Home |
Help |
Advanced search
2024-04-19 19:40:04, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001012398 2222 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens AKT interacting protein (AKTIP), transcript variant 1,
mRNA.
ACCESSION NM_001012398
VERSION NM_001012398.1 GI:61743932
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2222)
AUTHORS Anandharaj,A., Cinghu,S., Kim,W.D., Yu,J.R. and Park,W.Y.
TITLE Fused Toes Homolog modulates radiation cytotoxicity in uterine
cervical cancer cells
JOURNAL Mol. Biol. Rep. 38 (8), 5361-5370 (2011)
PUBMED 21424602
REMARK GeneRIF: Targeted inhibition of FTS led to the shutdown of key
elemental characteristics of cervical cancer and could lead to an
effective therapeutic strategy.
REFERENCE 2 (bases 1 to 2222)
AUTHORS Cinghu,S., Anandharaj,A., Lee,H.C., Yu,J.R. and Park,W.Y.
TITLE FTS (fused toes homolog) a novel oncoprotein involved in uterine
cervical carcinogenesis and a potential diagnostic marker for
cervical cancer
JOURNAL J. Cell. Physiol. 226 (6), 1564-1572 (2011)
PUBMED 20945372
REMARK GeneRIF: These data unraveled the involvement of new oncoprotein
FTS in cervical cancer which plays a central role in
carcinogenesis.
REFERENCE 3 (bases 1 to 2222)
AUTHORS Notaridou,M., Quaye,L., Dafou,D., Jones,C., Song,H., Hogdall,E.,
Kjaer,S.K., Christensen,L., Hogdall,C., Blaakaer,J., McGuire,V.,
Wu,A.H., Van Den Berg,D.J., Pike,M.C., Gentry-Maharaj,A.,
Wozniak,E., Sher,T., Jacobs,I.J., Tyrer,J., Schildkraut,J.M.,
Moorman,P.G., Iversen,E.S., Jakubowska,A., Medrek,K., Lubinski,J.,
Ness,R.B., Moysich,K.B., Lurie,G., Wilkens,L.R., Carney,M.E.,
Wang-Gohrke,S., Doherty,J.A., Rossing,M.A., Beckmann,M.W.,
Thiel,F.C., Ekici,A.B., Chen,X., Beesley,J., Gronwald,J.,
Fasching,P.A., Chang-Claude,J., Goodman,M.T., Chenevix-Trench,G.,
Berchuck,A., Pearce,C.L., Whittemore,A.S., Menon,U., Pharoah,P.D.,
Gayther,S.A. and Ramus,S.J.
CONSRTM Australian Ovarian Cancer Study Group/Australian Cancer Study
(Ovarian Cancer); Ovarian Cancer Association Consortium
TITLE Common alleles in candidate susceptibility genes associated with
risk and development of epithelial ovarian cancer
JOURNAL Int. J. Cancer 128 (9), 2063-2074 (2011)
PUBMED 20635389
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 4 (bases 1 to 2222)
AUTHORS Magno,L.A., Miranda,D.M., Neves,F.S., Pimenta,G.J., Mello,M.P., De
Marco,L.A., Correa,H. and Romano-Silva,M.A.
TITLE Association between AKT1 but not AKTIP genetic variants and
increased risk for suicidal behavior in bipolar patients
JOURNAL Genes Brain Behav. 9 (4), 411-418 (2010)
PUBMED 20132317
REMARK GeneRIF: Demographic and clinical characteristics and AKT1 single
markers and haplotypes, but not AKTIP polymorphisms or interactions
between AKT1 and AKTIP, are associated with increased risk for
suicidal behavior in bipolar patients.
REFERENCE 5 (bases 1 to 2222)
AUTHORS Quaye,L., Dafou,D., Ramus,S.J., Song,H., Gentry-Maharaj,A.,
Notaridou,M., Hogdall,E., Kjaer,S.K., Christensen,L., Hogdall,C.,
Easton,D.F., Jacobs,I., Menon,U., Pharoah,P.D. and Gayther,S.A.
