GGRNA Home | Help | Advanced search

2024-04-25 18:51:48, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001006665            3112 bp    mRNA    linear   PRI 16-JUN-2013
DEFINITION  Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 1
            (RPS6KA1), transcript variant 2, mRNA.
ACCESSION   NM_001006665
VERSION     NM_001006665.1  GI:55743133
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3112)
  AUTHORS   Zhang,X., Lavoie,G., Fort,L., Huttlin,E.L., Tcherkezian,J.,
            Galan,J.A., Gu,H., Gygi,S.P., Carreno,S. and Roux,P.P.
  TITLE     Gab2 phosphorylation by RSK inhibits Shp2 recruitment and cell
            motility
  JOURNAL   Mol. Cell. Biol. 33 (8), 1657-1670 (2013)
   PUBMED   23401857
  REMARK    GeneRIF: results indicate that RSK directly phosphorylates Gab2 on
            3 serine residues; findings show RSK-mediated Gab2 phosphorylation
            inhibits Shp2 recruitment, suggesting RSK mediates a
            negative-feedback loop that attenuates Gab2-dependent functions
            including cell motility
REFERENCE   2  (bases 1 to 3112)
  AUTHORS   Park,Y.S. and Cho,N.J.
  TITLE     EGFR and PKC are involved in the activation of ERK1/2 and p90 RSK
            and the subsequent proliferation of SNU-407 colon cancer cells by
            muscarinic acetylcholine receptors
  JOURNAL   Mol. Cell. Biochem. 370 (1-2), 191-198 (2012)
   PUBMED   22865467
  REMARK    GeneRIF: These data indicate that EGFR and PKC are involved in
            mAChR-mediated activation of ERK1/2 and RSK and the subsequent
            proliferation of SNU-407 colon cancer cells.
REFERENCE   3  (bases 1 to 3112)
  AUTHORS   Stratford,A.L., Reipas,K., Hu,K., Fotovati,A., Brough,R.,
            Frankum,J., Takhar,M., Watson,P., Ashworth,A., Lord,C.J.,
            Lasham,A., Print,C.G. and Dunn,S.E.
  TITLE     Targeting p90 ribosomal S6 kinase eliminates tumor-initiating cells
            by inactivating Y-box binding protein-1 in triple-negative breast
            cancers
  JOURNAL   Stem Cells 30 (7), 1338-1348 (2012)
   PUBMED   22674792
  REMARK    GeneRIF: Targeting p90 ribosomal S6 kinase eliminates
            tumor-initiating cells by inactivating Y-box binding protein-1 in
            triple-negative breast cancers.
REFERENCE   4  (bases 1 to 3112)
  AUTHORS   Li,D., Fu,T.M., Nan,J., Liu,C., Li,L.F. and Su,X.D.
  TITLE     Structural basis for the autoinhibition of the C-terminal kinase
            domain of human RSK1
  JOURNAL   Acta Crystallogr. D Biol. Crystallogr. 68 (PT 6), 680-685 (2012)
   PUBMED   22683790
  REMARK    GeneRIF: structure indicates that activation of RSK1 involves the
            removal of alpha-helix from the substrate-binding groove induced by
            ERK1/2 phosphorylation
REFERENCE   5  (bases 1 to 3112)
  AUTHORS   Li,R., Chen,D.F., Zhou,R., Jia,S.N., Yang,J.S., Clegg,J.S. and
            Yang,W.J.
  TITLE     Involvement of polo-like kinase 1 (Plk1) in mitotic arrest by
            inhibition of mitogen-activated protein kinase-extracellular
            signal-regulated kinase-ribosomal S6 kinase 1 (MEK-ERK-RSK1)
            cascade
  JOURNAL   J. Biol. Chem. 287 (19), 15923-15934 (2012)
   PUBMED   22427657
  REMARK    GeneRIF: Data indicate that Plk1 siRNA interference and
            overexpression increased phosphorylation of RSK1, suggesting that
            Plk1 inhibits RSK1.
REFERENCE   6  (bases 1 to 3112)
  AUTHORS   Moller,D.E., Xia,C.H., Tang,W., Zhu,A.X. and Jakubowski,M.
