GGRNA Home | Help | Advanced search

2020-10-24 07:33:32, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001023570            2594 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens IQ motif containing B1 (IQCB1), transcript variant 1,
            mRNA.
ACCESSION   NM_001023570
VERSION     NM_001023570.2  GI:170014683
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2594)
  AUTHORS   Fahim,A.T., Bowne,S.J., Sullivan,L.S., Webb,K.D., Williams,J.T.,
            Wheaton,D.K., Birch,D.G. and Daiger,S.P.
  TITLE     Polymorphic variation of RPGRIP1L and IQCB1 as modifiers of
            X-linked retinitis pigmentosa caused by mutations in RPGR
  JOURNAL   Adv. Exp. Med. Biol. 723, 313-320 (2012)
   PUBMED   22183348
  REMARK    GeneRIF: Genetic variation may affect severity of disease for
            X-linked retinitis pigmentosa.
REFERENCE   2  (bases 1 to 2594)
  AUTHORS   Wang,X., Wang,H., Cao,M., Li,Z., Chen,X., Patenia,C., Gore,A.,
            Abboud,E.B., Al-Rajhi,A.A., Lewis,R.A., Lupski,J.R., Mardon,G.,
            Zhang,K., Muzny,D., Gibbs,R.A. and Chen,R.
  TITLE     Whole-exome sequencing identifies ALMS1, IQCB1, CNGA3, and MYO7A
            mutations in patients with Leber congenital amaurosis
  JOURNAL   Hum. Mutat. 32 (12), 1450-1459 (2011)
   PUBMED   21901789
  REMARK    GeneRIF: in a set of consanguineous patient families with Leber
            congenital amaurosis study identified five putative disease-causing
            mutations, including four novel alleles, in six families; These
            five mutations are located in four genes, ALMS1, IQCB1, CNGA3, and
            MYO7A
REFERENCE   3  (bases 1 to 2594)
  AUTHORS   Cideciyan,A.V., Rachel,R.A., Aleman,T.S., Swider,M., Schwartz,S.B.,
            Sumaroka,A., Roman,A.J., Stone,E.M., Jacobson,S.G. and Swaroop,A.
  TITLE     Cone photoreceptors are the main targets for gene therapy of NPHP5
            (IQCB1) or NPHP6 (CEP290) blindness: generation of an all-cone
            Nphp6 hypomorph mouse that mimics the human retinal ciliopathy
  JOURNAL   Hum. Mol. Genet. 20 (7), 1411-1423 (2011)
   PUBMED   21245082
  REMARK    GeneRIF: Cone photoreceptors are the main targets for gene therapy
            of NPHP5 (IQCB1) or NPHP6 (CEP290) blindness: generation of an
            all-cone Nphp6 hypomorph mouse that mimics the human retinal
            ciliopathy.
REFERENCE   4  (bases 1 to 2594)
  AUTHORS   Stone,E.M., Cideciyan,A.V., Aleman,T.S., Scheetz,T.E., Sumaroka,A.,
            Ehlinger,M.A., Schwartz,S.B., Fishman,G.A., Traboulsi,E.I.,
            Lam,B.L., Fulton,A.B., Mullins,R.F., Sheffield,V.C. and
            Jacobson,S.G.
  TITLE     Variations in NPHP5 in patients with nonsyndromic leber congenital
            amaurosis and Senior-Loken syndrome
  JOURNAL   Arch. Ophthalmol. 129 (1), 81-87 (2011)
   PUBMED   21220633
  REMARK    GeneRIF: Mutations in NPHP5 can cause Leber congenital amaurosis
            (LCA)without early-onset renal disease.
REFERENCE   5  (bases 1 to 2594)
  AUTHORS   Fahim,A.T., Bowne,S.J., Sullivan,L.S., Webb,K.D., Williams,J.T.,
            Wheaton,D.K., Birch,D.G. and Daiger,S.P.
  TITLE     Allelic heterogeneity and genetic modifier loci contribute to
            clinical variation in males with X-linked retinitis pigmentosa due
            to RPGR mutations
  JOURNAL   PLoS ONE 6 (8), E23021 (2011)
   PUBMED   21857984
  REMARK    GeneRIF: Data show that the minor allele (N) of I393N in IQCB1 and
            the common allele (R) of R744Q in RPGRIP1L were associated with
            severe disease in XlRP with RPGR mutations.
