Home |
Help |
Advanced search
2024-04-26 07:31:20, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001013736 3308 bp mRNA linear PRI 23-APR-2012
DEFINITION Homo sapiens family with sequence similarity 47, member C (FAM47C),
mRNA.
ACCESSION NM_001013736 XM_498355
VERSION NM_001013736.2 GI:296010860
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3308)
AUTHORS Kimura,K., Wakamatsu,A., Suzuki,Y., Ota,T., Nishikawa,T.,
Yamashita,R., Yamamoto,J., Sekine,M., Tsuritani,K., Wakaguri,H.,
Ishii,S., Sugiyama,T., Saito,K., Isono,Y., Irie,R., Kushida,N.,
Yoneyama,T., Otsuka,R., Kanda,K., Yokoi,T., Kondo,H., Wagatsuma,M.,
Murakawa,K., Ishida,S., Ishibashi,T., Takahashi-Fujii,A.,
Tanase,T., Nagai,K., Kikuchi,H., Nakai,K., Isogai,T. and Sugano,S.
TITLE Diversification of transcriptional modulation: large-scale
identification and characterization of putative alternative
promoters of human genes
JOURNAL Genome Res. 16 (1), 55-65 (2006)
PUBMED 16344560
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
DB082026.1, AK125992.1 and BX842568.3.
This sequence is a reference standard in the RefSeqGene project.
On May 13, 2010 this sequence version replaced gi:61966918.
Summary: This gene encodes a product belonging to a family of
proteins with unknown function. The coding sequence of this family
member includes several tandemly repeated regions. [provided by
RefSeq, Sep 2011].
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-343 DB082026.1 1-343
344-874 AK125992.1 66-596
875-1496 BX842568.3 68862-69483 c
1497-3308 AK125992.1 1219-3030
FEATURES Location/Qualifiers
source 1..3308
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xp21.1"
gene 1..3308
/gene="FAM47C"
/note="family with sequence similarity 47, member C"
/db_xref="GeneID:442444"
/db_xref="HGNC:25301"
/db_xref="HPRD:18474"
exon 1..3308
/gene="FAM47C"
/inference="alignment:Splign:1.39.8"
variation 38
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:61730911"
variation 42
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:61730912"
CDS 53..3160
/gene="FAM47C"
/codon_start=1
/product="putative protein FAM47C"
/protein_id="NP_001013758.1"
/db_xref="GI:61966919"
/db_xref="CCDS:CCDS35227.1"
/db_xref="GeneID:442444"
/db_xref="HGNC:25301"
/db_xref="HPRD:18474"
/translation="
MGDQRPQDRPSSPGMDSTPWYCDKPPSKYFAKRKHRRLRFPPVDTQNWVFVTEGMDDFRYGCQSPEDTLVCRRDEFLLPKISLRGPQADPKSRKKKLLKKAALFSKLSPAQPARKAFVEEVEAQLMTKHPLAMYPNLGEDMPPDLLLQVLKPLDPERKLEDAGSCEGQEKTTDEPTEPGKYPCGEFSPRPPETRVSCLPPEPPKTPVSSLRPEPPETGVSHLRPQPPKTQVSSLHLEPPETGVSHLRPEPPKTQVSSLHLEPPETGVSHLYLEPPGTGVSHLCPEPPKTRVSHLHREPPETGVPDLCLEPPKSRVSHLRPEPSETGVSHLHPEPPKTLVSSLHPEPPETGVSHLCPEPPETRVSPLRQLPPEAGVSHLCPEPPKTRVPPLRPETPKNGVSPLFPEPPKTRISNLRSEPPKIGVSHLCLEPPKTRGSHLRPEPPETGVSHLRPEPPKTRVSSLHLEPPETGVSHLCPEPPEKDVSHLRPEPPDTGVSHLCPEPPKTRVSHLRPEPSETGVSHLRPEPPKILVSSLHQAPPESSVSHLRPEPPETGVSHLRPEPPKTRMYSLRPEPPDTGVSHLCPEPPKTRVSSLPPEPPETGVSHLCPEPPETRVSHLRPEPPETGVSHLRPEPPKTRMYSLRPEPPNTGVSHLCPEPPKTRVSSLPPEPPETGVSHLCPEPPETRVSHLRPEPPETGVSRLHPEPPKTRVSSLHAEPPESRVSHLCPEPPETGVSHLRPEPPKPRVSSLRPEPLETRVSHLRPEPPETGVSHLHPELPKPRVSSLHLEPPKTRRVSSLRLEPPKTGRVSSLCPEPTKTGASHLKELFQEGTSSTMECVSDSLQRRHTSRKLRDFKWAGDLGVNEESISSLFDFTPECRATYQDQKNKKANECSSGLKYSMELDEMDEVKFFSQEKDLDGKIQNAPNSHSAQHVKMGYGAWYLKPKLGKKLRSDEPLIDPKLVLEKPDEPDILDGLYGPIAFKDFILSKGYEMPGIIQRLFARRGWTYDSVKTPIQRAMQVYKYKEDVTDASEED
"
misc_feature <620..2242
/gene="FAM47C"
/note="large tegument protein UL36; Provisional; Region:
PHA03247"
/db_xref="CDD:165506"
variation 58
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:146333223"
variation 63
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:374396557"
variation 66
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:2731737"
variation 68
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:377377914"
variation 89
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:148309296"
variation 90
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:199598732"
variation 149
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:113161623"
variation 162
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:150852041"
variation 207
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:370862889"
variation 213
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:371622737"
variation 233
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:375043912"
variation 234
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:139337711"
variation 274
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:149618786"
variation 307
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:146144825"
variation 327
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:368080118"
variation 361
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:140170835"
variation 368
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:143938481"
variation 376
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:370448444"