  TITLE     Human rsk isoforms: cloning and characterization of tissue-specific
            expression
  JOURNAL   Am. J. Physiol. 266 (2 PT 1), C351-C359 (1994)
   PUBMED   8141249
REFERENCE   7  (bases 1 to 3112)
  AUTHORS   Chen,R.H., Abate,C. and Blenis,J.
  TITLE     Phosphorylation of the c-Fos transrepression domain by
            mitogen-activated protein kinase and 90-kDa ribosomal S6 kinase
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 90 (23), 10952-10956 (1993)
   PUBMED   8248197
REFERENCE   8  (bases 1 to 3112)
  AUTHORS   Rivera,V.M., Miranti,C.K., Misra,R.P., Ginty,D.D., Chen,R.H.,
            Blenis,J. and Greenberg,M.E.
  TITLE     A growth factor-induced kinase phosphorylates the serum response
            factor at a site that regulates its DNA-binding activity
  JOURNAL   Mol. Cell. Biol. 13 (10), 6260-6273 (1993)
   PUBMED   8413226
REFERENCE   9  (bases 1 to 3112)
  AUTHORS   Tratner,I., Ofir,R. and Verma,I.M.
  TITLE     Alteration of a cyclic AMP-dependent protein kinase phosphorylation
            site in the c-Fos protein augments its transforming potential
  JOURNAL   Mol. Cell. Biol. 12 (3), 998-1006 (1992)
   PUBMED   1545828
REFERENCE   10 (bases 1 to 3112)
  AUTHORS   Chen,R.H., Sarnecki,C. and Blenis,J.
  TITLE     Nuclear localization and regulation of erk- and rsk-encoded protein
            kinases
  JOURNAL   Mol. Cell. Biol. 12 (3), 915-927 (1992)
   PUBMED   1545823
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK092955.1, BC014966.1 and
            L07597.1.
            
            Summary: This gene encodes a member of the RSK (ribosomal S6
            kinase) family of serine/threonine kinases. This kinase contains 2
            nonidentical kinase catalytic domains and phosphorylates various
            substrates, including members of the mitogen-activated kinase
            (MAPK) signalling pathway. The activity of this protein has been
            implicated in controlling cell growth and differentiation.
            Alternate transcriptional splice variants, encoding different
            isoforms, have been characterized. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (2) differs in the 5' UTR and 5'
            end of the coding region, compared to variant 1. These differences
            cause translation initiation at an in-frame ATG of an alternate
            exon and an isoform (b) with a distinct N-terminus compared to
            isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK292722.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-544               AK092955.1         11-554
            545-547             AK092955.1         634-636
            548-2325            BC014966.1         628-2405
            2326-2328           L07597.1           2296-2298
            2329-2680           BC014966.1         2409-2760
            2681-2683           L07597.1           2645-2647
            2684-3108           BC014966.1         2764-3188
            3109-3112           AK092955.1         3198-3201
FEATURES             Location/Qualifiers
     source          1..3112
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p"
     gene            1..3112
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="ribosomal protein S6 kinase, 90kDa, polypeptide 1"
                     /db_xref="GeneID:6195"
                     /db_xref="HGNC:10430"
                     /db_xref="MIM:601684"
     exon            1..184
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       4
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:71640330"
     variation       5
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201434625"
     variation       39..40
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35840157"
     CDS             50..2284
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /EC_number="2.7.11.1"
                     /note="isoform b is encoded by transcript variant 2;
                     ribosomal protein S6 kinase alpha 1; p90-RSK 1; ribosomal
                     protein S6 kinase alpha-1; S6K-alpha 1; dJ590P13.1
                     (ribosomal protein S6 kinase, 90kD, polypeptide 1); RSK-1;
                     p90S6K; p90RSK1; MAPKAPK-1a; S6K-alpha-1; MAPKAP kinase
                     1a; ribosomal S6 kinase 1; MAPK-activated protein kinase
                     1a; 90 kDa ribosomal protein S6 kinase 1; MAP
                     kinase-activated protein kinase 1a"
                     /codon_start=1
                     /product="ribosomal protein S6 kinase alpha-1 isoform b"
                     /protein_id="NP_001006666.1"
                     /db_xref="GI:55743134"
                     /db_xref="CCDS:CCDS30649.1"
                     /db_xref="GeneID:6195"
                     /db_xref="HGNC:10430"
                     /db_xref="MIM:601684"
                     /translation="
MEQDPKPPRLRLWALIPWLPRKQRPRISQTSLPVPGPGSGPQRDSDEGVLKEISITHHVKAGSEKADPSHFELLKVLGQGSFGKVFLVRKVTRPDSGHLYAMKVLKKATLKVRDRVRTKMERDILADVNHPFVVKLHYAFQTEGKLYLILDFLRGGDLFTRLSKEVMFTEEDVKFYLAELALGLDHLHSLGIIYRDLKPENILLDEEGHIKLTDFGLSKEAIDHEKKAYSFCGTVEYMAPEVVNRQGHSHSADWWSYGVLMFEMLTGSLPFQGKDRKETMTLILKAKLGMPQFLSTEAQSLLRALFKRNPANRLGSGPDGAEEIKRHVFYSTIDWNKLYRREIKPPFKPAVAQPDDTFYFDTEFTSRTPKDSPGIPPSAGAHQLFRGFSFVATGLMEDDGKPRAPQAPLHSVVQQLHGKNLVFSDGYVVKETIGVGSYSECKRCVHKATNMEYAVKVIDKSKRDPSEEIEILLRYGQHPNIITLKDVYDDGKHVYLVTELMRGGELLDKILRQKFFSEREASFVLHTIGKTVEYLHSQGVVHRDLKPSNILYVDESGNPECLRICDFGFAKQLRAENGLLMTPCYTANFVAPEVLKRQGYDEGCDIWSLGILLYTMLAGYTPFANGPSDTPEEILTRIGSGKFTLSGGNWNTVSETAKDLVSKMLHVDPHQRLTAKQVLQHPWVTQKDKLPQSQLSHQDLQLVKGAMAATYSALNSSKPTPQLKPIESSILAQRRVRKLPSTTL
"
     misc_feature    260..1036
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    269..1222
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="N-terminal catalytic domain of the Protein
