Home |
Help |
Advanced search
2024-04-20 22:59:28, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001013398 2638 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens insulin-like growth factor binding protein 3 (IGFBP3),
transcript variant 1, mRNA.
ACCESSION NM_001013398
VERSION NM_001013398.1 GI:62243247
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2638)
AUTHORS Tsilidis,K.K., Travis,R.C., Appleby,P.N., Allen,N.E., Lindstrom,S.,
Albanes,D., Ziegler,R.G., McCullough,M.L., Siddiq,A.,
Barricarte,A., Berndt,S.I., Bueno-de-Mesquita,H.B., Chanock,S.J.,
Crawford,E.D., Diver,W.R., Gapstur,S.M., Giovannucci,E., Gu,F.,
Haiman,C.A., Hayes,R.B., Hunter,D.J., Johansson,M., Kaaks,R.,
Kolonel,L.N., Kraft,P., Le Marchand,L., Overvad,K., Polidoro,S.,
Riboli,E., Schumacher,F.R., Stevens,V.L., Trichopoulos,D.,
Virtamo,J., Willett,W.C. and Key,T.J.
TITLE Insulin-like growth factor pathway genes and blood concentrations,
dietary protein and risk of prostate cancer in the NCI Breast and
Prostate Cancer Cohort Consortium (BPC3)
JOURNAL Int. J. Cancer 133 (2), 495-504 (2013)
PUBMED 23341348
REMARK GeneRIF: analysis of 16 IGF pathway SNPs, including IGF-1 and
IGFBP-3, reveals that prostate cancer risk varies by intakes of
dietary protein
REFERENCE 2 (bases 1 to 2638)
AUTHORS Suh,Y.A., Kim,J.H., Sung,M.A., Boo,H.J., Yun,H.J., Lee,S.H.,
Lee,H.J., Min,H.Y., Suh,Y.G., Kim,K.W. and Lee,H.Y.
TITLE A novel antitumor activity of deguelin targeting the insulin-like
growth factor (IGF) receptor pathway via up-regulation of
IGF-binding protein-3 expression in breast cancer
JOURNAL Cancer Lett. 332 (1), 102-109 (2013)
PUBMED 23348700
REMARK GeneRIF: Deguelin suppresses the growth of breast cancer cells via
its impact on the expression of IGFBP3.
REFERENCE 3 (bases 1 to 2638)
CONSRTM GENDEP Investigators; MARS Investigators; STAR*D Investigators
TITLE Common genetic variation and antidepressant efficacy in major
depressive disorder: a meta-analysis of three genome-wide
pharmacogenetic studies
JOURNAL Am J Psychiatry 170 (2), 207-217 (2013)
PUBMED 23377640
REFERENCE 4 (bases 1 to 2638)
AUTHORS Wu,C., Liu,X., Wang,Y., Tian,H., Xie,Y., Li,Q., Zhang,X. and Liu,F.
TITLE Insulin-like factor binding protein-3 promotes the G1 cell cycle
arrest in several cancer cell lines
JOURNAL Gene 512 (1), 127-133 (2013)
PUBMED 23041555
REMARK GeneRIF: Insulin-like factor binding protein-3 promotes the G1 cell
cycle arrest in several cancer cell lines
REFERENCE 5 (bases 1 to 2638)
AUTHORS Safarinejad,M.R., Shafiei,N. and Safarinejad,S.
TITLE The influence of promoter -202 A/C polymorphism (rs2854744) of the
IGFBP-3 gene on erectile dysfunction risk and serum levels of IGF-I
and IGFBP-3
JOURNAL J. Urol. 189 (1), 374-379 (2013)
PUBMED 23174226
REMARK GeneRIF: The IGFBP-3 gene A-202C polymorphism does not modulate the
risk of erectile dysfunction
REFERENCE 6 (bases 1 to 2638)
AUTHORS Gargosky,S.E., Pham,H.M., Wilson,K.F., Liu,F., Giudice,L.C. and
Rosenfeld,R.G.
