2024-03-29 01:53:32, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001014832 2765 bp mRNA linear PRI 02-JUN-2013 DEFINITION Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 4 (PAK4), transcript variant 3, mRNA. ACCESSION NM_001014832 VERSION NM_001014832.1 GI:62422556 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2765) AUTHORS Kim,S.H., Kim,S.R., Ihm,H.J., Oh,Y.S., Chae,H.D., Kim,C.H. and Kang,B.M. TITLE Regulation of P21-activated kinase-4 by progesterone and tumor necrosis factor-alpha in human endometrium and its increased expression in advanced-stage endometriosis JOURNAL J. Clin. Endocrinol. Metab. 98 (2), E238-E248 (2013) PUBMED 23293332 REMARK GeneRIF: increased expression of Pak4 might lead to the establishment and progression of endometriosis by enhanced cellular viability and invasiveness in endometrial cells. REFERENCE 2 (bases 1 to 2765) AUTHORS Wang,Z., Zhang,X., Yang,Z., Du,H., Wu,Z., Gong,J., Yan,J. and Zheng,Q. TITLE MiR-145 regulates PAK4 via the MAPK pathway and exhibits an antitumor effect in human colon cells JOURNAL Biochem. Biophys. Res. Commun. 427 (3), 444-449 (2012) PUBMED 22766504 REMARK GeneRIF: these findings demonstrate that miR-145 downregulates P-ERK expression by targeting PAK4 and leads to inhibition of tumor growth. REFERENCE 3 (bases 1 to 2765) AUTHORS Ha,B.H., Davis,M.J., Chen,C., Lou,H.J., Gao,J., Zhang,R., Krauthammer,M., Halaban,R., Schlessinger,J., Turk,B.E. and Boggon,T.J. TITLE Type II p21-activated kinases (PAKs) are regulated by an autoinhibitory pseudosubstrate JOURNAL Proc. Natl. Acad. Sci. U.S.A. 109 (40), 16107-16112 (2012) PUBMED 22988085 REMARK GeneRIF: Full-length PAK4 is constitutively autoinibited, but mutation of the pseudosubstrate releases this inhibition. REFERENCE 4 (bases 1 to 2765) AUTHORS Baskaran,Y., Ng,Y.W., Selamat,W., Ling,F.T. and Manser,E. TITLE Group I and II mammalian PAKs have different modes of activation by Cdc42 JOURNAL EMBO Rep. 13 (7), 653-659 (2012) PUBMED 22653441 REMARK GeneRIF: PAK4 is strongly inhibited by an auto-inhibitory domain formed by amino acids 20 to 68. Publication Status: Online-Only REFERENCE 5 (bases 1 to 2765) AUTHORS Kesanakurti,D., Chetty,C., Rajasekhar Maddirela,D., Gujrati,M. and Rao,J.S. TITLE Functional cooperativity by direct interaction between PAK4 and MMP-2 in the regulation of anoikis resistance, migration and invasion in glioma JOURNAL Cell Death Dis 3, E445 (2012) PUBMED 23254288 REMARK GeneRIF: Interaction between PAK4 and MMP-2 regulated anoikis, cell migration and invasion in glioma. Publication Status: Online-Only REFERENCE 6 (bases 1 to 2765) AUTHORS Lu,Y., Pan,Z.Z., Devaux,Y. and Ray,P. TITLE p21-activated protein kinase 4 (PAK4) interacts with the keratinocyte growth factor receptor and participates in keratinocyte growth factor-mediated inhibition of oxidant-induced cell death JOURNAL J. Biol. Chem. 278 (12), 10374-10380 (2003) PUBMED 12529371 REMARK GeneRIF: PAK4 interacts with KGF receptor and mediate anti-apoptosis effects of KGF on epithelial cells. REFERENCE 7 (bases 1 to 2765) AUTHORS Zhang,H., Li,Z., Viklund,E.K. and Stromblad,S. TITLE P21-activated kinase 4 interacts with integrin alpha v beta 5 and regulates alpha v beta 5-mediated cell migration JOURNAL J. Cell Biol. 158 (7), 1287-1297 (2002) PUBMED 12356872 REFERENCE 8 (bases 1 to 2765) AUTHORS Dan,C., Kelly,A., Bernard,O. and Minden,A. TITLE Cytoskeletal changes regulated by the PAK4 serine/threonine kinase are mediated by LIM kinase 1 and cofilin JOURNAL J. Biol. Chem. 276 (34), 32115-32121 (2001) PUBMED 11413130 REFERENCE 9 (bases 1 to 2765) AUTHORS Bagrodia,S. and Cerione,R.A. TITLE Pak to the future JOURNAL Trends Cell Biol. 9 (9), 350-355 (1999) PUBMED 10461188 REMARK Review article REFERENCE 10 (bases 1 to 2765) AUTHORS Abo,A., Qu,J., Cammarano,M.S., Dan,C., Fritsch,A., Baud,V., Belisle,B. and Minden,A. TITLE PAK4, a novel effector for Cdc42Hs, is implicated in the reorganization of the actin cytoskeleton and in the formation of filopodia JOURNAL EMBO J. 17 (22), 6527-6540 (1998) PUBMED 9822598 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BG773480.1, BC025282.1, BC011368.1 and AB032968.1. Summary: PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (3) lacks an exon in the 5' UTR, and encodes the same isoform (1), as compared to variant 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC011368.