Home |
Help |
Advanced search
2024-05-09 04:12:03, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001014831 3064 bp mRNA linear PRI 02-JUN-2013
DEFINITION Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 4 (PAK4),
transcript variant 2, mRNA.
ACCESSION NM_001014831
VERSION NM_001014831.2 GI:126273531
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3064)
AUTHORS Kim,S.H., Kim,S.R., Ihm,H.J., Oh,Y.S., Chae,H.D., Kim,C.H. and
Kang,B.M.
TITLE Regulation of P21-activated kinase-4 by progesterone and tumor
necrosis factor-alpha in human endometrium and its increased
expression in advanced-stage endometriosis
JOURNAL J. Clin. Endocrinol. Metab. 98 (2), E238-E248 (2013)
PUBMED 23293332
REMARK GeneRIF: increased expression of Pak4 might lead to the
establishment and progression of endometriosis by enhanced cellular
viability and invasiveness in endometrial cells.
REFERENCE 2 (bases 1 to 3064)
AUTHORS Wang,Z., Zhang,X., Yang,Z., Du,H., Wu,Z., Gong,J., Yan,J. and
Zheng,Q.
TITLE MiR-145 regulates PAK4 via the MAPK pathway and exhibits an
antitumor effect in human colon cells
JOURNAL Biochem. Biophys. Res. Commun. 427 (3), 444-449 (2012)
PUBMED 22766504
REMARK GeneRIF: these findings demonstrate that miR-145 downregulates
P-ERK expression by targeting PAK4 and leads to inhibition of tumor
growth.
REFERENCE 3 (bases 1 to 3064)
AUTHORS Ha,B.H., Davis,M.J., Chen,C., Lou,H.J., Gao,J., Zhang,R.,
Krauthammer,M., Halaban,R., Schlessinger,J., Turk,B.E. and
Boggon,T.J.
TITLE Type II p21-activated kinases (PAKs) are regulated by an
autoinhibitory pseudosubstrate
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 109 (40), 16107-16112 (2012)
PUBMED 22988085
REMARK GeneRIF: Full-length PAK4 is constitutively autoinibited, but
mutation of the pseudosubstrate releases this inhibition.
REFERENCE 4 (bases 1 to 3064)
AUTHORS Baskaran,Y., Ng,Y.W., Selamat,W., Ling,F.T. and Manser,E.
TITLE Group I and II mammalian PAKs have different modes of activation by
Cdc42
JOURNAL EMBO Rep. 13 (7), 653-659 (2012)
PUBMED 22653441
REMARK GeneRIF: PAK4 is strongly inhibited by an auto-inhibitory domain
formed by amino acids 20 to 68.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 3064)
AUTHORS Kesanakurti,D., Chetty,C., Rajasekhar Maddirela,D., Gujrati,M. and
Rao,J.S.
TITLE Functional cooperativity by direct interaction between PAK4 and
MMP-2 in the regulation of anoikis resistance, migration and
invasion in glioma
JOURNAL Cell Death Dis 3, E445 (2012)
PUBMED 23254288
REMARK GeneRIF: Interaction between PAK4 and MMP-2 regulated anoikis, cell
migration and invasion in glioma.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 3064)
AUTHORS Lu,Y., Pan,Z.Z., Devaux,Y. and Ray,P.
TITLE p21-activated protein kinase 4 (PAK4) interacts with the
keratinocyte growth factor receptor and participates in
keratinocyte growth factor-mediated inhibition of oxidant-induced
cell death
JOURNAL J. Biol. Chem. 278 (12), 10374-10380 (2003)
PUBMED 12529371
REMARK GeneRIF: PAK4 interacts with KGF receptor and mediate
anti-apoptosis effects of KGF on epithelial cells.
REFERENCE 7 (bases 1 to 3064)
AUTHORS Zhang,H., Li,Z., Viklund,E.K. and Stromblad,S.