TITLE Measurement and characterization of insulin-like growth factor
binding protein-3 in human biological fluids: discrepancies between
radioimmunoassay and ligand blotting
JOURNAL Endocrinology 131 (6), 3051-3060 (1992)
PUBMED 1280211
REFERENCE 7 (bases 1 to 2638)
AUTHORS Takahashi,T., Monica-Masuda,L., Ito,S., Katsumoto,T., Ishibashi,Y.
and Onodera,K.
TITLE Biochemical study of cells cultured from a patient with tuberous
sclerosis
JOURNAL J. Dermatol. 19 (11), 909-913 (1992)
PUBMED 1293182
REFERENCE 8 (bases 1 to 2638)
AUTHORS Cohen,P., Graves,H.C., Peehl,D.M., Kamarei,M., Giudice,L.C. and
Rosenfeld,R.G.
TITLE Prostate-specific antigen (PSA) is an insulin-like growth factor
binding protein-3 protease found in seminal plasma
JOURNAL J. Clin. Endocrinol. Metab. 75 (4), 1046-1053 (1992)
PUBMED 1383255
REFERENCE 9 (bases 1 to 2638)
AUTHORS Ehrenborg,E., Larsson,C., Stern,I., Janson,M., Powell,D.R. and
Luthman,H.
TITLE Contiguous localization of the genes encoding human insulin-like
growth factor binding proteins 1 (IGBP1) and 3 (IGBP3) on
chromosome 7
JOURNAL Genomics 12 (3), 497-502 (1992)
PUBMED 1373120
REFERENCE 10 (bases 1 to 2638)
AUTHORS Cubbage,M.L., Suwanichkul,A. and Powell,D.R.
TITLE Insulin-like growth factor binding protein-3. Organization of the
human chromosomal gene and demonstration of promoter activity
JOURNAL J. Biol. Chem. 265 (21), 12642-12649 (1990)
PUBMED 1695633
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from X64875.1, BC064987.1,
AL540642.3, AC091524.4 and AI142967.1.
This sequence is a reference standard in the RefSeqGene project.
Summary: This gene is a member of the insulin-like growth factor
binding protein (IGFBP) family and encodes a protein with an IGFBP
domain and a thyroglobulin type-I domain. The protein forms a
ternary complex with insulin-like growth factor acid-labile subunit
(IGFALS) and either insulin-like growth factor (IGF) I or II. In
this form, it circulates in the plasma, prolonging the half-life of
IGFs and altering their interaction with cell surface receptors.
Alternate transcriptional splice variants, encoding different
isoforms, have been characterized. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer
transcript and encodes the longer isoform (a).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AL553452.3, BP337005.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025084, ERS025098 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-225 X64875.1 1-225
226-228 BC064987.1 210-212
229-429 X64875.1 229-429
430-568 AL540642.3 403-541
569-1670 BC064987.1 535-1636
1671-2500 AC091524.4 31333-32162 c
2501-2638 AI142967.1 1-138 c
FEATURES Location/Qualifiers
source 1..2638
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="7"
/map="7p13-p12"
gene 1..2638
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/note="insulin-like growth factor binding protein 3"
/db_xref="GeneID:3486"
/db_xref="HGNC:5472"
/db_xref="HPRD:00899"
/db_xref="MIM:146732"
exon 1..553
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="alignment:Splign:1.39.8"
variation 86
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="c"
/db_xref="dbSNP:35925180"
CDS 133..1026
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/note="isoform a precursor is encoded by transcript
variant 1; IGF-binding protein 3; growth hormone-dependent
binding protein; acid stable subunit of the 140 K IGF
complex; binding protein 53; binding protein 29; IBP-3;
IGFBP-3"
/codon_start=1
/product="insulin-like growth factor-binding protein 3
isoform a precursor"
/protein_id="NP_001013416.1"
/db_xref="GI:62243248"
/db_xref="CCDS:CCDS34632.1"
/db_xref="GeneID:3486"
/db_xref="HGNC:5472"
/db_xref="HPRD:00899"
/db_xref="MIM:146732"
/translation="
MQRARPTLWAAALTLLVLLRGPPVARAGASSAGLGPVVRCEPCDARALAQCAPPPAVCAELVREPGCGCCLTCALSEGQPCGIYTERCGSGLRCQPSPDEARPLQALLDGRGLCVNASAVSRLRAYLLPAPPAPGEPPAPGNASESEEDRSAGSVESPSVSSTHRVSDPKFHPLHSKIIIIKKGHAKDSQRYKVDYESQSTDTQNFSSESKRETEYGPCRREMEDTLNHLKFLNVLSPRGVHIPNCDKKGFYKKKQCRPSKGRKRGFCWCVDKYGQPLPGYTTKGKEDVHCYSMQSK
"
sig_peptide 133..213
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 211..213
