GGRNA Home | Help | Advanced search

2024-04-26 15:43:20, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001013736            3308 bp    mRNA    linear   PRI 23-APR-2012
DEFINITION  Homo sapiens family with sequence similarity 47, member C (FAM47C),
            mRNA.
ACCESSION   NM_001013736 XM_498355
VERSION     NM_001013736.2  GI:296010860
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3308)
  AUTHORS   Kimura,K., Wakamatsu,A., Suzuki,Y., Ota,T., Nishikawa,T.,
            Yamashita,R., Yamamoto,J., Sekine,M., Tsuritani,K., Wakaguri,H.,
            Ishii,S., Sugiyama,T., Saito,K., Isono,Y., Irie,R., Kushida,N.,
            Yoneyama,T., Otsuka,R., Kanda,K., Yokoi,T., Kondo,H., Wagatsuma,M.,
            Murakawa,K., Ishida,S., Ishibashi,T., Takahashi-Fujii,A.,
            Tanase,T., Nagai,K., Kikuchi,H., Nakai,K., Isogai,T. and Sugano,S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DB082026.1, AK125992.1 and BX842568.3.
            This sequence is a reference standard in the RefSeqGene project.
            On May 13, 2010 this sequence version replaced gi:61966918.
            
            Summary: This gene encodes a product belonging to a family of
            proteins with unknown function. The coding sequence of this family
            member includes several tandemly repeated regions. [provided by
            RefSeq, Sep 2011].
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-343               DB082026.1         1-343
            344-874             AK125992.1         66-596
            875-1496            BX842568.3         68862-69483         c
            1497-3308           AK125992.1         1219-3030
FEATURES             Location/Qualifiers
     source          1..3308
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xp21.1"
     gene            1..3308
                     /gene="FAM47C"
                     /note="family with sequence similarity 47, member C"
                     /db_xref="GeneID:442444"
                     /db_xref="HGNC:25301"
                     /db_xref="HPRD:18474"
     exon            1..3308
                     /gene="FAM47C"
                     /inference="alignment:Splign:1.39.8"
     variation       38
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61730911"
     variation       42
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61730912"
     CDS             53..3160
                     /gene="FAM47C"
                     /codon_start=1
                     /product="putative protein FAM47C"
                     /protein_id="NP_001013758.1"
                     /db_xref="GI:61966919"
                     /db_xref="CCDS:CCDS35227.1"
                     /db_xref="GeneID:442444"
                     /db_xref="HGNC:25301"
                     /db_xref="HPRD:18474"
                     /translation="
MGDQRPQDRPSSPGMDSTPWYCDKPPSKYFAKRKHRRLRFPPVDTQNWVFVTEGMDDFRYGCQSPEDTLVCRRDEFLLPKISLRGPQADPKSRKKKLLKKAALFSKLSPAQPARKAFVEEVEAQLMTKHPLAMYPNLGEDMPPDLLLQVLKPLDPERKLEDAGSCEGQEKTTDEPTEPGKYPCGEFSPRPPETRVSCLPPEPPKTPVSSLRPEPPETGVSHLRPQPPKTQVSSLHLEPPETGVSHLRPEPPKTQVSSLHLEPPETGVSHLYLEPPGTGVSHLCPEPPKTRVSHLHREPPETGVPDLCLEPPKSRVSHLRPEPSETGVSHLHPEPPKTLVSSLHPEPPETGVSHLCPEPPETRVSPLRQLPPEAGVSHLCPEPPKTRVPPLRPETPKNGVSPLFPEPPKTRISNLRSEPPKIGVSHLCLEPPKTRGSHLRPEPPETGVSHLRPEPPKTRVSSLHLEPPETGVSHLCPEPPEKDVSHLRPEPPDTGVSHLCPEPPKTRVSHLRPEPSETGVSHLRPEPPKILVSSLHQAPPESSVSHLRPEPPETGVSHLRPEPPKTRMYSLRPEPPDTGVSHLCPEPPKTRVSSLPPEPPETGVSHLCPEPPETRVSHLRPEPPETGVSHLRPEPPKTRMYSLRPEPPNTGVSHLCPEPPKTRVSSLPPEPPETGVSHLCPEPPETRVSHLRPEPPETGVSRLHPEPPKTRVSSLHAEPPESRVSHLCPEPPETGVSHLRPEPPKPRVSSLRPEPLETRVSHLRPEPPETGVSHLHPELPKPRVSSLHLEPPKTRRVSSLRLEPPKTGRVSSLCPEPTKTGASHLKELFQEGTSSTMECVSDSLQRRHTSRKLRDFKWAGDLGVNEESISSLFDFTPECRATYQDQKNKKANECSSGLKYSMELDEMDEVKFFSQEKDLDGKIQNAPNSHSAQHVKMGYGAWYLKPKLGKKLRSDEPLIDPKLVLEKPDEPDILDGLYGPIAFKDFILSKGYEMPGIIQRLFARRGWTYDSVKTPIQRAMQVYKYKEDVTDASEED
"
     misc_feature    <620..2242
                     /gene="FAM47C"
                     /note="large tegument protein UL36; Provisional; Region:
                     PHA03247"
                     /db_xref="CDD:165506"
     variation       58
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146333223"
     variation       63
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374396557"
     variation       66
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2731737"
     variation       68
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377377914"
     variation       89
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148309296"
     variation       90
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199598732"
     variation       149
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113161623"
     variation       162
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150852041"
     variation       207
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370862889"
     variation       213
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371622737"
     variation       233
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375043912"
     variation       234
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139337711"
     variation       274
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149618786"
     variation       307
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146144825"
     variation       327
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368080118"
     variation       361
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140170835"