variation 383
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:146420839"
variation 392
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:189160727"
variation 397
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:373856649"
variation 405
/gene="FAM47C"
/replace="a"
/replace="t"
/db_xref="dbSNP:148624854"
variation 427
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:142090974"
variation 431
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:151172763"
variation 474
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:199642917"
variation 491
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:140265914"
variation 536
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:186119759"
variation 539
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:146977391"
variation 574
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:147623513"
variation 576
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:28706806"
variation 593
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:146258005"
variation 604
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:61730915"
variation 642
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:149352851"
variation 669
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:372313874"
variation 670
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:200547398"
variation 688
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:375921003"
variation 725
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:368685662"
variation 742
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:368731308"
variation 769
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:201507521"
variation 788
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:148119466"
variation 797
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:113759376"
variation 818
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:372027100"
variation 842
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:376309609"
variation 845
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:142884749"
variation 913
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:146118126"
variation 921
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:369396417"
variation 923
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:182976429"
variation 939
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:140151778"
variation 985..986
/gene="FAM47C"
/replace=""
/replace="caagt"
/db_xref="dbSNP:374488209"
variation 995
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:374331672"
variation 1007
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:200865878"
variation 1008
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:142244745"
variation 1051
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:150906408"
variation 1056
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:200166615"
variation 1089
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:376665941"
variation 1094
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:139443110"
variation 1119
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:368736267"
variation 1137
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:149671724"
variation 1146
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:372986772"
variation 1201
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:201382252"
variation 1202
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:202169391"
variation 1211
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:376992053"
variation 1223
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:202186252"
variation 1247
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:371381467"
variation 1263
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:373282135"
variation 1283
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:145172566"
variation 1295
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:147613870"
variation 1367
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:375607348"
variation 1403
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:61730908"
variation 1425
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:200849623"
variation 1427
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:151225998"
variation 1439
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:140431595"
variation 1472
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:150397226"
variation 1475
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:61730909"
variation 1511
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:377326539"
variation 1568
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:370557345"
variation 1569
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:182977677"
variation 1570
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:149060980"
variation 1572
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:201525254"