TITLE Functional complementation studies identify candidate genes and
common genetic variants associated with ovarian cancer survival
JOURNAL Hum. Mol. Genet. 18 (10), 1869-1878 (2009)
PUBMED 19270026
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
Erratum:[Hum Mol Genet. 2009 Aug 1;18(15):2928. Maharaj, Aleksandra
Gentry [corrected to Gentry-Maharaj, Aleksandra]]
REFERENCE 6 (bases 1 to 2222)
AUTHORS Stelzl,U., Worm,U., Lalowski,M., Haenig,C., Brembeck,F.H.,
Goehler,H., Stroedicke,M., Zenkner,M., Schoenherr,A., Koeppen,S.,
Timm,J., Mintzlaff,S., Abraham,C., Bock,N., Kietzmann,S.,
Goedde,A., Toksoz,E., Droege,A., Krobitsch,S., Korn,B.,
Birchmeier,W., Lehrach,H. and Wanker,E.E.
TITLE A human protein-protein interaction network: a resource for
annotating the proteome
JOURNAL Cell 122 (6), 957-968 (2005)
PUBMED 16169070
REFERENCE 7 (bases 1 to 2222)
AUTHORS Remy,I. and Michnick,S.W.
TITLE Regulation of apoptosis by the Ft1 protein, a new modulator of
protein kinase B/Akt
JOURNAL Mol. Cell. Biol. 24 (4), 1493-1504 (2004)
PUBMED 14749367
REMARK GeneRIF: Ft1 protein interacts directly with PKB, enhancing the
phosphorylation of both of its regulatory sites by promoting its
interaction with the upstream kinase PDK1
REFERENCE 8 (bases 1 to 2222)
AUTHORS Lesche,R. and Ruther,U.
TITLE Close linkage of p130 and Ft1 is conserved among mammals
JOURNAL Mamm. Genome 9 (3), 253-255 (1998)
PUBMED 9501314
REFERENCE 9 (bases 1 to 2222)
AUTHORS Lesche,R., Peetz,A., van der Hoeven,F. and Ruther,U.
TITLE Ft1, a novel gene related to ubiquitin-conjugating enzymes, is
deleted in the Fused toes mouse mutation
JOURNAL Mamm. Genome 8 (12), 879-883 (1997)
PUBMED 9383278
REFERENCE 10 (bases 1 to 2222)
AUTHORS Aiyar,N., Rand,K., Elshourbagy,N.A., Zeng,Z., Adamou,J.E.,
Bergsma,D.J. and Li,Y.
TITLE A cDNA encoding the calcitonin gene-related peptide type 1 receptor
JOURNAL J. Biol. Chem. 271 (19), 11325-11329 (1996)
PUBMED 8626685
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BI545474.1, BC001134.2,
AC007342.6 and BG568989.1.
Summary: The mouse homolog of this gene produces fused toes and
thymic hyperplasia in heterozygous mutant animals while homozygous
mutants die in early development. This gene may play a role in
apoptosis as these morphological abnormalities are caused by
altered patterns of programmed cell death. The protein encoded by
this gene is similar to the ubiquitin ligase domain of other
ubiquitin-conjugating enzymes but lacks the conserved cysteine
residue that enables those enzymes to conjugate ubiquitin to the
target protein. This protein interacts directly with
serine/threonine kinase protein kinase B (PKB)/Akt and modulates
PKB activity by enhancing the phosphorylation of PKB's regulatory
sites. Alternative splicing results in two transcript variants
encoding the same protein. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer
transcript. Variants 1 and 2 encode the same protein.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC001134.2 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025098 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-35 BI545474.1 14-48
36-1196 BC001134.2 1-1161
1197-2096 AC007342.6 27679-28578
2097-2222 BG568989.1 384-509
FEATURES Location/Qualifiers
source 1..2222
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="16"
/map="16q12.2"
gene 1..2222
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/note="AKT interacting protein"
/db_xref="GeneID:64400"
/db_xref="HGNC:16710"
/db_xref="MIM:608483"
exon 1..141
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/inference="alignment:Splign:1.39.8"