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 211..213
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01488"
mat_peptide 214..1023
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/product="insulin-like growth factor-binding protein 3
isoform a"
misc_feature 244..477
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/note="Insulin growth factor-binding protein homologues;
Region: IB; smart00121"
/db_xref="CDD:197525"
misc_feature 478..480
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 496..498
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 499..501
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00384"
misc_feature 499..501
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00386"
misc_feature 502..504
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 502..504
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01461"
misc_feature 502..504
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01488"
misc_feature 508..510
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00291"
misc_feature 508..510
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00384"
misc_feature 508..510
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00386"
misc_feature 508..510
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01703"
misc_feature 556..558
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 556..558
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01703"
misc_feature 562..564
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 568..570
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 625..627
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01461"
misc_feature 652..654
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00384"
misc_feature 652..654
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00386"
misc_feature 655..657
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00289"
misc_feature 655..657
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 661..663
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00293"
misc_feature 676..678
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
misc_feature 679..681
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
misc_feature 691..693
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
misc_feature 703..705
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 706..708
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01461"
misc_feature 709..711
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00291"
misc_feature 709..711
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 721..723
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00291"
misc_feature 745..747
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 748..750
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01461"
misc_feature 757..759
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01703"
misc_feature 766..768
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01461"
misc_feature 784..993
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/note="Thyroglobulin type I repeats.; The N-terminal
region of human thyroglobulin contains 11 type-1 repeats
TY repeats are proposed to be inhibitors of cysteine
proteases; Region: TY; cd00191"
/db_xref="CDD:29153"
misc_feature order(799..801,853..855,907..909,931..933)
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/note="protease interaction site; other site"
/db_xref="CDD:29153"
misc_feature 823..825
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 832..834
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00291"
misc_feature 838..840
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00289"
misc_feature 847..849
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01488"
misc_feature 889..891
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
variation 141
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:34239916"
variation 227
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="c"
/replace="g"
/db_xref="dbSNP:2854746"
variation 298
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:34257987"
exon 554..780
