 78977-79041 c
841-880 AP001107.5 78499-78538 c
881-964 CB529276.1 403-486 c
965-1360 BM312965.1 1-396 c
FEATURES Location/Qualifiers
source 1..1360
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q13-q13.2"
gene 1..1360
/gene="BRMS1"
/note="breast cancer metastasis suppressor 1"
/db_xref="GeneID:25855"
/db_xref="HGNC:17262"
/db_xref="HPRD:05879"
/db_xref="MIM:606259"
exon 1..140
/gene="BRMS1"
/inference="alignment:Splign:1.39.8"
variation 9
/gene="BRMS1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1190624"
variation 73
/gene="BRMS1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11537992"
misc_feature 115..117
/gene="BRMS1"
/note="upstream in-frame stop codon"
exon 141..286
/gene="BRMS1"
/inference="alignment:Splign:1.39.8"
CDS 148..1020
/gene="BRMS1"
/note="isoform 2 is encoded by transcript variant 2;
breast cancer metastasis-suppressor 1"
/codon_start=1
/product="breast cancer metastasis-suppressor 1 isoform 2"
/protein_id="NP_001020128.1"
/db_xref="GI:68348702"
/db_xref="CCDS:CCDS44654.1"
/db_xref="GeneID:25855"
/db_xref="HGNC:17262"
/db_xref="HPRD:05879"
/db_xref="MIM:606259"
/translation="
MPVQPPSKDTEEMEAEGDSAAEMNGEEEESEEERSGSQTESEEESSEMDDEDYERRRSECVSEMLDLEKQFSELKEKLFRERLSQLRLRLEEVGAERAPEYTEPLGGLQRSLKIRIQVAGIYKGFCLDVIRNKYECELQGAKQHLESEKLLLYDTLQGELQERIQRLEEDRQSLDLSSEWWDDKLHARGSSRSWDSLPPSKRKKAPLVSGPYIVYMLQEIDILEDWTAIKKARAAVSPQKRKSDDRRTHRPLRVCPARLLWCCWALPLHLALAWTPPLPSSRPAQLWPWS
"
misc_feature 325..834
/gene="BRMS1"
/note="Sds3-like; Region: Sds3; pfam08598"
/db_xref="CDD:203995"
variation 261
/gene="BRMS1"
/replace="a"
/replace="g"
/db_xref="dbSNP:36129490"
exon 287..377
/gene="BRMS1"
/inference="alignment:Splign:1.39.8"
variation 348
/gene="BRMS1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11537993"
exon 378..505
/gene="BRMS1"
/inference="alignment:Splign:1.39.8"
exon 506..585
/gene="BRMS1"
/inference="alignment:Splign:1.39.8"
exon 586..682
/gene="BRMS1"
/inference="alignment:Splign:1.39.8"
exon 683..775
/gene="BRMS1"
/inference="alignment:Splign:1.39.8"
exon 776..840
/gene="BRMS1"
/inference="alignment:Splign:1.39.8"
exon 841..880
/gene="BRMS1"
/inference="alignment:Splign:1.39.8"
exon 881..1355
/gene="BRMS1"
/inference="alignment:Splign:1.39.8"
variation 965
/gene="BRMS1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1052566"
variation 1166
/gene="BRMS1"
/replace="a"
/replace="g"
/db_xref="dbSNP:3116068"
variation 1207
/gene="BRMS1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1052567"
variation 1253
/gene="BRMS1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1052568"
variation 1311
/gene="BRMS1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1052570"
polyA_signal 1331..1336
/gene="BRMS1"
polyA_site 1355
/gene="BRMS1"
ORIGIN
aagcaccgataggctctgcctcccgaagaaaagggagccgcgcagcgcctacgggagtccggcggcagcagccggtaccggcaaccacgggcagctctcagggaatctccgtcgtgaggccagaggctccagtccccgcgagtccagatgcctgtccagcctccaagcaaagacacagaagagatggaagcagagggtgattctgctgctgagatgaatggggaggaggaagagagtgaggaggagcggagcggcagccagacagagtcagaagaggagagctccgagatggatgatgaggactatgagcgacgccgcagcgagtgtgtcagtgagatgctggacctagagaagcagttctcggagctaaaggagaagttgttcagggaacgactgagtcagctgcggttgcggctggaggaagtgggggctgagagagcccctgaatacacggagccccttggggggctgcagcggagcctcaagattcgcattcaggtggcagggatctacaagggcttctgtctggatgtgatcaggaataagtacgaatgtgagctgcagggagccaaacagcacctggagagtgagaagctgctgctctatgacacgctgcagggggagctgcaggagcggatccagaggctggaggaggaccgccagagcctggacctcagctctgaatggtgggatgacaaactgcacgccagaggcagctccaggtcttgggactccctgccgcccagcaagaggaagaaggcacctctggtttctggcccatacatcgtgtacatgcttcaagagatcgacatcctggaggactggacagccatcaaaaaggctagggcagctgtgtcccctcagaagagaaaatcggatgacaggcggacccacaggcccctcagggtctgcccagccaggctcctgtggtgctgctgggccctcccactccatctggcactggcctggactcctcctctgccctcctcgaggcctgcacagctgtggccgtggagctgacctgaccaggcaaggctgctgtctccatccctgagccgcctgccacctcccactcctgaagatccatctcttggggctcccctgacagagaagacagccgaagtcaaagccacatcctcttgctgatgttggatgcaggctgtccggcctcagggccagggagccagtttccactgtgcgggaactctgagtcagacgtgattatctgggggtctgtccaccctggctggatctggaggcaagatgccaggccccccaggtgttctcagggcagttcttggtgtctgcttctcagattccaaggactggaattaaaacctttcctgggactctggaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:25855 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:25855 -> Molecular function: GO:0051059 [NF-kappaB binding] evidence: IDA
GeneID:25855 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:25855 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:25855 -> Biological process: GO:0032088 [negative regulation of NF-kappaB transcription factor activity] evidence: IDA
GeneID:25855 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IDA
GeneID:25855 -> Biological process: GO:0090312 [positive regulation of protein deacetylation] evidence: IDA
GeneID:25855 -> Biological process: GO:2000210 [positive regulation of anoikis] evidence: IMP
GeneID:25855 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:25855 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.