     variation       368
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143938481"
     variation       376
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370448444"
     variation       383
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146420839"
     variation       392
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:189160727"
     variation       397
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373856649"
     variation       405
                     /gene="FAM47C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148624854"
     variation       427
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142090974"
     variation       431
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151172763"
     variation       474
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199642917"
     variation       491
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140265914"
     variation       536
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186119759"
     variation       539
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146977391"
     variation       574
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147623513"
     variation       576
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:28706806"
     variation       593
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146258005"
     variation       604
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61730915"
     variation       642
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149352851"
     variation       669
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372313874"
     variation       670
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200547398"
     variation       688
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375921003"
     variation       725
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368685662"
     variation       742
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368731308"
     variation       769
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201507521"
     variation       788
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148119466"
     variation       797
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113759376"
     variation       818
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372027100"
     variation       842
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376309609"
     variation       845
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142884749"
     variation       913
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146118126"
     variation       921
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369396417"
     variation       923
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:182976429"
     variation       939
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140151778"
     variation       985..986
                     /gene="FAM47C"
                     /replace=""
                     /replace="caagt"
                     /db_xref="dbSNP:374488209"
     variation       995
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374331672"
     variation       1007
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200865878"
     variation       1008
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142244745"
     variation       1051
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150906408"
     variation       1056
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200166615"
     variation       1089
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376665941"
     variation       1094
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139443110"
     variation       1119
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368736267"
     variation       1137
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149671724"
     variation       1146
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372986772"
     variation       1201
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201382252"
     variation       1202
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202169391"
     variation       1211
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376992053"
     variation       1223
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202186252"
     variation       1247
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371381467"
     variation       1263
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373282135"
     variation       1283
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145172566"
     variation       1295
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147613870"
     variation       1367
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375607348"
     variation       1403
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61730908"
     variation       1425
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200849623"
     variation       1427
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151225998"
     variation       1439
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140431595"
     variation       1472
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:150397226"
     variation       1475
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61730909"
     variation       1511
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377326539"
     variation       1568
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370557345"
     variation       1569