variation 1583
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:138169403"
variation 1614
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:200410509"
variation 1664
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:138922114"
variation 1666..1667
/gene="FAM47C"
/replace=""
/replace="c"
/db_xref="dbSNP:372272981"
variation 1670
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:187865465"
variation 1679
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:143115052"
variation 1696
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:73631164"
variation 1708
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:201342805"
variation 1728
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:148160398"
variation 1732
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:142025533"
variation 1762
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:73631165"
variation 1777
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:61741724"
variation 1821
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:139503125"
variation 1847
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:370198155"
variation 1894
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:200423838"
variation 1907
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:374159933"
variation 1912
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:183452806"
variation 1940
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:147168815"
variation 1943
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:140469750"
variation 1958
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:200624033"
variation 1980
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:374929761"
variation 1984
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:201276970"
variation 1989
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:187795004"
variation 1991
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:144435332"
variation 1994
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:145580328"
variation 2012
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:148899112"
variation 2055
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:142735792"
variation 2065
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:369077079"
variation 2109
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:145034356"
variation 2131
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:138880937"
variation 2162
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:200610681"
variation 2172
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:140624380"
variation 2180
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:372777724"
variation 2192
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:201919807"
variation 2198
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:61999275"
variation 2217
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:138293293"
variation 2236
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:149639130"
variation 2248
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:368244972"
variation 2252
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:376884601"
variation 2267
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:144392292"
variation 2288
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:199727942"
variation 2324
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:145545779"
variation 2325
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:376888720"
variation 2331
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:61730910"
variation 2339
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:143434116"
variation 2343
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:192457922"
variation 2433
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:147158965"
variation 2435
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:140378751"
variation 2437
/gene="FAM47C"
/replace="a"
/replace="t"
/db_xref="dbSNP:369069861"
variation 2464
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:202153386"
variation 2473
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:371425971"
variation 2474
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:375850001"
variation 2491
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:370026356"
variation 2502
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:61744986"
variation 2508
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:78225817"
variation 2515
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:373875260"
variation 2544
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:200407931"
variation 2549
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:200774091"
variation 2553
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:199779841"
variation 2599
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:376287688"
variation 2667
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:200637175"