                     Serine/Threonine Kinase, 90 kDa ribosomal protein S6
                     kinase; Region: STKc_RSK_N; cd05582"
                     /db_xref="CDD:173673"
     misc_feature    order(278..292,302..304,350..352,356..358,449..451,
                     497..502,506..508,518..520,524..526,635..637,641..643,
                     647..652,656..658,686..691,698..700,740..757,836..838,
                     854..856,863..865)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="active site"
                     /db_xref="CDD:173673"
     misc_feature    order(278..292,302..304,350..352,356..358,449..451,
                     500..508,518..520,635..637,641..643,647..652,656..658,
                     686..691)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173673"
     misc_feature    order(290..292,518..520,524..526,635..637,641..643,
                     647..649,698..700,740..757,836..838,854..856,863..865)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173673"
     misc_feature    536..538
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    order(686..721,725..757)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173673"
     misc_feature    737..739
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:05556"
     misc_feature    749..751
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03402"
     misc_feature    749..751
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1151..1153
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01496"
     misc_feature    1163..1165
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="turn motif phosphorylation site [posttranslational
                     modification]; other site"
                     /db_xref="CDD:173673"
     misc_feature    1163..1165
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01496"
     misc_feature    1202..1219
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="hydrophobic motif (HM); other site"
                     /db_xref="CDD:173673"
     misc_feature    1214..1216
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03402"
     misc_feature    1328..2101
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    1346..2098
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl09925"
                     /db_xref="CDD:213116"
     misc_feature    order(1346..1360,1370..1372,1409..1411,1415..1417,
                     1493..1495,1541..1552,1562..1564,1568..1570,1679..1681,
                     1685..1687,1691..1696,1700..1702,1745..1747,1754..1756,
                     1802..1813)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="active site"
                     /db_xref="CDD:173623"
     misc_feature    order(1346..1360,1370..1372,1409..1411,1415..1417,
                     1493..1495,1541..1552,1562..1564,1679..1681,1685..1687,
                     1691..1696,1700..1702,1745..1747)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173623"
     misc_feature    order(1358..1360,1562..1564,1568..1570,1679..1681,
                     1685..1687,1691..1693,1754..1756,1802..1813)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173623"
     misc_feature    order(1742..1762,1802..1813)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173623"
     misc_feature    1793..1795
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1805..1807
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03402"
     misc_feature    1805..1807
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2270..2272
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     variation       74
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149509119"
     variation       79
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377047340"
     variation       80
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371482353"
     variation       90
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148249059"
     variation       110
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201699710"
     variation       163
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377611375"
     variation       169
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:67503835"
     exon            185..301
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       208
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202208797"
     variation       212
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113539136"
     variation       223
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200512418"
     variation       224
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139078872"
     variation       262
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371635262"
     variation       268
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370115968"
     variation       301
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:60319813"
     exon            302..383
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       322
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12028491"
     variation       325
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201385156"
     variation       346
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150535662"
     variation       376
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149695725"
     exon            384..464
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       387
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373103051"
     variation       436
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2229710"
     variation       460
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376032218"
     exon            465..544
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       520
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371581310"
     variation       530