REFERENCE   6  (bases 1 to 2594)
  AUTHORS   Luo,X., He,Q., Huang,Y. and Sheikh,M.S.
  TITLE     Cloning and characterization of a p53 and DNA damage down-regulated
            gene PIQ that codes for a novel calmodulin-binding IQ motif protein
            and is up-regulated in gastrointestinal cancers
  JOURNAL   Cancer Res. 65 (23), 10725-10733 (2005)
   PUBMED   16322217
REFERENCE   7  (bases 1 to 2594)
  AUTHORS   le Maire,A., Weber,T., Saunier,S., Broutin,I., Antignac,C.,
            Ducruix,A. and Dardel,F.
  TITLE     Solution NMR structure of the SH3 domain of human nephrocystin and
            analysis of a mutation-causing juvenile nephronophthisis
  JOURNAL   Proteins 59 (2), 347-355 (2005)
   PUBMED   15723349
REFERENCE   8  (bases 1 to 2594)
  AUTHORS   Mollet,G., Silbermann,F., Delous,M., Salomon,R., Antignac,C. and
            Saunier,S.
  TITLE     Characterization of the nephrocystin/nephrocystin-4 complex and
            subcellular localization of nephrocystin-4 to primary cilia and
            centrosomes
  JOURNAL   Hum. Mol. Genet. 14 (5), 645-656 (2005)
   PUBMED   15661758
REFERENCE   9  (bases 1 to 2594)
  AUTHORS   Otto,E.A., Loeys,B., Khanna,H., Hellemans,J., Sudbrak,R., Fan,S.,
            Muerb,U., O'Toole,J.F., Helou,J., Attanasio,M., Utsch,B.,
            Sayer,J.A., Lillo,C., Jimeno,D., Coucke,P., De Paepe,A.,
            Reinhardt,R., Klages,S., Tsuda,M., Kawakami,I., Kusakabe,T.,
            Omran,H., Imm,A., Tippens,M., Raymond,P.A., Hill,J., Beales,P.,
            He,S., Kispert,A., Margolis,B., Williams,D.S., Swaroop,A. and
            Hildebrandt,F.
  TITLE     Nephrocystin-5, a ciliary IQ domain protein, is mutated in
            Senior-Loken syndrome and interacts with RPGR and calmodulin
  JOURNAL   Nat. Genet. 37 (3), 282-288 (2005)
   PUBMED   15723066
  REMARK    GeneRIF: nephrocystin-5, RPGR and calmodulin can be
            coimmunoprecipitated from retinal extracts, and that these proteins
            localize to connecting cilia of photoreceptors and to primary cilia
            of renal epithelial cells
REFERENCE   10 (bases 1 to 2594)
  AUTHORS   Mollet,G., Salomon,R., Gribouval,O., Silbermann,F., Bacq,D.,
            Landthaler,G., Milford,D., Nayir,A., Rizzoni,G., Antignac,C. and
            Saunier,S.
  TITLE     The gene mutated in juvenile nephronophthisis type 4 encodes a
            novel protein that interacts with nephrocystin
  JOURNAL   Nat. Genet. 32 (2), 300-305 (2002)
   PUBMED   12244321
  REMARK    Erratum:[Nat Genet 2002 Nov;32(3):459]
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AY714228.1, AY964668.1,
            BX393165.2 and D25278.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Mar 15, 2008 this sequence version replaced gi:66571306.
            
            Summary: This gene encodes a nephrocystin protein that interacts
            with calmodulin and the retinitis pigmentosa GTPase regulator
            protein. The encoded protein has a central coiled-coil region and
            two calmodulin-binding IQ domains. It is localized to the primary
            cilia of renal epithelial cells and connecting cilia of
            photoreceptor cells. The protein is thought to play a role in
            ciliary function. Defects in this gene result in Senior-Loken
            syndrome type 5. Alternative splicing results in multiple
            transcript variants. [provided by RefSeq, Nov 2009].