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:182977677"
     variation       1570
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149060980"
     variation       1572
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201525254"
     variation       1583
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138169403"
     variation       1614
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200410509"
     variation       1664
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138922114"
     variation       1666..1667
                     /gene="FAM47C"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:372272981"
     variation       1670
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187865465"
     variation       1679
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143115052"
     variation       1696
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73631164"
     variation       1708
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201342805"
     variation       1728
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148160398"
     variation       1732
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142025533"
     variation       1762
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73631165"
     variation       1777
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61741724"
     variation       1821
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139503125"
     variation       1847
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370198155"
     variation       1894
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200423838"
     variation       1907
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374159933"
     variation       1912
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183452806"
     variation       1940
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147168815"
     variation       1943
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140469750"
     variation       1958
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200624033"
     variation       1980
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374929761"
     variation       1984
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201276970"
     variation       1989
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187795004"
     variation       1991
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144435332"
     variation       1994
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145580328"
     variation       2012
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148899112"
     variation       2055
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142735792"
     variation       2065
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369077079"
     variation       2109
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145034356"
     variation       2131
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138880937"
     variation       2162
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200610681"
     variation       2172
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140624380"
     variation       2180
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372777724"
     variation       2192
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201919807"
     variation       2198
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61999275"
     variation       2217
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138293293"
     variation       2236
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149639130"
     variation       2248
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368244972"
     variation       2252
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376884601"
     variation       2267
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144392292"
     variation       2288
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199727942"
     variation       2324
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145545779"
     variation       2325
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376888720"
     variation       2331
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61730910"
     variation       2339
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143434116"
     variation       2343
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192457922"
     variation       2433
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147158965"
     variation       2435
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140378751"
     variation       2437
                     /gene="FAM47C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369069861"
     variation       2464
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202153386"
     variation       2473
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371425971"
     variation       2474
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375850001"
     variation       2491
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370026356"
     variation       2502
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61744986"
     variation       2508
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78225817"
     variation       2515
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373875260"
     variation       2544
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200407931"
     variation       2549
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200774091"