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025082 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-34 BG773480.1 26-59 35-102 BC025282.1 1-68 103-2219 BC011368.1 81-2197 2220-2765 AB032968.1 1780-2325 FEATURES Location/Qualifiers source 1..2765 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="19" /map="19q13.2" gene 1..2765 /gene="PAK4" /note="p21 protein (Cdc42/Rac)-activated kinase 4" /db_xref="GeneID:10298" /db_xref="HGNC:16059" /db_xref="MIM:605451" exon 1..140 /gene="PAK4" /inference="alignment:Splign:1.39.8" variation 56 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:71356837" variation 74 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:4803205" variation 102 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:4803206" variation 116 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:111999288" exon 141..366 /gene="PAK4" /inference="alignment:Splign:1.39.8" variation 143 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:376621337" variation 144 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:370008929" variation 148 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:690929" variation 149 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:201511246" variation 151 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:149068416" variation 156 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:373760840" variation 157 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:376606539" CDS 163..1938 /gene="PAK4" /EC_number="2.7.11.1" /note="isoform 1 is encoded by transcript variant 3; protein kinase related to S. cerevisiae STE20, effector for Cdc42Hs; p21(CDKN1A)-activated kinase 4; serine/threonine-protein kinase PAK 4; PAK-4; p21-activated kinase 4" /codon_start=1 /product="serine/threonine-protein kinase PAK 4 isoform 1" /protein_id="NP_001014832.1" /db_xref="GI:62422557" /db_xref="CCDS:CCDS12528.1" /db_xref="GeneID:10298" /db_xref="HGNC:16059" /db_xref="MIM:605451" /translation="
MFGKRKKRVEISAPSNFEHRVHTGFDQHEQKFTGLPRQWQSLIEESARRPKPLVDPACITSIQPGAPKTIVRGSKGAKDGALTLLLDEFENMSVTRSNSLRRDSPPPPARARQENGMPEEPATTARGGPGKAGSRGRFAGHSEAGGGSGDRRRAGPEKRPKSSREGSGGPQESSRDKRPLSGPDVGTPQPAGLASGAKLAAGRPFNTYPRADTDHPSRGAQGEPHDVAPNGPSAGGLAIPQSSSSSSRPPTRARGAPSPGVLGPHASEPQLAPPACTPAAPAVPGPPGPRSPQREPQRVSHEQFRAALQLVVDPGDPRSYLDNFIKIGEGSTGIVCIATVRSSGKLVAVKKMDLRKQQRRELLFNEVVIMRDYQHENVVEMYNSYLVGDELWVVMEFLEGGALTDIVTHTRMNEEQIAAVCLAVLQALSVLHAQGVIHRDIKSDSILLTHDGRVKLSDFGFCAQVSKEVPRRKSLVGTPYWMAPELISRLPYGPEVDIWSLGIMVIEMVDGEPPYFNEPPLKAMKMIRDNLPPRLKNLHKVSPSLKGFLDRLLVRDPAQRATAAELLKHPFLAKAGPPASIVPLMRQNRTR
" misc_feature 190..306 /gene="PAK4" /note="PAK (p21 activated kinase) Binding Domain (PBD), binds Cdc42p- and/or Rho-like small GTPases; also known as the Cdc42/Rac interactive binding (CRIB) motif; has been shown to inhibit transcriptional activation and cell transformation mediated by the...; Region: CRIB_PAK_like; cd01093" /db_xref="CDD:29038" misc_feature order(193..195,202..204,211..213,217..219,226..228, 277..279,289..291) /gene="PAK4" /note="GTPase interaction site [polypeptide binding]; other site" /db_xref="CDD:29038" misc_feature 235..1122 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O96013.1); Region: Linker" misc_feature 283..285 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (O96013.1); phosphorylation site" misc_feature 457..459 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05675" misc_feature 472..474 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (O96013.1); phosphorylation site" misc_feature 472..474 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05675" misc_feature 604..606 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (O96013.1); phosphorylation site" misc_feature 604..606 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05675" misc_feature 661..663 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (O96013.1); phosphorylation site" misc_feature 661..663 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05675" misc_feature 703..705 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (O96013.1); phosphorylation site" misc_feature 703..705 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 703..705 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05675" misc_feature 721..723 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (O96013.1); phosphorylation site" misc_feature 745..747 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (O96013.1); phosphorylation site" misc_feature 781..783 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05675" misc_feature 934..936 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (O96013.1); phosphorylation site" misc_feature 934..936 