            
            Transcript Variant: This variant (1) encodes the longer isoform
            (a).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: D25278.1, AY714228.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-68                AY714228.1         1-68
            69-203              AY964668.1         8-142
            204-788             AY714228.1         198-782
            789-2012            AY964668.1         727-1950
            2013-2208           AY714228.1         2007-2202
            2209-2555           BX393165.2         39-385              c
            2556-2594           D25278.1           2497-2535
FEATURES             Location/Qualifiers
     source          1..2594
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3q13.33"
     gene            1..2594
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /note="IQ motif containing B1"
                     /db_xref="GeneID:9657"
                     /db_xref="HGNC:28949"
                     /db_xref="MIM:609237"
     exon            1..114
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    111..113
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /note="upstream in-frame stop codon"
     exon            115..203
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     exon            204..315
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     CDS             216..2012
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /note="isoform a is encoded by transcript variant 1; IQ
                     calmodulin-binding motif containing 1; p53 and DNA
                     damage-regulated IQ motif protein; IQ calmodulin-binding
                     motif-containing protein 1; nephrocystin 5"
                     /codon_start=1
                     /product="IQ calmodulin-binding motif-containing protein 1
                     isoform a"
                     /protein_id="NP_001018864.2"
                     /db_xref="GI:170014684"
                     /db_xref="CCDS:CCDS33837.1"
                     /db_xref="GeneID:9657"
                     /db_xref="HGNC:28949"
                     /db_xref="MIM:609237"
                     /translation="
MKPTGTDPRILSIAAEVAKSPEQNVPVILLKLKEIINITPLGSSELKKIKQDIYCYDLIQYCLLVLSQDYSRIQGGWTTISQLTQILSHCCVGLEPGEDAEEFYNELLPSAAENFLVLGRQLQTCFINAAKAEEKDELLHFFQIVTDSLFWLLGGHVELIQNVLQSDHFLHLLQADNVQIGSAVMMMLQNILQINSGDLLRIGRKALYSILDEVIFKLFSTPSPVIRSTATKLLLLMAESHQEILILLRQSTCYKGLRRLLSKQETGTEFSQELRQLVGLLSPMVYQEVEEQKLHQAACLIQAYWKGFQTRKRLKKLPSAVIALQRSFRSKRSKMLLEINRQKEEEDLKLQLQLQRQRAMRLSRELQLSMLEIVHPGQVEKHYREMEEKSALIIQKHWRGYRERKNFHQQRQSLIEYKAAVTLQRAALKFLAKCRKKKKLFAPWRGLQELTDARRVELKKRVDDYVRRHLGSPMSDVVSRELHAQAQERLQHYFMGRALEERAQQHREALIAQISTNVEQLMKAPSLKEAEGKEPELFLSRSRPVAAKAKQAHLTTLKHIQAPWWKKLGEESGDEIDVPKDELSIELENLFIGGTKPP
"
     misc_feature    1374..1439
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /note="IQ calmodulin-binding motif; Region: IQ; cl15479"
                     /db_xref="CDD:210118"
     misc_feature    1929..1931
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q15051.1); phosphorylation site"
     exon            316..478
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     exon            479..608
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     exon            609..702
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     exon            703..802
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     exon            803..981
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     exon            982..1091
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     exon            1092..1201
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     exon            1202..1344
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     exon            1345..1493
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     variation       1393
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1141528"
     exon            1494..1625
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     STS             1505..1659
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /standard_name="RH25274"
                     /db_xref="UniSTS:32769"
     exon            1626..1782
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     STS             1634..1899