TITLE P21-activated kinase 4 interacts with integrin alpha v beta 5 and
regulates alpha v beta 5-mediated cell migration
JOURNAL J. Cell Biol. 158 (7), 1287-1297 (2002)
PUBMED 12356872
REFERENCE 8 (bases 1 to 3064)
AUTHORS Dan,C., Kelly,A., Bernard,O. and Minden,A.
TITLE Cytoskeletal changes regulated by the PAK4 serine/threonine kinase
are mediated by LIM kinase 1 and cofilin
JOURNAL J. Biol. Chem. 276 (34), 32115-32121 (2001)
PUBMED 11413130
REFERENCE 9 (bases 1 to 3064)
AUTHORS Bagrodia,S. and Cerione,R.A.
TITLE Pak to the future
JOURNAL Trends Cell Biol. 9 (9), 350-355 (1999)
PUBMED 10461188
REMARK Review article
REFERENCE 10 (bases 1 to 3064)
AUTHORS Abo,A., Qu,J., Cammarano,M.S., Dan,C., Fritsch,A., Baud,V.,
Belisle,B. and Minden,A.
TITLE PAK4, a novel effector for Cdc42Hs, is implicated in the
reorganization of the actin cytoskeleton and in the formation of
filopodia
JOURNAL EMBO J. 17 (22), 6527-6540 (1998)
PUBMED 9822598
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BG773480.1, BC025282.1 and
AB032968.1.
On Feb 27, 2007 this sequence version replaced gi:62422553.
Summary: PAK proteins, a family of serine/threonine p21-activating
kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are
critical effectors that link Rho GTPases to cytoskeleton
reorganization and nuclear signaling. They serve as targets for the
small GTP binding proteins Cdc42 and Rac and have been implicated
in a wide range of biological activities. PAK4 interacts
specifically with the GTP-bound form of Cdc42Hs and weakly
activates the JNK family of MAP kinases. PAK4 is a mediator of
filopodia formation and may play a role in the reorganization of
the actin cytoskeleton. Multiple alternatively spliced transcript
variants encoding distinct isoforms have been found for this gene.
[provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) has an additional segment in
the 5' UTR, and encodes the same isoform (1), as compared to
variant 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC025282.1 [ECO:0000332]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-34 BG773480.1 26-59
35-3059 BC025282.1 1-3025
3060-3064 AB032968.1 2321-2325
FEATURES Location/Qualifiers
source 1..3064
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="19"
/map="19q13.2"
gene 1..3064
/gene="PAK4"
/note="p21 protein (Cdc42/Rac)-activated kinase 4"
/db_xref="GeneID:10298"
/db_xref="HGNC:16059"
/db_xref="MIM:605451"
exon 1..140
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 56
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:71356837"
variation 74
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:4803205"
variation 102
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:4803206"
variation 116
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:111999288"
exon 141..223
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 151
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:144636460"
variation 155
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:45495801"
variation 182
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:373493871"
variation 193
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:73933813"
variation 211..220
/gene="PAK4"
/replace=""
/replace="caggtgtgtg"
/db_xref="dbSNP:201679547"
exon 224..439
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 278..279
/gene="PAK4"
/replace=""
/replace="ta"
/db_xref="dbSNP:35242898"
variation 331
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:183006549"
misc_feature 423..425
/gene="PAK4"
/note="upstream in-frame stop codon"
variation 426
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:187673293"
variation 431
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:45598837"
exon 440..665
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 442
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:376621337"
variation 443
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:370008929"
variation 447
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:690929"
variation 448
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:201511246"
variation 450
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:149068416"
variation 455
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:373760840"
variation 456
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:376606539"
CDS 462..2237
/gene="PAK4"
/EC_number="2.7.11.1"
/note="isoform 1 is encoded by transcript variant 2;
protein kinase related to S. cerevisiae STE20, effector
for Cdc42Hs; p21(CDKN1A)-activated kinase 4;
serine/threonine-protein kinase PAK 4; PAK-4;
p21-activated kinase 4"
/codon_start=1
/product="serine/threonine-protein kinase PAK 4 isoform 1"
/protein_id="NP_001014831.1"
/db_xref="GI:62422554"
/db_xref="CCDS:CCDS12528.1"
/db_xref="GeneID:10298"
/db_xref="HGNC:16059"
/db_xref="MIM:605451"
/translation="