exon 142..253
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/inference="alignment:Splign:1.39.8"
misc_feature 185..187
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/note="upstream in-frame stop codon"
CDS 212..1090
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/note="fused toes protein homolog; fused toes homolog"
/codon_start=1
/product="AKT-interacting protein"
/protein_id="NP_001012398.1"
/db_xref="GI:61743933"
/db_xref="CCDS:CCDS10749.1"
/db_xref="GeneID:64400"
/db_xref="HGNC:16710"
/db_xref="MIM:608483"
/translation="
MNPFWSMSTSSVRKRSEGEEKTLTGDVKTSPPRTAPKKQLPSIPKNALPITKPTSPAPAAQSTNGTHASYGPFYLEYSLLAEFTLVVKQKLPGVYVQPSYRSALMWFGVIFIRHGLYQDGVFKFTVYIPDNYPDGDCPRLVFDIPVFHPLVDPTSGELDVKRAFAKWRRNHNHIWQVLMYARRVFYKIDTASPLNPEAAVLYEKDIQLFKSKVVDSVKVCTARLFDQPKIEDPYAISFSPWNPSVHDEAREKMLTQKKPEEQHNKSVHVAGLSWVKPGSVQPFSKEEKTVAT
"
misc_feature 446..877
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/note="Ubiquitin-conjugating enzyme E2, catalytic domain
homologues; Region: UBCc; smart00212"
/db_xref="CDD:197575"
misc_feature order(608..613,716..721)
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/note="E3 interaction residues; other site"
/db_xref="CDD:29157"
misc_feature order(644..649,659..664,668..670,683..685,689..694,
710..715,722..724,740..742,749..751,758..760,767..772,
776..778,782..787)
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/note="Ub thioester intermediate interaction residues;
other site"
/db_xref="CDD:29157"
exon 254..459
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/inference="alignment:Splign:1.39.8"
exon 460..524
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/inference="alignment:Splign:1.39.8"
exon 525..625
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/inference="alignment:Splign:1.39.8"
exon 626..714
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/inference="alignment:Splign:1.39.8"
exon 715..813
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/inference="alignment:Splign:1.39.8"
exon 814..921
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/inference="alignment:Splign:1.39.8"
exon 922..982
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/inference="alignment:Splign:1.39.8"
exon 983..2222
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/inference="alignment:Splign:1.39.8"
variation 1112
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2892438"
variation 1172
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/replace="g"
/replace="t"
/db_xref="dbSNP:3956281"
STS 1198..1340
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/standard_name="RH94082"
/db_xref="UniSTS:89039"
variation 1278
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/replace="g"
/replace="t"
/db_xref="dbSNP:4002162"
variation 1348..1351
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/replace=""
/replace="agta"
/db_xref="dbSNP:4002163"
STS 1543..1739
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/standard_name="RH75186"
/db_xref="UniSTS:84678"
polyA_signal 1779..1784
/gene="AKTIP"
/gene_synonym="FT1; FTS"
variation 1781
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/replace="g"
/replace="t"
/db_xref="dbSNP:4002164"
polyA_signal 1787..1792
/gene="AKTIP"
/gene_synonym="FT1; FTS"
polyA_site 1812
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/experiment="experimental evidence, no additional details
recorded"
polyA_signal 2099..2104
/gene="AKTIP"
/gene_synonym="FT1; FTS"
polyA_site 2119
/gene="AKTIP"
/gene_synonym="FT1; FTS"
/experiment="experimental evidence, no additional details
recorded"
ORIGIN