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="alignment:Splign:1.39.8"
variation 623
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="c"
/db_xref="dbSNP:9282734"
STS 696..883
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="D7S2146E"
/db_xref="UniSTS:151142"
STS 736..955
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="Igfbp3"
/db_xref="UniSTS:143488"
exon 781..900
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="alignment:Splign:1.39.8"
variation 850
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:35712717"
exon 901..1041
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="alignment:Splign:1.39.8"
variation 905
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:17847676"
variation 935..980
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="c"
/replace="t"
/db_xref="dbSNP:45490491"
exon 1042..2631
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="alignment:Splign:1.39.8"
STS 1088..1432
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="D7S2833"
/db_xref="UniSTS:14552"
variation 1190
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:35704214"
STS 1193..2008
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="IGFBP3_1859"
/db_xref="UniSTS:280776"
variation 1353
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:45599232"
variation 1420
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="c"
/replace="t"
/db_xref="dbSNP:11537920"
STS 1437..2082
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="IGFBP3-X4.4"
/db_xref="UniSTS:255348"
variation 1473
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:9911"
variation 1627
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="g"
/replace="t"
/db_xref="dbSNP:11537917"
variation 1785
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:35751739"
variation 1786
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:34735423"
variation 1798
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace=""
/replace="a"
/db_xref="dbSNP:35496550"
STS 1966..2571
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="IGFBP3-X4.5"
/db_xref="UniSTS:255349"
variation 2000
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="t"
/db_xref="dbSNP:11537919"
variation 2221
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="t"
/db_xref="dbSNP:6670"
STS 2233..2408
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="D7S2379"
/db_xref="UniSTS:73386"
variation 2305
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="c"
/replace="t"
/db_xref="dbSNP:1050566"
STS 2354..2566
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="STS-M35878"
/db_xref="UniSTS:72873"
polyA_signal 2500..2505
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
polyA_site 2517
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
polyA_site 2526
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
variation 2589
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace=""
/replace="taataattattttattata"
/db_xref="dbSNP:34663167"
polyA_signal 2607..2612
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
polyA_site 2630
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
ORIGIN
agatgcgagcactgcggctgggcgctgaggatcagccgcttcctgcctggattccacagcttcgcgccgtgtactgtcgccccatccctgcgcgcccagcctgccaagcagcgtgccccggttgcaggcgtcatgcagcgggcgcgacccacgctctgggccgctgcgctgactctgctggtgctgctccgcgggccgccggtggcgcgggctggcgcgagctcggcgggcttgggtcccgtggtgcgctgcgagccgtgcgacgcgcgtgcactggcccagtgcgcgcctccgcccgccgtgtgcgcggagctggtgcgcgagccgggctgcggctgctgcctgacgtgcgcactgagcgagggccagccgtgcggcatctacaccgagcgctgtggctccggccttcgctgccagccgtcgcccgacgaggcgcgaccgctgcaggcgctgctggacggccgcgggctctgcgtcaacgctagtgccgtcagccgcctgcgcgcctacctgctgccagcgccgccagctccaggtgagccgcccgcgccaggaaatgctagtgagtcggaggaagaccgcagcgccggcagtgtggagagcccgtccgtctccagcacgcaccgggtgtctgatcccaagttccaccccctccattcaaagataatcatcatcaagaaagggcatgctaaagacagccagcgctacaaagttgactacgagtctcagagcacagatacccagaacttctcctccgagtccaagcgggagacagaatatggtccctgccgtagagaaatggaagacacactgaatcacctgaagttcctcaatgtgctgagtcccaggggtgtacacattcccaactgtgacaagaagggattttataagaaaaagcagtgtcgcccttccaaaggcaggaagcggggcttctgctggtgtgtggataagtatgggcagcctctcccaggctacaccaccaaggggaaggaggacgtgcactgctacagcatgcagagcaagtagacgcctgccgcaaggttaatgtggagctcaaatatgccttattttgcacaaaagactgccaaggacatgaccagcagctggctacagcctcgatttatatttctgtttgtggtgaactgattttttttaaaccaaagtttagaaagaggtttttgaaatgcctatggtttctttgaatggtaaacttgagcatcttttcactttccagtagtcagcaaagagcagtttgaattttcttgtcgcttcctatcaaaatattcagagactcgagcacagcacccagacttcatgcgcccgtggaatgctcaccacatgttggtcgaagcggccgaccactgactttgtgacttaggcggctgtgttgcctatgtagagaacacgcttcacccccactccccgtacagtgcgcacaggctttatcgagaataggaaaacctttaaaccccggtcatccggacatcccaacgcatgctcctggagctcacagccttctgtggtgtcatttctgaaacaagggcgtggatccctcaaccaagaagaatgtttatgtcttcaagtgacctgtactgcttggggactattggagaaaataaggtggagtcctacttgtttaaaaaatatgtatctaagaatgttctagggcactctgggaacctataaaggcaggtatttcgggccctcctcttcaggaatcttcctgaagacatggcccagtcgaaggcccaggatggcttttgctgcggccccgtggggtaggagggacagagagacagggagagtcagcctccacattcagaggcatcacaagtaatggcacaattcttcggatgactgcagaaaatagtgttttgtagttcaacaactcaagacgaagcttatttctgaggataagctctttaaaggcaaagctttattttcatctctcatcttttgtcctccttagcacaatgtaaaaaagaatagtaatatcagaacaggaaggaggaatggcttgctggggagcccatccaggacactgggagcacatagagattcacccatgtttgttgaacttagagtcattctcatgcttttctttataattcacacatatatgcagagaagatatgttcttgttaacattgtatacaacatagccccaaatatagtaagatctatactagataatcctagatgaaatgttagagatgctatatgatacaactgtggccatgactgaggaaaggagctcacgcccagagactgggctgctctcccggaggccaaacccaagaaggtctggcaaagtcaggctcagggagactctgccctgctgcagacctcggtgtggacacacgctgcatagagctctccttgaaaacagaggggtctcaagacattctgcctacctattagcttttctttatttttttaactttttggggggaaaagtatttttgagaagtttgtcttgcaatgtatttataaatagtaaataaagtttttaccattaaaaaaatatctttccctttgttattgaccatctctgggctttgtatcactaattattttattttattatataataattattttattataataaaatcctgaaaggggaaaataaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:3486 -> Molecular function: GO:0001968 [fibronectin binding] evidence: IEA
GeneID:3486 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:3486 -> Molecular function: GO:0005520 [insulin-like growth factor binding] evidence: NAS
GeneID:3486 -> Molecular function: GO:0008160 [protein tyrosine phosphatase activator activity] evidence: IDA
GeneID:3486 -> Molecular function: GO:0031994 [insulin-like growth factor I binding] evidence: IPI
GeneID:3486 -> Molecular function: GO:0046872 [metal ion binding] evidence: NAS
GeneID:3486 -> Biological process: GO:0001558 [regulation of cell growth] evidence: IEA
GeneID:3486 -> Biological process: GO:0001933 [negative regulation of protein phosphorylation] evidence: IDA
GeneID:3486 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:3486 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:3486 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IGI
GeneID:3486 -> Biological process: GO:0009968 [negative regulation of signal transduction] evidence: NAS
GeneID:3486 -> Biological process: GO:0010906 [regulation of glucose metabolic process] evidence: IEA
GeneID:3486 -> Biological process: GO:0014912 [negative regulation of smooth muscle cell migration] evidence: IDA
GeneID:3486 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IMP
GeneID:3486 -> Biological process: GO:0043410 [positive regulation of MAPK cascade] evidence: IEA
GeneID:3486 -> Biological process: GO:0043568 [positive regulation of insulin-like growth factor receptor signaling pathway] evidence: IEA
GeneID:3486 -> Biological process: GO:0044267 [cellular protein metabolic process] evidence: TAS
GeneID:3486 -> Biological process: GO:0044342 [type B pancreatic cell proliferation] evidence: IEA
GeneID:3486 -> Biological process: GO:0045663 [positive regulation of myoblast differentiation] evidence: IDA
GeneID:3486 -> Biological process: GO:0048662 [negative regulation of smooth muscle cell proliferation] evidence: IDA
GeneID:3486 -> Cellular component: GO:0005576 [extracellular region] evidence: NAS
GeneID:3486 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
GeneID:3486 -> Cellular component: GO:0005615 [extracellular space] evidence: IDA
GeneID:3486 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:3486 -> Cellular component: GO:0016942 [insulin-like growth factor binding protein complex] evidence: IC
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.