MFGKRKKRVEISAPSNFEHRVHTGFDQHEQKFTGLPRQWQSLIEESARRPKPLVDPACITSIQPGAPKTIVRGSKGAKDGALTLLLDEFENMSVTRSNSLRRDSPPPPARARQENGMPEEPATTARGGPGKAGSRGRFAGHSEAGGGSGDRRRAGPEKRPKSSREGSGGPQESSRDKRPLSGPDVGTPQPAGLASGAKLAAGRPFNTYPRADTDHPSRGAQGEPHDVAPNGPSAGGLAIPQSSSSSSRPPTRARGAPSPGVLGPHASEPQLAPPACTPAAPAVPGPPGPRSPQREPQRVSHEQFRAALQLVVDPGDPRSYLDNFIKIGEGSTGIVCIATVRSSGKLVAVKKMDLRKQQRRELLFNEVVIMRDYQHENVVEMYNSYLVGDELWVVMEFLEGGALTDIVTHTRMNEEQIAAVCLAVLQALSVLHAQGVIHRDIKSDSILLTHDGRVKLSDFGFCAQVSKEVPRRKSLVGTPYWMAPELISRLPYGPEVDIWSLGIMVIEMVDGEPPYFNEPPLKAMKMIRDNLPPRLKNLHKVSPSLKGFLDRLLVRDPAQRATAAELLKHPFLAKAGPPASIVPLMRQNRTR
"
misc_feature 489..605
/gene="PAK4"
/note="PAK (p21 activated kinase) Binding Domain (PBD),
binds Cdc42p- and/or Rho-like small GTPases; also known as
the Cdc42/Rac interactive binding (CRIB) motif; has been
shown to inhibit transcriptional activation and cell
transformation mediated by the...; Region: CRIB_PAK_like;
cd01093"
/db_xref="CDD:29038"
misc_feature order(492..494,501..503,510..512,516..518,525..527,
576..578,588..590)
/gene="PAK4"
/note="GTPase interaction site [polypeptide binding];
other site"
/db_xref="CDD:29038"
misc_feature 534..1421
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O96013.1);
Region: Linker"
misc_feature 582..584
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 756..758
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 771..773
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 771..773
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 903..905
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 903..905
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 960..962
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 960..962
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 1002..1004
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 1002..1004
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1002..1004
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 1020..1022
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (O96013.1); phosphorylation site"
misc_feature 1044..1046
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 1080..1082
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 1233..1235
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 1233..1235
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 1260..1262
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 1332..1334
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 1332..1334
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 1353..1430
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O96013.1);
Region: GEF-interaction domain (GID)"
misc_feature 1362..2216
/gene="PAK4"
/note="Catalytic domain of the Protein Serine/Threonine
Kinase, Group II p21-activated kinase; Region:
STKc_PAK_II; cd06648"
/db_xref="CDD:132979"
misc_feature 1437..2177
/gene="PAK4"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature order(1440..1454,1464..1466,1503..1505,1509..1511,
1536..1538,1596..1598,1644..1658,1662..1667,1674..1676,
1779..1781,1785..1796,1800..1802,1830..1835,1842..1844,
1881..1895,1899..1901,1980..1982,2007..2015)
/gene="PAK4"
/note="active site"
/db_xref="CDD:132979"
misc_feature order(1440..1454,1464..1466,1503..1505,1509..1511,
1596..1598,1644..1658,1662..1667,1674..1676,1791..1796,
1800..1802,1830..1835)
/gene="PAK4"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:132979"
misc_feature order(1449..1454,1536..1538,1779..1781,1785..1793,
1842..1844,1881..1895,1899..1901,1980..1982,2007..2015)
/gene="PAK4"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:132979"
misc_feature 1830..1901
/gene="PAK4"
/note="activation loop (A-loop); other site"
/db_xref="CDD:132979"
misc_feature 1881..1883
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (O96013.1); phosphorylation site"
misc_feature 1881..1883
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1893..1895
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
variation 497
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:370966374"
variation 499
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:146498509"
variation 503
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:141017388"
variation 506
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:200199299"
variation 508
/gene="PAK4"
/replace=""
/replace="a"
/db_xref="dbSNP:66579155"
variation 509
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:199730416"
variation 521
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:114564484"
variation 522
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:146583353"
variation 530
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:199597836"
variation 536
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:113813881"
variation 545
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:75096376"
variation 590
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:373656030"
variation 591
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:200500244"
variation 620
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:377525201"
variation 621
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:148292608"
variation 625
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:112229040"