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05675" misc_feature 961..963 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (O96013.1); phosphorylation site" misc_feature 1033..1035 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (O96013.1); phosphorylation site" misc_feature 1033..1035 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05675" misc_feature 1054..1131 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O96013.1); Region: GEF-interaction domain (GID)" misc_feature 1063..1917 /gene="PAK4" /note="Catalytic domain of the Protein Serine/Threonine Kinase, Group II p21-activated kinase; Region: STKc_PAK_II; cd06648" /db_xref="CDD:132979" misc_feature 1138..1878 /gene="PAK4" /note="Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220" /db_xref="CDD:197582" misc_feature order(1141..1155,1165..1167,1204..1206,1210..1212, 1237..1239,1297..1299,1345..1359,1363..1368,1375..1377, 1480..1482,1486..1497,1501..1503,1531..1536,1543..1545, 1582..1596,1600..1602,1681..1683,1708..1716) /gene="PAK4" /note="active site" /db_xref="CDD:132979" misc_feature order(1141..1155,1165..1167,1204..1206,1210..1212, 1297..1299,1345..1359,1363..1368,1375..1377,1492..1497, 1501..1503,1531..1536) /gene="PAK4" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:132979" misc_feature order(1150..1155,1237..1239,1480..1482,1486..1494, 1543..1545,1582..1596,1600..1602,1681..1683,1708..1716) /gene="PAK4" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:132979" misc_feature 1531..1602 /gene="PAK4" /note="activation loop (A-loop); other site" /db_xref="CDD:132979" misc_feature 1582..1584 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by autocatalysis; propagated from UniProtKB/Swiss-Prot (O96013.1); phosphorylation site" misc_feature 1582..1584 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1594..1596 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05675" variation 198 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:370966374" variation 200 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:146498509" variation 204 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:141017388" variation 207 /gene="PAK4" /replace="a" /replace="c" /db_xref="dbSNP:200199299" variation 209 /gene="PAK4" /replace="" /replace="a" /db_xref="dbSNP:66579155" variation 210 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:199730416" variation 222 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:114564484" variation 223 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:146583353" variation 231 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:199597836" variation 237 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:113813881" variation 246 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:75096376" variation 291 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:373656030" variation 292 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:200500244" variation 321 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:377525201" variation 322 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:148292608" variation 326 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:112229040" variation 336 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:200638581" variation 354 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:141602417" variation 357 /gene="PAK4" /replace="g" /replace="t" /db_xref="dbSNP:371051871" variation 358 /gene="PAK4" /replace="g" /replace="t" /db_xref="dbSNP:373324891" variation 359 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:376845802" exon 367..825 /gene="PAK4" /inference="alignment:Splign:1.39.8" variation 375 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:368355444" variation 377 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:372186735" variation 411 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:202071466" variation 471 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:144141109" variation 477 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:376964135" variation 480 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:375296515" variation 485 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:114116556" variation 486 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:55711468" variation 487 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:200319983" variation 495 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:376684961" variation 524 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:374813703" variation 525 