     variation       2553
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199779841"
     variation       2599
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376287688"
     variation       2667
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200637175"
     variation       2674
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35315805"
     variation       2689
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373836661"
     variation       2758
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150769551"
     variation       2768
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56928700"
     variation       2780
                     /gene="FAM47C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:28756702"
     variation       2802
                     /gene="FAM47C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139172934"
     variation       2823
                     /gene="FAM47C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1995914"
     variation       2825
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61730906"
     variation       2881
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373029478"
     variation       2907
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1995915"
     variation       2915
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375998369"
     variation       2922
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201493707"
     variation       2962
                     /gene="FAM47C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:41311787"
     variation       2994
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200986221"
     variation       3092
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143561128"
     variation       3104
                     /gene="FAM47C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373819113"
     variation       3148
                     /gene="FAM47C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146796397"
     variation       3288
                     /gene="FAM47C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189955231"
ORIGIN      
agggatcaggaaccgcggaaactggagaggtggcaccccagcgagggccaccatgggggaccagaggccgcaggaccggcccagttccccgggcatggactccacgccctggtactgtgacaaaccgccttccaagtacttcgcgaagcgcaagcacaggcgcctgaggttcccgcctgtggacacccagaactgggtatttgtgacggagggcatggacgacttccgctacggctgtcagtctcctgaagatacgcttgtttgtcgccgtgacgagtttttactccccaaaatatctctcagaggtccccaagctgaccccaaaagcaggaagaaaaagctgctcaagaaagcggccctgttttccaagctctcgccagcacagccagcacggaaggcgttcgtagaggaagtggaagcccagctgatgaccaagcatcccttggccatgtaccccaatctgggagaagatatgcctccagatctcctactacaggtactgaaaccgctggaccctgagaggaagctggaggacgcaggctcttgtgagggccaggagaagacaactgacgaacccacggagcctggtaaatacccctgtggggaattctcccctcggcctcccgagactcgggtgtcctgtctccccccggagcctcccaagactccggtgtccagtctccgcccggagcctccagagactggagtgtcccatctccgcccacagcctcccaagactcaggtgtccagtctccacctggagcctccagagactggagtgtcccatctccgcccagagcctcccaagactcaggtgtccagtctccacctggagcctcccgagactggagtgtcccatctctacctggagcctcctgggactggagtgtctcatctctgcccagagcctcccaagactcgcgtatctcatctccatcgggagcctcctgagactggagtgcctgatctctgcctggagcctcccaagtcacgcgtatctcatctccgcccagagccttctgagactggagtgtcccatctccacccagagcctcccaagactctggtgtccagtctccacccagagcctcccgagactggagtgtcccatctctgcccggaacctccagagactcgcgtatctcctctccgccagctgcctcccgaggctggagtgtcccatctctgcccggaacctcccaagactcgcgtacctcctctccgcccagagacccccaagaatggagtgtctcctctcttcccggagcctcccaagactcgcatatctaatctccgctcggagcctcccaagattggagtgtcccatctctgcctggagcctcccaagactcgcggatctcatctccgcccggaacctcctgagactggagtgtcccatctccgcccagagcctcccaagactcgggtgtccagtctccacctggagcctcctgagactggagtgtcccatctctgcccggagcctccagagaaggacgtatctcatctccgcccagagcctcccgacactggagtgtcccatctctgcccagagccccccaagacacgcgtatctcatctccgcccagagccttctgagactggagtgtcccatctccgcccagagcctcccaagattctggtgtccagtctccaccaggcacctcctgagagtagcgtatctcatctccgcccagagcctcctgagactggagtgtcccatctccgcccagagcctcccaagactcggatgtacagtctccgcccggagcctcccgatactggagtgtcccatctctgcccagagcctcccaagactcgggtgtccagtctccccccggagccccccgagactggagtgtcccatctctgcccggagcctccagagactcgcgtatctcatctccgcccagagcctcctgagactggagtgtcccatctccgcccagagcctcccaagactcggatgtacagtctccgcccggagcctcccaatactggagtgtcccatctctgcccagagcctcccaagactcgggtgtccagtctccccccggagccccccgagactggagtgtcccatctctgcccggagcctccagagactcgcgtatctcatctccgcccagagcctcctgagactggagtgtcccgtctccacccagagcctcccaagactcgggtgtccagtctccacgcggagcctcctgagagtcgcgtatctcatctctgcccggagcctcctgagactggagtgtcccatctccgcccagagcctcccaagcctcgggtttccagtctccgcccagagcctcttgagactcgcgtatctcatctccgcccggagcctcctgagactggagtgtcccatctccacccagagcttcccaagcctcgggtatccagtctccacctggagcctcccaagactcgtcgagtgtccagtctccgcctggagcctcccaagactggtcgggtgtccagtctctgcccggagcctaccaagaccggagcgtcccatctaaaagaactgtttcaggaaggtacatcaagcacaatggagtgtgtttctgactctcttcaacgtagacacacatcgagaaaactccgtgacttcaagtgggctggagacctaggagttaatgaagaatccatcagcagtctgtttgactttacccctgagtgcagagcaacctatcaagaccaaaagaataagaaggcaaacgagtgttcctcagggctgaagtacagcatggagctagacgaaatggatgaggtcaaattcttctcacaggaaaaagacttggacgggaaaatccagaatgcaccaaattctcatagtgcacagcatgtgaagatggggtatggagcatggtacctcaagcctaagttggggaaaaagctaagaagtgatgaacctttgattgaccccaagctcgtacttgaaaagcctgatgaacccgacattcttgacggtctttatggaccaatcgcctttaaggatttcattctaagcaagggctatgaaatgcctggcatcattcaaaggctgtttgccaggaggggatggacttatgactctgttaagactcctattcaacgtgcaatgcaagtttacaagtacaaagaagacgtcacagatgcatcggaagaagattagatggttttgaatttactagttaattgggtatttcttgctctcattttaaacatcagtcagaatttatgatgactggccccaggaatgtacaacgttggcaacatctgtaaattcaatacctaatgtttataaatatttcttaatgacc
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.