variation 635
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:200638581"
variation 653
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:141602417"
variation 656
/gene="PAK4"
/replace="g"
/replace="t"
/db_xref="dbSNP:371051871"
variation 657
/gene="PAK4"
/replace="g"
/replace="t"
/db_xref="dbSNP:373324891"
variation 658
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:376845802"
exon 666..1124
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 674
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:368355444"
variation 676
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:372186735"
variation 710
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:202071466"
variation 770
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:144141109"
variation 776
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:376964135"
variation 779
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:375296515"
variation 784
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:114116556"
variation 785
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:55711468"
variation 786
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:200319983"
variation 794
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:376684961"
variation 823
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:374813703"
variation 824
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:185941563"
variation 833
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:115339655"
variation 865
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:56099436"
variation 870
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:200644444"
variation 876
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:35655056"
variation 878
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:369143802"
variation 893
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045562"
variation 900
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:199622580"
variation 923
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:369129733"
variation 994
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:373168150"
variation 1005
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:376102097"
variation 1022
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:371641844"
variation 1052
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:377431095"
variation 1068
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:370979504"
variation 1088
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:375542750"
variation 1116
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:200780929"
exon 1125..1559
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 1125
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:370852872"
variation 1129
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:371684690"
variation 1130
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:138516359"
variation 1131
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:375872670"
variation 1140
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:200391013"
variation 1168
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:368557621"
variation 1173
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:371973365"
variation 1204
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:199929260"
variation 1229
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:375137743"
variation 1235
/gene="PAK4"
/replace=""
/replace="c"
/db_xref="dbSNP:35120836"
variation 1281
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:200534045"
variation 1296
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:369318453"
variation 1298
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:190702581"
variation 1329
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:375957288"
STS 1355..1651
/gene="PAK4"
/standard_name="MARC_20651-20652:1024691026:1"
/db_xref="UniSTS:268460"
variation 1400
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:369018322"
variation 1407
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:143998317"
variation 1409
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:201587224"
variation 1414
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:147291859"
variation 1442
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:374237195"
variation 1445
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:371904272"
variation 1475
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:370908993"
variation 1479
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:140420249"
variation 1489
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:149267288"
variation 1490
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:144457438"
variation 1505
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:148400225"
exon 1560..1693
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 1587
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:375220515"
variation 1610
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:146831773"
variation 1615