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:185941563" variation 534 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:115339655" variation 566 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:56099436" variation 571 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:200644444" variation 577 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:35655056" variation 579 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:369143802" variation 594 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:1045562" variation 601 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:199622580" variation 624 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:369129733" variation 695 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:373168150" variation 706 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:376102097" variation 723 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:371641844" variation 753 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:377431095" variation 769 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:370979504" variation 789 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:375542750" variation 817 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:200780929" exon 826..1260 /gene="PAK4" /inference="alignment:Splign:1.39.8" variation 826 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:370852872" variation 830 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:371684690" variation 831 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:138516359" variation 832 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:375872670" variation 841 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:200391013" variation 869 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:368557621" variation 874 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:371973365" variation 905 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:199929260" variation 930 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:375137743" variation 936 /gene="PAK4" /replace="" /replace="c" /db_xref="dbSNP:35120836" variation 982 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:200534045" variation 997 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:369318453" variation 999 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:190702581" variation 1030 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:375957288" STS 1056..1352 /gene="PAK4" /standard_name="MARC_20651-20652:1024691026:1" /db_xref="UniSTS:268460" variation 1101 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:369018322" variation 1108 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:143998317" variation 1110 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:201587224" variation 1115 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:147291859" variation 1143 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:374237195" variation 1146 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:371904272" variation 1176 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:370908993" variation 1180 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:140420249" variation 1190 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:149267288" variation 1191 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:144457438" variation 1206 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:148400225" exon 1261..1394 /gene="PAK4" /inference="alignment:Splign:1.39.8" variation 1288 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:375220515" variation 1311 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:146831773" variation 1316 /gene="PAK4" /replace="a" /replace="c" /db_xref="dbSNP:142488595" variation 1329 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:368459616" variation 1371 /gene="PAK4" /replace="a" /replace="c" /db_xref="dbSNP:56306494" variation 1377 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:11559035" variation 1379 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:146517848" variation 1380 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:372653621" exon 1395..1521 /gene="PAK4" /inference="alignment:Splign:1.39.8" variation 1401 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:376504839" variation 1419 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:139956496" variation 1420 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:370017586" variation 1440 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:374443098" variation 1448 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:377696830" variation 