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375857541"
     exon            545..651
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       556
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376383316"
     variation       571
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372793504"
     variation       583
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4970490"
     variation       592
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199789905"
     exon            652..689
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     exon            690..832
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       721
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141051128"
     variation       738
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:873152"
     variation       745
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147965368"
     variation       751
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367795872"
     variation       776
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141533618"
     variation       787
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:67370581"
     exon            833..903
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       847
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375217524"
     variation       868
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369496197"
     variation       893
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181351346"
     exon            904..992
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       942
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138247663"
     exon            993..1057
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1002
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:66696971"
     exon            1058..1160
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1080
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2229712"
     variation       1083
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201565442"
     variation       1087
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11546001"
     variation       1109
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200823090"
     variation       1136
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370536932"
     variation       1148
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138571702"
     variation       1149
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201153306"
     variation       1151
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372835609"
     exon            1161..1291
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1165
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143984856"
     variation       1178
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138168136"
     variation       1179
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374505864"
     variation       1206
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150753331"
     variation       1209
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373109074"
     variation       1229
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140901694"
     variation       1243
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371215242"
     variation       1246
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375770745"
     variation       1263
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201413022"
     variation       1271
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200693344"
     variation       1282
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150063775"
     exon            1292..1417
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1324
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149144046"
     variation       1330
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56018615"
     variation       1331
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373923998"
     variation       1351
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375786399"
     exon            1418..1507
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1439
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146829384"
     variation       1469
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372558260"
     variation       1474
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1064196"
     exon            1508..1666
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1528
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112552710"
     variation       1548
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369431738"
     variation       1580
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138370781"
     variation       1604
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144489369"
     variation       1609
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143525775"
     variation       1610
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199860173"
     variation       1632
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202075423"
     variation       1663
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369922928"
     exon            1667..1828
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1693
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373074678"
     variation       1702
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200312178"
     variation       1717
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11546000"
     variation       1726
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374126540"
     variation       1735
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116009402"
     variation       1822
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377161355"
     variation       1825