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:142488595"
variation 1628
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:368459616"
variation 1670
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:56306494"
variation 1676
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:11559035"
variation 1678
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:146517848"
variation 1679
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:372653621"
exon 1694..1820
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 1700
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:376504839"
variation 1718
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:139956496"
variation 1719
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:370017586"
variation 1739
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:374443098"
variation 1747
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:377696830"
variation 1748
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:116665223"
variation 1757
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:371674508"
variation 1776
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:375117492"
variation 1784
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:146720735"
variation 1787
/gene="PAK4"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:11559036"
variation 1790
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:141004307"
exon 1821..1946
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 1827
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:11559033"
variation 1873
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:373414547"
variation 1883
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:56286946"
variation 1884
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:11559034"
variation 1889
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:201757969"
variation 1922
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:200775475"
variation 1927
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:147024501"
variation 1932
/gene="PAK4"
/replace=""
/replace="c"
/db_xref="dbSNP:34054211"
variation 1934
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:138564503"
variation 1937
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:144059751"
exon 1947..2081
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 1961
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:151137853"
variation 1965
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:193920877"
variation 1992
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:141267072"
variation 2002
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:368539931"
variation 2003
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:146955542"
variation 2012
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:375810830"
variation 2013
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:372098486"
variation 2033
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:111768373"
variation 2039
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:11559037"
variation 2063
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:201791285"
exon 2082..3064
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 2113
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:200026990"
variation 2123
/gene="PAK4"
/replace="g"
/replace="t"
/db_xref="dbSNP:34569811"
variation 2124
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:56084716"
variation 2147
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:55747949"
variation 2154
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:150747591"
variation 2178
/gene="PAK4"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:149210444"
variation 2245
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:371711789"
variation 2273
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:376520116"
variation 2333
/gene="PAK4"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:113335516"
variation 2346
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:186511166"
variation 2409
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:377438234"
variation 2410
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:143251867"
variation 2490
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:3752161"
variation 2518
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:79890280"
variation 2519
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:45573536"
variation 2533
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:374106536"
variation 2618..2619
/gene="PAK4"
/replace=""
/replace="tg"
/db_xref="dbSNP:3833875"
variation 2619..2620
/gene="PAK4"
/replace=""
/replace="tg"
/db_xref="dbSNP:373786885"
variation 2620..2621
/gene="PAK4"
/replace=""
/replace="gt"
/db_xref="dbSNP:142481159"
variation 2631..2632
/gene="PAK4"
/replace=""
/replace="tg"
/db_xref="dbSNP:67439622"
variation 2660
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:13228"
variation 2683
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:114113304"