variation 2674
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:35315805"
variation 2689
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:373836661"
variation 2758
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:150769551"
variation 2768
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:56928700"
variation 2780
/gene="FAM47C"
/replace="a"
/replace="t"
/db_xref="dbSNP:28756702"
variation 2802
/gene="FAM47C"
/replace="a"
/replace="t"
/db_xref="dbSNP:139172934"
variation 2823
/gene="FAM47C"
/replace="a"
/replace="c"
/db_xref="dbSNP:1995914"
variation 2825
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:61730906"
variation 2881
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:373029478"
variation 2907
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:1995915"
variation 2915
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:375998369"
variation 2922
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:201493707"
variation 2962
/gene="FAM47C"
/replace="c"
/replace="g"
/db_xref="dbSNP:41311787"
variation 2994
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:200986221"
variation 3092
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:143561128"
variation 3104
/gene="FAM47C"
/replace="g"
/replace="t"
/db_xref="dbSNP:373819113"
variation 3148
/gene="FAM47C"
/replace="a"
/replace="g"
/db_xref="dbSNP:146796397"
variation 3288
/gene="FAM47C"
/replace="c"
/replace="t"
/db_xref="dbSNP:189955231"
ORIGIN
agggatcaggaaccgcggaaactggagaggtggcaccccagcgagggccaccatgggggaccagaggccgcaggaccggcccagttccccgggcatggactccacgccctggtactgtgacaaaccgccttccaagtacttcgcgaagcgcaagcacaggcgcctgaggttcccgcctgtggacacccagaactgggtatttgtgacggagggcatggacgacttccgctacggctgtcagtctcctgaagatacgcttgtttgtcgccgtgacgagtttttactccccaaaatatctctcagaggtccccaagctgaccccaaaagcaggaagaaaaagctgctcaagaaagcggccctgttttccaagctctcgccagcacagccagcacggaaggcgttcgtagaggaagtggaagcccagctgatgaccaagcatcccttggccatgtaccccaatctgggagaagatatgcctccagatctcctactacaggtactgaaaccgctggaccctgagaggaagctggaggacgcaggctcttgtgagggccaggagaagacaactgacgaacccacggagcctggtaaatacccctgtggggaattctcccctcggcctcccgagactcgggtgtcctgtctccccccggagcctcccaagactccggtgtccagtctccgcccggagcctccagagactggagtgtcccatctccgcccacagcctcccaagactcaggtgtccagtctccacctggagcctccagagactggagtgtcccatctccgcccagagcctcccaagactcaggtgtccagtctccacctggagcctcccgagactggagtgtcccatctctacctggagcctcctgggactggagtgtctcatctctgcccagagcctcccaagactcgcgtatctcatctccatcgggagcctcctgagactggagtgcctgatctctgcctggagcctcccaagtcacgcgtatctcatctccgcccagagccttctgagactggagtgtcccatctccacccagagcctcccaagactctggtgtccagtctccacccagagcctcccgagactggagtgtcccatctctgcccggaacctccagagactcgcgtatctcctctccgccagctgcctcccgaggctggagtgtcccatctctgcccggaacctcccaagactcgcgtacctcctctccgcccagagacccccaagaatggagtgtctcctctcttcccggagcctcccaagactcgcatatctaatctccgctcggagcctcccaagattggagtgtcccatctctgcctggagcctcccaagactcgcggatctcatctccgcccggaacctcctgagactggagtgtcccatctccgcccagagcctcccaagactcgggtgtccagtctccacctggagcctcctgagactggagtgtcccatctctgcccggagcctccagagaaggacgtatctcatctccgcccagagcctcccgacactggagtgtcccatctctgcccagagccccccaagacacgcgtatctcatctccgcccagagccttctgagactggagtgtcccatctccgcccagagcctcccaagattctggtgtccagtctccaccaggcacctcctgagagtagcgtatctcatctccgcccagagcctcctgagactggagtgtcccatctccgcccagagcctcccaagactcggatgtacagtctccgcccggagcctcccgatactggagtgtcccatctctgcccagagcctcccaagactcgggtgtccagtctccccccggagccccccgagactggagtgtcccatctctgcccggagcctccagagactcgcgtatctcatctccgcccagagcctcctgagactggagtgtcccatctccgcccagagcctcccaagactcggatgtacagtctccgcccggagcctcccaatactggagtgtcccatctctgcccagagcctcccaagactcgggtgtccagtctccccccggagccccccgagactggagtgtcccatctctgcccggagcctccagagactcgcgtatctcatctccgcccagagcctcctgagactggagtgtcccgtctccacccagagcctcccaagactcgggtgtccagtctccacgcggagcctcctgagagtcgcgtatctcatctctgcccggagcctcctgagactggagtgtcccatctccgcccagagcctcccaagcctcgggtttccagtctccgcccagagcctcttgagactcgcgtatctcatctccgcccggagcctcctgagactggagtgtcccatctccacccagagcttcccaagcctcgggtatccagtctccacctggagcctcccaagactcgtcgagtgtccagtctccgcctggagcctcccaagactggtcgggtgtccagtctctgcccggagcctaccaagaccggagcgtcccatctaaaagaactgtttcaggaaggtacatcaagcacaatggagtgtgtttctgactctcttcaacgtagacacacatcgagaaaactccgtgacttcaagtgggctggagacctaggagttaatgaagaatccatcagcagtctgtttgactttacccctgagtgcagagcaacctatcaagaccaaaagaataagaaggcaaacgagtgttcctcagggctgaagtacagcatggagctagacgaaatggatgaggtcaaattcttctcacaggaaaaagacttggacgggaaaatccagaatgcaccaaattctcatagtgcacagcatgtgaagatggggtatggagcatggtacctcaagcctaagttggggaaaaagctaagaagtgatgaacctttgattgaccccaagctcgtacttgaaaagcctgatgaacccgacattcttgacggtctttatggaccaatcgcctttaaggatttcattctaagcaagggctatgaaatgcctggcatcattcaaaggctgtttgccaggaggggatggacttatgactctgttaagactcctattcaacgtgcaatgcaagtttacaagtacaaagaagacgtcacagatgcatcggaagaagattagatggttttgaatttactagttaattgggtatttcttgctctcattttaaacatcagtcagaatttatgatgactggccccaggaatgtacaacgttggcaacatctgtaaattcaatacctaatgtttataaatatttcttaatgacc
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.