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /standard_name="D6S2310"
                     /db_xref="UniSTS:6299"
     exon            1783..2594
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /inference="alignment:Splign:1.39.8"
     STS             1817..2455
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /standard_name="IQCB1_8973"
                     /db_xref="UniSTS:468484"
     STS             2053..2155
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /standard_name="WI-9285"
                     /db_xref="UniSTS:12591"
     variation       2209
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1135750"
     polyA_signal    2574..2579
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
     polyA_site      2594
                     /gene="IQCB1"
                     /gene_synonym="NPHP5; PIQ; SLSN5"
ORIGIN      
cgcctccaggccccttcccgcgtcgcgacgcacgctgccccggaaggccgcggcgctgtagtgcggcgtgggagccccaggttctttagtggaagaacgcgaagcgaggatgagtgatccgtggaggcagtaacaggcgcggcgagggagaagtgattcccgaagaatcaaggctgggccggacccggtggcctggcaacagggtaataagagaaatgaagccaacaggtacagacccaaggatcttatctatagctgctgaagttgcaaaaagccctgagcagaatgtccctgttatactgttgaagttaaaagaaataataaacatcacacctttaggaagctcagagttgaagaaaatcaaacaagatatatattgttatgatctcattcaatattgcctcttggtcctcagtcaagattattctcgaatccagggtggttggactacaatttcccagcttacacagatattaagccattgctgtgtgggcttggagccaggagaagatgcagaggaattttacaatgaattacttccatcagctgcagaaaattttctagttttggggagacaattacaaacatgttttatcaatgcagctaaggctgaagaaaaagatgaattactacactttttccaaattgtgactgattctctcttctggcttttgggaggccatgttgaacttattcagaatgtactacaaagtgatcatttcttacatttactgcaagctgacaatgtccaaataggatctgcagtcatgatgatgctacagaatatactacagatcaacagtggtgatttactcagaataggaagaaaagccctgtattcaattttagatgaagttattttcaagcttttttcaactcctagtccagttataagaagtactgctacaaaactcctactgttgatggctgaatcccatcaggaaattttgattttactgagacaaagtacctgctacaaaggactcagacgtctactaagtaaacaggaaactgggactgaattcagtcaagaacttagacagcttgttggccttttaagcccaatggtctatcaggaagtagaagagcagaaactacatcaagcagcatgcttgattcaagcctattggaagggttttcagacaagaaagagattaaagaagcttccatctgctgtgattgctttgcagaggagtttcagatccaaacgatcaaagatgttgctggagataaataggcagaaggaagaagaggacctcaaattacaattgcaacttcaaagacagagagccatgagactttcccgagaattgcagctgagtatgctcgaaatagttcatccaggtcaggtggagaaacactatcgggaaatggaagagaaatcagcactgattatccagaaacattggagagggtacagggaaaggaaaaattttcaccaacagaggcagtctctcatagagtataaagcagctgtcacacttcaaagagcagcgcttaaattcctagcgaagtgccgtaagaaaaagaaactatttgctccttggcgaggactccaagaactcactgatgcacgccgagttgaactgaagaaacgagtggatgactatgtcagaagacatttgggctctccaatgtcagatgtggtcagtagggagctccatgcccaagctcaagaacgactgcaacactactttatgggcagggccctagaagagcgagcccagcagcacagagaagctctgatagcacagatcagcaccaacgttgaacagctaatgaaggcaccaagtctgaaggaggcagaagggaaagaacctgagctcttcctaagtagatccaggcctgtggcagccaaggccaagcaggcccatctcacaaccctgaagcacatacaagcaccctggtggaagaagcttggagaagaatctggagatgagattgatgttccaaaggatgagcttagtatagaattagaaaatttattcattggtggaaccaaaccaccttagtgagtaaccctaagaattgacacaaatctcatattttaggagattatattggttctgcctctggcatgctggtagactagggccatcctaacttattattttccagaggttctcctccagacaagacctgcagtaagcaaagagttatattctacctctctctcaattttctttttcttttctctgtatcctcatcgttagccacacacagatttgtgtggcttttattgtagaactaaacttagcatagtgttctgttgtttacatgaagtgtgtttttctttggtttcttctgttttccaactaaatatttttttctaaataaatattttcaacaattgatttgaaaaatttgtcaggattatttcaacttttcacatttgttatctgaaattcctatttcctgttaacataggaggtgtgtgcagactttattaatgtgaggaaaagaaatgctcaattgaaggacatttccctgttttctataaagcaatggttgaactcattttctattttgttatttctaaaaggaactgcataccaaaaaaatgcattctttctattaaactgtgagaactacat
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9657 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:9657 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IDA
            GeneID:9657 -> Biological process: GO:0042384 [cilium assembly] evidence: ISS
            GeneID:9657 -> Biological process: GO:0045494 [photoreceptor cell maintenance] evidence: IMP
            GeneID:9657 -> Biological process: GO:0048496 [maintenance of organ identity] evidence: IMP
            GeneID:9657 -> Cellular component: GO:0001750 [photoreceptor outer segment] evidence: IEA
            GeneID:9657 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:9657 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
            GeneID:9657 -> Cellular component: GO:0032391 [photoreceptor connecting cilium] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.