variation 2711..2712
/gene="PAK4"
/replace=""
/replace="c"
/db_xref="dbSNP:34766623"
variation 2756
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:11559032"
variation 2774..2775
/gene="PAK4"
/replace=""
/replace="tt"
/db_xref="dbSNP:377017717"
variation 2806
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:114754037"
variation 2867
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:11559031"
STS 2909..3035
/gene="PAK4"
/standard_name="RH12716"
/db_xref="UniSTS:3224"
variation 2998
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:73933820"
variation 3005
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:11122"
variation 3009
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:45472902"
variation 3026
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:370782442"
polyA_signal 3041..3046
/gene="PAK4"
variation 3049
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:181552710"
polyA_site 3064
/gene="PAK4"
ORIGIN
agccccggatgttcgttggggattcaacatggcggcgggagtgtccgcggtggtggcggtgcaagagagctgagggaggcgcgagggcgcggagttccaggtcgagcagttaggccgcgagcgactgcggcgccgagccgatgagtaacccgaagcccctagaggagtggtcacctgcctgagggcacttctgtcccaccagcatcagaccaggtgtgtgcaggctctctatgggatgccgccatcagaatgtctcttcctcagcccctttgttttttaaagtggctttggtcgaccatttgctctgtgcttggtactgtgtcaagggcccgattgaagaccacagatcctaaagataggggagtgtcgcgacaaggctgcctggggtgccctcttaacccaggggatcagtaaccctgtgctgagtcaatatccaaaggccgcaccgagtccccggcaccatgtttgggaagaggaagaagcgggtggagatctccgcgccgtccaacttcgagcaccgcgtgcacacgggcttcgaccagcacgagcagaagttcacggggctgccccgccagtggcagagcctgatcgaggagtcggctcgccggcccaagcccctcgtcgaccccgcctgcatcacctccatccagcccggggcccccaagaccatcgtgcggggcagcaaaggtgccaaagatggggccctcacgctgctgctggacgagtttgagaacatgtcggtgacacgctccaactccctgcggagagacagcccgccgccgcccgcccgtgcccgccaggaaaatgggatgccagaggagccggccaccacggccagagggggcccagggaaggcaggcagccgaggccggttcgccggtcacagcgaggcgggtggcggcagtggtgacaggcgacgggcggggccagagaagaggcccaagtcttccagggagggctcagggggtccccaggagtcctcccgggacaaacgccccctctccgggcctgatgtcggcaccccccagcctgctggtctggccagtggggcgaaactggcagctggccggccctttaacacctacccgagggctgacacggaccacccatcccggggtgcccagggggagcctcatgacgtggcccctaacgggccatcagcggggggcctggccatcccccagtcctcctcctcctcctcccggcctcccacccgagcccgaggtgcccccagccctggagtgctgggaccccacgcctcagagccccagctggcccctccagcctgcacccccgccgcccctgctgttcctgggccccctggcccccgctcaccacagcgggagccacagcgagtatcccatgagcagttccgggctgccctgcagctggtggtggacccaggcgacccccgctcctacctggacaacttcatcaagattggcgagggctccacgggcatcgtgtgcatcgccaccgtgcgcagctcgggcaagctggtggccgtcaagaagatggacctgcgcaagcagcagaggcgcgagctgctcttcaacgaggtggtaatcatgagggactaccagcacgagaatgtggtggagatgtacaacagctacctggtgggggacgagctctgggtggtcatggagttcctggaaggaggcgccctcaccgacatcgtcacccacaccaggatgaacgaggagcagatcgcggccgtgtgccttgcagtgctgcaggccctgtcggtgctccacgcccagggcgtcatccaccgggacatcaagagcgactcgatcctgctgacccatgatggcagggtgaagctgtcagactttgggttctgcgcccaggtgagcaaggaagtgccccgaaggaagtcgctggtcggcacgccctactggatggccccagagctcatctcccgccttccctacgggccagaggtagacatctggtcgctggggataatggtgattgagatggtggacggagagcccccctacttcaacgagccacccctcaaagccatgaagatgattcgggacaacctgccaccccgactgaagaacctgcacaaggtgtcgccatccctgaagggcttcctggaccgcctgctggtgcgagaccctgcccagcgggccacggcagccgagctgctgaagcacccattcctggccaaggcagggccgcctgccagcatcgtgcccctcatgcgccagaaccgcaccagatgaggcccagcgcccttcccctcaaccaaagagccccccgggtcacccccgccccactgaggccagtagggggccaggcctcccactcctcccagcccgggagatgctccgcgtggcaccaccctccttgctgggggtagatgagaccctactactgaactccagttttgatctcgtgacttttagaaaaacacagggactcgtgggagcaagcgaggctcccaggacccccaccctctgggacaggccctcccccatgttcttctgtctccaggaagggcagcggccctcccatcactggaagtctgcagtgggggtcgctgggggtggagagaacactaagaggtgaacatgtatgagtgtgtgcacgcgtgtgagtgtgcatgtgtgtgtgtgcaaaggtccagccaccccgtcctccagcctgcaaggggtgtctggcgccttgcctgacacccagccccctctccccctgagccattgtgggggtcgatcatgaatgtccgaagagtggccttttcccgtagccctgcgccccctttctgtggctggatggggagacaggtcagggccccccaccctctccagcccctgcagcaaatgactactgcacctggacagcctcctcttttctagaagtctatttatattgtcattttataacactctagcccctgcccttattgggggacagatggtccctgtcctgcggggtggccctggcagaaccactgcctgaagaaccaggttcctgcccggtcagcgcagccccagcccgcccacccctgcctcgagttagttttacaattaaaacattgtcttgttttgtg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:10298 -> Molecular function: GO:0004672 [protein kinase activity] evidence: NAS
GeneID:10298 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IEA
GeneID:10298 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:10298 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:10298 -> Biological process: GO:0006928 [cellular component movement] evidence: TAS
GeneID:10298 -> Biological process: GO:0007010 [cytoskeleton organization] evidence: TAS
GeneID:10298 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
GeneID:10298 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:10298 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS
GeneID:10298 -> Biological process: GO:0016049 [cell growth] evidence: TAS
GeneID:10298 -> Biological process: GO:0016477 [cell migration] evidence: TAS
GeneID:10298 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001014831 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.