1449 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:116665223" variation 1458 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:371674508" variation 1477 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:375117492" variation 1485 /gene="PAK4" /replace="a" /replace="c" /db_xref="dbSNP:146720735" variation 1488 /gene="PAK4" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:11559036" variation 1491 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:141004307" exon 1522..1647 /gene="PAK4" /inference="alignment:Splign:1.39.8" variation 1528 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:11559033" variation 1574 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:373414547" variation 1584 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:56286946" variation 1585 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:11559034" variation 1590 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:201757969" variation 1623 /gene="PAK4" /replace="a" /replace="c" /db_xref="dbSNP:200775475" variation 1628 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:147024501" variation 1633 /gene="PAK4" /replace="" /replace="c" /db_xref="dbSNP:34054211" variation 1635 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:138564503" variation 1638 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:144059751" exon 1648..1782 /gene="PAK4" /inference="alignment:Splign:1.39.8" variation 1662 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:151137853" variation 1666 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:193920877" variation 1693 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:141267072" variation 1703 /gene="PAK4" /replace="a" /replace="c" /db_xref="dbSNP:368539931" variation 1704 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:146955542" variation 1713 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:375810830" variation 1714 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:372098486" variation 1734 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:111768373" variation 1740 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:11559037" variation 1764 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:201791285" exon 1783..2765 /gene="PAK4" /inference="alignment:Splign:1.39.8" variation 1814 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:200026990" variation 1824 /gene="PAK4" /replace="g" /replace="t" /db_xref="dbSNP:34569811" variation 1825 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:56084716" variation 1848 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:55747949" variation 1855 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:150747591" variation 1879 /gene="PAK4" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:149210444" variation 1946 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:371711789" variation 1974 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:376520116" variation 2034 /gene="PAK4" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:113335516" variation 2047 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:186511166" variation 2110 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:377438234" variation 2111 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:143251867" variation 2191 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:3752161" variation 2219 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:79890280" variation 2220 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:45573536" variation 2234 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:374106536" variation 2319..2320 /gene="PAK4" /replace="" /replace="tg" /db_xref="dbSNP:3833875" variation 2320..2321 /gene="PAK4" /replace="" /replace="tg" /db_xref="dbSNP:373786885" variation 2321..2322 /gene="PAK4" /replace="" /replace="gt" /db_xref="dbSNP:142481159" variation 2332..2333 /gene="PAK4" /replace="" /replace="tg" /db_xref="dbSNP:67439622" variation 2361 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:13228" variation 2384 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:114113304" variation 2412..2413 /gene="PAK4" /replace="" /replace="c" /db_xref="dbSNP:34766623" variation 2457 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:11559032" variation 2475..2476 /gene="PAK4" /replace="" /replace="tt" /db_xref="dbSNP:377017717" variation 2507 /gene="PAK4" /replace="a" /replace="c" /db_xref="dbSNP:114754037" variation 2568 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:11559031" STS 2610..2736 /gene="PAK4" /standard_name="RH12716" /db_xref="UniSTS:3224" variation 2699 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:73933820" variation 2706 /gene="PAK4" /replace="c" /replace="g" /db_xref="dbSNP:11122" variation 2710 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:45472902" variation 2727 /gene="PAK4" /replace="c" /replace="t" /db_xref="dbSNP:370782442" polyA_signal 2742..2747 /gene="PAK4" variation 2750 /gene="PAK4" /replace="a" /replace="g" /db_xref="dbSNP:181552710" polyA_site 2759 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" polyA_site 2761 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" polyA_site 2765 /gene="PAK4" /experiment="experimental evidence, no additional details recorded" ORIGIN
agccccggatgttcgttggggattcaacatggcggcgggagtgtccgcggtggtggcggtgcaagagagctgagggaggcgcgagggcgcggagttccaggtcgagcagttaggccgcgagcgactgcggcgccgagccggccgcaccgagtccccggcaccatgtttgggaagaggaagaagcgggtggagatctccgcgccgtccaacttcgagcaccgcgtgcacacgggcttcgaccagcacgagcagaagttcacggggctgccccgccagtggcagagcctgatcgaggagtcggctcgccggcccaagcccctcgtcgaccccgcctgcatcacctccatccagcccggggcccccaagaccatcgtgcggggcagcaaaggtgccaaagatggggccctcacgctgctgctggacgagtttgagaacatgtcggtgacacgctccaactccctgcggagagacagcccgccgccgcccgcccgtgcccgccaggaaaatgggatgccagaggagccggccaccacggccagagggggcccagggaaggcaggcagccgaggccggttcgccggtcacagcgaggcgggtggcggcagtggtgacaggcgacgggcggggccagagaagaggcccaagtcttccagggagggctcagggggtccccaggagtcctcccgggacaaacgccccctctccgggcctgatgtcggcaccccccagcctgctggtctggccagtggggcgaaactggcagctggccggccctttaacacctacccgagggctgacacggaccacccatcccggggtgcccagggggagcctcatgacgtggcccctaacgggccatcagcggggggcctggccatcccccagtcctcctcctcctcctcccggcctcccacccgagcccgaggtgcccccagccctggagtgctgggaccccacgcctcagagccccagctggcccctccagcctgcacccccgccgcccctgctgttcctgggccccctggcccccgctcaccacagcgggagccacagcgagtatcccatgagcagttccgggctgccctgcagctggtggtggacccaggcgacccccgctcctacctggacaacttcatcaagattggcgagggctccacgggcatcgtgtgcatcgccaccgtgcgcagctcgggcaagctggtggccgtcaagaagatggacctgcgcaagcagcagaggcgcgagctgctcttcaacgaggtggtaatcatgagggactaccagcacgagaatgtggtggagatgtacaacagctacctggtgggggacgagctctgggtggtcatggagttcctggaaggaggcgccctcaccgacatcgtcacccacaccaggatgaacgaggagcagatcgcggccgtgtgccttgcagtgctgcaggccctgtcggtgctccacgcccagggcgtcatccaccgggacatcaagagcgactcgatcctgctgacccatgatggcagggtgaagctgtcagactttgggttctgcgcccaggtgagcaaggaagtgccccgaaggaagtcgctggtcggcacgccctactggatggccccagagctcatctcccgccttccctacgggccagaggtagacatctggtcgctggggataatggtgattgagatggtggacggagagcccccctacttcaacgagccacccctcaaagccatgaagatgattcgggacaacctgccaccccgactgaagaacctgcacaaggtgtcgccatccctgaagggcttcctggaccgcctgctggtgcgagaccctgcccagcgggccacggcagccgagctgctgaagcacccattcctggccaaggcagggccgcctgccagcatcgtgcccctcatgcgccagaaccgcaccagatgaggcccagcgcccttcccctcaaccaaagagccccccgggtcacccccgccccactgaggccagtagggggccaggcctcccactcctcccagcccgggagatgctccgcgtggcaccaccctccttgctgggggtagatgagaccctactactgaactccagttttgatctcgtgacttttagaaaaacacagggactcgtgggagcaagcgaggctcccaggacccccaccctctgggacaggccctcccccatgttcttctgtctccaggaagggcagcggccctcccatcactggaagtctgcagtgggggtcgctgggggtggagagaacactaagaggtgaacatgtatgagtgtgtgcacgcgtgtgagtgtgcatgtgtgtgtgtgcaaaggtccagccaccccgtcctccagcctgcaaggggtgtctggcgccttgcctgacacccagccccctctccccctgagccattgtgggggtcgatcatgaatgtccgaagagtggccttttcccgtagccctgcgccccctttctgtggctggatggggagacaggtcagggccccccaccctctccagcccctgcagcaaatgactactgcacctggacagcctcctcttttctagaagtctatttatattgtcattttataacactctagcccctgcccttattgggggacagatggtccctgtcctgcggggtggccctggcagaaccactgcctgaagaaccaggttcctgcccggtcagcgcagccccagcccgcccacccctgcctcgagttagttttacaattaaaacattgtcttgttttgtg
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:10298 -> Molecular function: GO:0004672 [protein kinase activity] evidence: NAS GeneID:10298 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IEA GeneID:10298 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA GeneID:10298 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS GeneID:10298 -> Biological process: GO:0006928 [cellular component movement] evidence: TAS GeneID:10298 -> Biological process: GO:0007010 [cytoskeleton organization] evidence: TAS GeneID:10298 -> Biological process: GO:0007049 [cell cycle] evidence: IEA GeneID:10298 -> Biological process: GO:0007165 [signal transduction] evidence: TAS GeneID:10298 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS GeneID:10298 -> Biological process: GO:0016049 [cell growth] evidence: TAS GeneID:10298 -> Biological process: GO:0016477 [cell migration] evidence: TAS GeneID:10298 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_001014832 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.