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202239545"
     exon            1829..1905
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1852
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146788594"
     variation       1882
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143490841"
     exon            1906..2023
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1909
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374581897"
     variation       1913
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377725709"
     variation       1924
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371025431"
     variation       1931
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368086441"
     variation       1937
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112905695"
     variation       1959
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149093867"
     variation       1960
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140088113"
     variation       1961
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201508654"
     variation       1964
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369721857"
     exon            2024..2161
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       2047
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80024567"
     variation       2055
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368282746"
     variation       2084
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7417142"
     variation       2125
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145893180"
     exon            2162..3112
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       2178
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367842246"
     variation       2179
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201125214"
     variation       2185
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144389719"
     variation       2212
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2229713"
     variation       2290
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181744837"
     variation       2299
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145772599"
     variation       2300
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2229714"
     variation       2327
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:282179"
     variation       2331
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151125319"
     variation       2358
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141078619"
     variation       2397
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12121702"
     STS             2422..3102
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /standard_name="RPS6KA1_8600"
                     /db_xref="UniSTS:468658"
     variation       2467
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111709494"
     variation       2474
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372547001"
     variation       2490
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377553777"
     variation       2512
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:12118436"
     variation       2593
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371766931"
     variation       2599
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41303623"
     variation       2609
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114390260"
     variation       2615
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137855096"
     variation       2677
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186868052"
     variation       2682
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11113"
     variation       2693
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:14071"
     STS             2756..3086
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /standard_name="SHGC-74446"
                     /db_xref="UniSTS:81238"
     STS             2774..2902
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /standard_name="G34845"
                     /db_xref="UniSTS:18551"
     variation       2781
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41303625"
     variation       2801
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117144131"
     variation       2849
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1804418"
     STS             2861..3010
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /standard_name="RH70250"
                     /db_xref="UniSTS:78250"
     variation       2911
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7726"
     variation       3012
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192064574"
     variation       3013
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376910879"
     polyA_signal    3090..3095
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
     polyA_site      3108
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
     polyA_site      3112
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
ORIGIN      