ggggtggggcggggcggggatcaagcaggggcagggctggcgctgcggcgggagatgctgtcgggccgcggcggcgcttggcagccaggagctctgcattgaaggcactggggtgaggcttactgcccggcaggctggtgggtaaagtgaatgccgaagacagaagatttggatgatacaccactgactttctttgtttggaatacacgttatgaaccctttctggagcatgtctacaagctctgtacgcaaacgatctgaaggtgaagagaagacattaacaggggacgtgaaaaccagtcctccacgaactgcaccaaagaaacagctgccttctattcccaaaaatgctttgcccataactaagcctacatctcctgccccagcagcacagtcaacaaatggcacgcatgcgtcctatggacccttctacctggaatactctcttcttgcagaatttaccttggttgtgaagcagaagctaccaggcgtctatgtgcagccatcttatcgctctgcattaatgtggtttggagtaatattcatacggcatggactttaccaagatggcgtatttaagtttacagtttacatccctgataactatccagatggtgactgtccacgcttggtgttcgatattcctgtctttcacccgctagttgatcccacctcaggtgagctggatgtgaagagagcatttgcaaaatggaggcggaaccataatcatatttggcaggtattaatgtatgcaaggagagttttctacaagattgatacagcaagccccctgaacccagaggctgcagtactgtatgaaaaagatattcagctttttaaaagtaaagttgttgacagtgttaaggtgtgcactgctcgtttgtttgaccaacctaaaatagaagacccctatgcaattagcttttctccatggaatccttctgtacatgatgaagccagagaaaagatgctgactcagaaaaagcctgaagaacagcacaataaaagtgttcatgttgctggcctgtcatgggtaaagcctggctcagtacagcctttcagtaaagaagagaaaacagtggcgacttaagagatggtgaatctggtgcaccatgcactttcctgctagactctggcctagttcaagctgaccaatggcagaggactgcctgaagagtaaaactgtgtgaacaatgactgactgccagtgttttccatgtatgcataggttctaacagcagggtttggaaacctgtctctaagtaatgcattacttctgtcagaagtgtcttagggtggttatctagttcagtactccaaattattggggaccttgaggcttaagtaagtatttttctgaatataatgctaaaggtaagttgcattcatttaaactaatagagcagacagaattcagcactacttaatagtttataaatcagtggtttcagttgtatatatgttaggaaatggagaggtatagagagagcaggttccatagctcagcacttttaagtggaagatcatttgaatctcagtcttcagcctgcactgatttgtagcctgcactgtcttactgatttacaaactgaaatcactgagaaatgtctttagttcagtgagaagaaaccagaacacttgttcctagtgttgtgttgttttttttaagcaaattacttactgtatttttatggcaggagggagaaaaagtgttacaacggtttctaatgaagtccggtatttaaatgataaatgactaatgtgtttagtagagacaaaataaaccaataaatgattgttctttgccatttatgcaggaaactacccttttctcaatataaccaaacaaaggctaatttataaatgctttattgaaaaatacacttatcttcatataaaattacagtagcagtatcttgagaagttttataaatatttttgcagaacactattctaattgaacaatgtaagttccatatttctctcagcaatatgaagttacctagtaactttgtttatactgattcaatttacaattgaattttctccctaataagattattaatttgacttgaaaactgctggaacaatagtgattaataaagatatgtatagataattcagctgttaaataacattttctaatttgtataaatggtactatggtactaataaaaacctaaattctccaaccaatttttttaaactgccaggaacaccca
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:64400 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:64400 -> Molecular function: GO:0019787 [small conjugating protein ligase activity] evidence: NAS
GeneID:64400 -> Biological process: GO:0001934 [positive regulation of protein phosphorylation] evidence: IDA
GeneID:64400 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:64400 -> Biological process: GO:0007032 [endosome organization] evidence: IMP
GeneID:64400 -> Biological process: GO:0007040 [lysosome organization] evidence: IMP
GeneID:64400 -> Biological process: GO:0008333 [endosome to lysosome transport] evidence: IMP
GeneID:64400 -> Biological process: GO:0015031 [protein transport] evidence: IEA
GeneID:64400 -> Biological process: GO:0032092 [positive regulation of protein binding] evidence: IDA
GeneID:64400 -> Biological process: GO:0045022 [early endosome to late endosome transport] evidence: IMP
GeneID:64400 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:64400 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:64400 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA
GeneID:64400 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:64400 -> Cellular component: GO:0030897 [HOPS complex] evidence: IDA
GeneID:64400 -> Cellular component: GO:0070695 [FHF complex] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.