ccccggactctgcctgctcctgccatggtgccgtggccctgctgggcggatggagcaggatcccaagccgccccgtctgcggctctgggccctgatcccctggcttcccaggaagcagcggcccaggatcagccagacctctctgcctgtccctggccctggctctggcccccagcgggactcggatgagggcgtcctcaaggagatctccatcacgcaccacgtcaaggctggctctgagaaggctgatccatcccatttcgagctcctcaaggttctgggccagggatcctttggcaaagtcttcctggtgcggaaagtcacccggcctgacagtgggcacctgtatgctatgaaggtgctgaagaaggcaacgctgaaagtacgtgaccgcgtccggaccaagatggagagagacatcctggctgatgtaaatcacccattcgtggtgaagctgcactatgccttccagaccgagggcaagctctatctcattctggacttcctgcgtggtggggacctcttcacccggctctcaaaagaggtgatgttcacggaggaggatgtgaagttttacctggccgagctggctctgggcctggatcacctgcacagcctgggtatcatttacagagacctcaagcctgagaacatccttctggatgaggagggccacatcaaactcactgactttggcctgagcaaagaggccattgaccacgagaagaaggcctattctttctgcgggacagtggagtacatggcccctgaggtcgtcaaccgccagggccactcccatagtgcggactggtggtcctatggggtgttgatgtttgagatgctgacgggctccctgcccttccaggggaaggaccggaaggagaccatgacactgattctgaaggcgaagctaggcatgccccagtttctgagcactgaagcccagagcctcttgcgggccctgttcaagcggaatcctgccaaccggctcggctccggccctgatggggcagaggaaatcaagcggcatgtcttctactccaccattgactggaataagctataccgtcgtgagatcaagccacccttcaagccagcagtggctcagcctgatgacaccttctactttgacaccgagttcacgtcccgcacacccaaggattccccaggcatcccccccagcgctggggcccatcagctgttccggggcttcagcttcgtggccaccggcctgatggaagacgacggcaagcctcgtgccccgcaggcacccctgcactcggtggtacagcaactccatgggaagaacctggtttttagtgacggctacgtggtaaaggagacaattggtgtgggctcctactctgagtgcaagcgctgtgtccacaaggccaccaacatggagtatgctgtcaaggtcattgataagagcaagcgggatccttcagaagagattgagattcttctgcggtatggccagcaccccaacatcatcactctgaaagatgtgtatgatgatggcaaacacgtgtacctggtgacagagctgatgcggggtggggagctgctggacaagatcctgcggcagaagttcttctcagagcgggaggccagctttgtcctgcacaccattggcaaaactgtggagtatctgcactcacagggggttgtgcacagggacctgaagcccagcaacatcctgtatgtggacgagtccgggaatcccgagtgcctgcgcatctgtgactttggttttgccaaacagctgcgggctgagaatgggctcctcatgacaccttgctacacagccaactttgtggcgcctgaggtgctgaagcgccagggctacgatgaaggctgcgacatctggagcctgggcattctgctgtacaccatgctggcaggatatactccatttgccaacggtcccagtgacacaccagaggaaatcctaacccggatcggcagtgggaagtttaccctcagtgggggaaattggaacacagtttcagagacagccaaggacctggtgtccaagatgctacacgtggatccccaccagcgcctcacagctaagcaggttctgcagcatccatgggtcacccagaaagacaagcttccccaaagccagctgtcccaccaggacctacagcttgtgaagggagccatggctgccacgtactccgcactcaacagctccaagcccaccccccagctgaagcccatcgagtcatccatcctggcccagcggcgagtgaggaagttgccatccaccaccctgtgaggcaccagggcattcgggccacagggcggtgctagcttgacacagtcagcatgcttcccagagggagcaggccggaaccacagggccagagggagctggaacccgaggggccggggaagctgccagcccagaacacccctaatgagggtgtgagaagtgccttctccttccccaggatggactcttctcggctcaggctctgctggtggaaagcgattcactgtataaacttttttttatgaaaaaaatggcatcaaccaccatggatttttacaagatccatttgcctttctgggagcagaaacagccattgcggccccaggaggggaactgagtcacgctggggctctctgagactctttagagcagctttgggatcccaccctggggacccccacgattggccacctgtagccatctgcacacacctccgagacagtccagtgtcacctctctcagagcatctggctgtttagcagaactcattctatccccaatcagctccttttccgttctgttctgctgggagttctagaaccacttcctgctacaggaggggtctcatgtcctgctggcttccagcttcaggcaccagcatccaccttggctctgccagtggatcccctgcggtcaggctgggcagccccagagagaggatgtggaaagcactttttggctgacttcatctggggttggcaacaggacagagttcacaggaggccagtgggcgggccatgagggacagggtcttttttcatttcttcctcagctggttactcagggttcatctgtccatggcctttctaataaactgttgagttgaagcac
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:6195 -> Molecular function: GO:0000287 [magnesium ion binding] evidence: IEA
            GeneID:6195 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
            GeneID:6195 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:6195 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:6195 -> Molecular function: GO:0043027 [cysteine-type endopeptidase inhibitor activity involved in apoptotic process] evidence: IDA
            GeneID:6195 -> Biological process: GO:0002224 [toll-like receptor signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0002755 [MyD88-dependent toll-like receptor signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0002756 [MyD88-independent toll-like receptor signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
            GeneID:6195 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
            GeneID:6195 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
            GeneID:6195 -> Biological process: GO:0007411 [axon guidance] evidence: TAS
            GeneID:6195 -> Biological process: GO:0030307 [positive regulation of cell growth] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034134 [toll-like receptor 2 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034138 [toll-like receptor 3 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034142 [toll-like receptor 4 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034146 [toll-like receptor 5 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034162 [toll-like receptor 9 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034166 [toll-like receptor 10 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0035666 [TRIF-dependent toll-like receptor signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0038123 [toll-like receptor TLR1:TLR2 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0038124 [toll-like receptor TLR6:TLR2 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IMP
            GeneID:6195 -> Biological process: GO:0043154 [negative regulation of cysteine-type endopeptidase activity involved in apoptotic process] evidence: IDA
            GeneID:6195 -> Biological process: GO:0043555 [regulation of translation in response to stress] evidence: TAS
            GeneID:6195 -> Biological process: GO:0043620 [regulation of DNA-dependent transcription in response to stress] evidence: TAS
            GeneID:6195 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
            GeneID:6195 -> Biological process: GO:0045597 [positive regulation of cell differentiation] evidence: TAS
            GeneID:6195 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IMP
            GeneID:6195 -> Biological process: GO:0048011 [neurotrophin TRK receptor signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0051403 [stress-activated MAPK cascade] evidence: TAS
            GeneID:6195 -> Biological process: GO:2000491 [positive regulation of hepatic stellate cell activation] evidence: IMP
            GeneID:6195 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:6195 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:6195 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:6195 -> Cellular component: GO:0005819 [spindle] evidence: IEA
            GeneID:6195 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001006666 -> EC 2.7.11.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.